Polyhydroxy nucleic acid carrier and application thereof in preparation of medicine for treating explosive hepatitis

Abstract

The invention relates to the field of novel biomedical materials, in particular to a polyhydroxy nucleic acid carrier and application thereof in preparation of drugs for treating explosive hepatitis. The nanoparticle provided by the invention is obtained based on direct action of a polyhydroxy branched cationic gene carrier and a TNF-alpha silent gene and centrifugal ultrafiltration concentration, the preparation process is simple and easy to operate, the nanoparticle can be degraded into therapeutic micromolecules under the action of a reducing agent, the bioavailability and the therapeutic effect of a medicine are improved, and the application of the nanoparticle to preparation of the TNF-alpha silent gene is facilitated. Meanwhile, the antibacterial performance is good, infection source bacteria can be removed, meanwhile, the good oxidation resistance and free nucleic acid adsorption performance are achieved, and damage to the liver caused by the in-vivo explosive oxidation environment of sepsis and other bacterial infection diseases can be relieved. In addition, TNF-alpha silent genes can be released, on one hand, release of inflammatory cytokines TNF-alpha in the body can be reduced so as to prevent shock, and on the other hand, polarization of macrophages to M1 can be reduced so as to relieve liver injury and improve patient prognosis.

Description

Technical Field

[0001] This application relates to the field of new biomedical materials, and particularly to a polyhydroxy nucleic acid carrier and its application in the treatment of sepsis-induced fulminant hepatitis, including the preparation of nanoparticles with functions of regulating macrophage polarization, antibacterial, anti-inflammatory, etc. by assembling a polyhydroxy gene carrier and a TNF-α silencing gene. Background Art

[0002] Sepsis is a life-threatening organ dysfunction caused by the dysregulation of the host's immune response to infection, and is one of the main causes of infection-related deaths globally. The latest data shows that there are approximately 48.9 million cases of sepsis worldwide every year, with a mortality rate as high as 19.7%. The etiology of sepsis is complex, the disease progresses rapidly, and there are significant individual differences, making it difficult to achieve effective treatment (see So, J.L., Aeju, L., Seung, R., H., Inchan, Y., Kwangmeyung, K., Mol. Ther., 2014, 22(2), 397-408.). Mechanistically, the production and release of various inflammatory mediators, such as lipopolysaccharide (LPS), reactive oxygen species (ROS), cell-free DNA (cfDNA), and nitric oxide (NO), induce sepsis. If these circulating inflammatory mediators in the body are not cleared in time, they will continuously induce systemic inflammation in patients, and then cause irreversible damage to endothelial cells, epithelial cells, and immune cells, ultimately leading to organ damage or failure.

[0003] Among them, the liver, as the most metabolically active organ in the body, plays a key role in detoxification, energy production, nutrient conversion, hormone balance, and blood coagulation. In addition, the liver is also the core organ of metabolic homeostasis and immune regulation. Due to its unique anatomical location, the liver is directly exposed to bacteria, antigens, and endotoxins from gut microbiota and their metabolites. Therefore, fulminant hepatitis is more likely to occur during sepsis, resulting in liver damage. A study of 320 hospitalized sepsis patients found that liver injury usually appears in the early stage of sepsis development and is a significant early clinical symptom (see Jun, Y., Song, L., Shunlin, L., Int. Rev. Immunol., 2014, 33(6), 498-510.). In addition, patients with liver injury usually have a poor prognosis. Therefore, reducing liver injury during sepsis is crucial for controlling the disease and achieving potential recovery.

[0004] The liver is the main organ of the mononuclear phagocyte system (MPS), containing a high density of resident macrophages, namely Kupffer cells, which play a key role in pathogen defense and immune regulation. In the early stage of sepsis, macrophages are over-activated due to pathogen invasion, releasing a large amount of tumor necrosis factor α (TNF-α), which may lead to shock and organ failure. In the late stage of sepsis, macrophages transform into a tolerant phenotype due to repeated exposure to cytokines, resulting in weakened pathogen phagocytosis and a tendency to undergo apoptosis, pyroptosis or necrosis, thus exacerbating the patient's condition. Therefore, it is extremely important to inhibit the overexpression of TNF-α. Reducing TNF-α expression can not only change the macrophage phenotype, but also restore its phagocytic ability, reduce the secretion of pro-inflammatory cytokines, relieve the cytokine storm, and enhance the pathogen clearance ability. Although TNF-α antagonists (such as etanercept) are often clinically used as cytokine inhibitors, there are many disadvantages in clinical treatment. For example, small molecule antagonists lack targeting, and systemic penetration after administration leads to insensitivity or inactivation of systemic immune receptors (such as TLR), thus increasing the risk of secondary pathogen infection. Gene therapy-mediated transient TNF-α silencing can achieve balanced immunomodulation with fewer side effects through the design of gene vectors and nanodrug delivery strategies, but there is less research on gene therapy for sepsis. This may be because the inducing factors of sepsis are complex and the disease progresses rapidly, while the therapeutic gene has poor stability, fast clearance rate and low delivery efficiency in vivo. In summary, there is an urgent need to develop an efficient gene vector with the function of clearing inflammatory mediators.

[0005] Although cationic polymer carriers such as PEI 25k are effective for nucleic acid delivery and can reduce the activation of NF-κB by adsorbing free nucleic acids, thus alleviating the progression of sepsis, their high biotoxicity and lack of degradability limit their application. Studies have shown that branched gene carriers constructed from aminoglycoside antibiotics have high antibacterial activity and efficient gene delivery ability, and the glycoside structure helps to disperse positive charges and enhance biocompatibility. However, these carriers still lack degradability, which may produce unnecessary biotoxicity. Summary of the Invention

[0006] In view of this, the present application provides a polyhydroxy nucleic acid carrier (a redox-responsive cationic branched gene carrier based on aminoglycoside antibiotics, SS-HPT) and its application in the treatment of sepsis-induced fulminant hepatitis, which can utilize reducibility to scavenge reactive oxygen species, achieve controlled release of the small molecule antibiotic tobramycin by biodegradability, adsorb excess free nucleic acids and deliver TNF-α silencing gene (pshTNF-α) by positive charges, and inhibit macrophage polarization to M1 by reducing TNF-α secretion. This nanosystem can effectively eliminate pathogens and excess inflammatory factors, regulate TNF-α release and macrophage phenotype, inhibit the progression of sepsis and protect the body's core metabolic organ, the liver, reduce mortality and improve the prognosis of patients while reducing the abuse of antagonists and antibiotics.

[0007] In order to achieve the above-mentioned invention object, the present application provides the following technical solutions:

[0008] The present application provides nanoparticles, comprising a polyhydroxy nucleic acid carrier and a nucleic acid molecule for silencing TNF-α;

[0009] The polyhydroxy nucleic acid carrier comprises a branched cationic gene carrier grafted with an aminoglycoside antibiotic and having GSH responsiveness;

[0010] The branched cationic gene carrier grafted with an aminoglycoside antibiotic and having GSH responsiveness comprises SS-HPT.

[0011] In some specific embodiments of the present application, the branched cationic gene carrier grafted with an aminoglycoside antibiotic of the above-mentioned nanoparticles is obtained by ring-opening polymerization of diglycidyl disulfide with an aminoglycoside antibiotic.

[0012] In some specific embodiments of the present application, the aminoglycoside antibiotic of the above-mentioned nanoparticles comprises at least one of streptomycin, kanamycin, gentamicin, neomycin, tobramycin, and plazomicin.

[0013] In some specific embodiments of the present application, the nucleic acid molecule of the above-mentioned nanoparticles expresses an oligonucleotide molecule, and the oligonucleotide molecule has:

[0014] (1) a nucleotide sequence as shown in SEQ ID NO: 1; or

[0015] (2) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (1), and having the same or similar function as that of (1); or

[0016] (3) a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in (1) or (2).

[0017] In some specific embodiments of the present application, the nucleic acid molecule of the above-mentioned nanoparticles has:

[0018] (4), a nucleotide sequence as shown in SEQ ID NO:4; or

[0019] (5), a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (4), and having the same or similar function as (4); or

[0020] (6), a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in (4) or (5).

[0021] In some specific embodiments of the present application, the nucleic acid molecule of the above-mentioned nanoparticles has:

[0022] (7), a nucleotide sequence as shown in SEQ ID NO:5; or

[0023] (8), a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (7), and having the same or similar function as (7); or

[0024] (9), a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in (7) or (8).

[0025] In some specific embodiments of the present application, the nucleic acid molecule of the above-mentioned nanoparticles may be a plasmid and has:

[0026] (10), a nucleotide sequence as shown in SEQ ID NO:6; or

[0027] (11), a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (10), and having the same or similar function as (10); or

[0028] (12), a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in (10) or (11);

[0029] The plurality is from 2 to 10.

[0030] In some specific embodiments of the present application, the nucleic acid molecule of the above-mentioned nanoparticles may be a lentiviral vector, which may be pLKO.1-Puro.

[0031] In some specific embodiments of the present application, the mass ratio of the polyhydroxy nucleic acid carrier of the above-mentioned nanoparticles to the nucleic acid molecule is one of 50:1, 60:1, 70:1 or the range formed by any two of them.

[0032] The present application also provides a method for preparing the above-mentioned nanoparticles, which includes: mixing a buffering substance, the polyhydroxy nucleic acid carrier and the nucleic acid molecule, vortexing, and ultrafiltration centrifugation to obtain the nanoparticles.

[0033] In some specific embodiments of the present application, the above-mentioned preparation method includes the following steps:

[0034] Disperse the polyhydroxy nucleic acid carrier in the buffering substance, then mix with the nucleic acid molecule, vortex, stand still, and perform ultrafiltration centrifugation to obtain the nanoparticles.

[0035] In some specific embodiments of the present application, the above-mentioned dispersion is ultrasonic dispersion, and the dispersion time can be one of 30s, 35s, 40s, 45s, 50s, 55s, 60s or any range formed by any two of them.

[0036] In some specific embodiments of the present application, the rotation speed of the above-mentioned vortex can be one of 10rpm, 15rpm, 20rpm or any range formed by any two of them.

[0037] In some specific embodiments of the present application, the temperature for standing still in the above-mentioned preparation method can be one of 20°C, 21°C, 22°C, 23°C, 24°C, 25°C or any range formed by any two of them.

[0038] In some specific embodiments of the present application, the standing time in the above-mentioned preparation method can be one of 8min, 9min, 10min, 11min, 12min, 13min, 14min, 15min or any range formed by any two of them.

[0039] In some specific embodiments of the present application, the cut-off amount of the ultrafiltration tube used in the above-mentioned ultrafiltration centrifugation can be 3000Da or 100000Da.

[0040] In some specific embodiments of the present application, the above-mentioned buffering substance is Opti-MEM medium.

[0041] The present application also provides the nanoparticles prepared by the above-mentioned preparation method.

[0042] The present application also provides the application of the above-mentioned nanoparticles in any of the following items:

[0043] (I) Anti-inflammatory and / or antibacterial;

[0044] (II) Regulating macrophage polarization;

[0045] (III) Improving sepsis;

[0046] (IV) Adjusting the level of serum aspartate aminotransferase;

[0047] (V) Treating liver injury;

[0048] The liver injury includes sepsis-induced liver injury;

[0049] The liver injury includes fulminant hepatitis.

[0050] This application also provides the use of the above nanoparticles in any of the following:

[0051] (i) Preparing an anti-inflammatory and / or antibacterial preparation;

[0052] (ii) Preparing a preparation for regulating macrophage polarization;

[0053] (iii) Preparing a preparation for improving sepsis;

[0054] (iv) Preparing a preparation for regulating the level of serum aspartate aminotransferase;

[0055] (v) Preparing a preparation for treating liver injury;

[0056] The liver injury includes sepsis-induced liver injury;

[0057] The liver injury includes fulminant hepatitis.

[0058] In some specific embodiments of this application, the liver injury in the above use may be fulminant hepatitis.

[0059] This application also provides a preparation comprising the above nanoparticles.

[0060] In some specific embodiments of this application, the above preparation further comprises an acceptable excipient or adjuvant.

[0061] This application also provides a drug comprising the above nanoparticles or the above preparation.

[0062] In some specific embodiments of this application, the above drug further comprises an acceptable excipient or adjuvant.

[0063] This application also provides a treatment method, including treating based on the above nanoparticles or the above drug.

[0064] In some specific embodiments of this application, the above treatment method includes a method for improving sepsis or a method for treating fulminant hepatitis.

[0065] The present invention has the following beneficial effects:

[0066] This application provides a polyhydroxy nucleic acid carrier for the treatment of sepsis-induced fulminant hepatitis, and also provides nanoparticles with functions of regulating macrophage polarization, antibacterial, anti-inflammatory, etc., prepared by assembling a polyhydroxy gene carrier and a TNF-α silencing gene. After analysis, the polyhydroxy nucleic acid carrier is a redox-responsive cationic branched gene carrier (SS-HPT) based on aminoglycoside antibiotics. This carrier can utilize reducibility to scavenge reactive oxygen species, achieve controlled release of the small molecule antibiotic tobramycin using degradability, adsorb excess free nucleic acid and deliver the TNF-α silencing gene (pshTNF-α) using positive charges, and inhibit macrophage polarization to M1 by reducing TNF-α secretion. Experimental results show that this nanosystem can effectively clear pathogens and excess inflammatory factors, regulate TNF-α release and macrophage phenotype, and inhibit liver injury caused by sepsis-induced fulminant hepatitis. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the following will briefly introduce the drawings required for description in the embodiments or the prior art.

[0068] Figure 1 Transmission electron microscope picture of the SS-HPT / pshTNF-α nanoparticles obtained in Example 14;

[0069] Figure 2 Transfection effect of the SS-HPT / pshTNF-α-EGFP nanoparticles obtained in Examples 9-16 on cells;

[0070] Figure 3 Degradability of the polyhydroxy nucleic acid carrier obtained in Example 14;

[0071] Figure 4 Biosafety of the nanoparticles obtained in Examples 17-22;

[0072] Figure 5 Antioxidant property of the nanoparticles obtained in Example 14;

[0073] Figure 6 Inhibitory effect of the nanoparticles obtained in Example 14 on Gram-negative bacteria;

[0074] Figure 7 Survival time of mice with fulminant hepatitis extended by the nanoparticles obtained in Example 14;

[0075] Figure 8 Regulation of macrophage phenotype in the liver of mice with fulminant hepatitis by the nanoparticles obtained in Example 14;

[0076] Figure 9The nanoparticles obtained in Example 14 reduce the content of aspartate aminotransferase in the liver;

[0077] Figure 10 The nanoparticles obtained in Example 14 reduce liver injury;

[0078] Figure 11 Shows the alleviating effects of different sequences on oxidative stress in liver injury mice. Detailed implementation manners

[0079] This application discloses a polyhydroxy nucleic acid carrier and its application in the treatment of sepsis-induced fulminant hepatitis. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in this application. The methods and applications of this application have been described through preferred embodiments. Relevant personnel can obviously make changes or appropriate modifications and combinations to the methods and applications described herein without departing from the content, spirit and scope of this application to implement and apply the technical invention of this application.

[0080] This application provides an aminoglycoside antibiotic-based redox-responsive cationic branched gene carrier (SS-HPT) and a TNF-α silencing gene, which are complexed by electrostatic interaction and nanoparticles are obtained after ultrafiltration and concentration. The carrier can utilize reducibility to scavenge reactive oxygen species, utilize degradability to achieve controlled release of the small molecule antibiotic tobramycin, utilize positive charges to adsorb excess free nucleic acids and deliver the TNF-α silencing gene (pshTNF-α), and inhibit macrophage polarization to M1 by reducing TNF-α secretion. Experimental results show that this nanosystem can effectively clear pathogens and excess inflammatory factors, regulate TNF-α release and macrophage phenotype, inhibit the progression of sepsis and protect the body's core metabolic organ, the liver, reduce mortality and improve the prognosis of patients while reducing the abuse of antagonists and antibiotics.

[0081] In some specific embodiments, the aminoglycoside antibiotic includes one or more of streptomycin, kanamycin, gentamicin, neomycin, tobramycin, and plazomicin.

[0082] In some specific embodiments, the TNF-α silencing gene sequence is 5'-GACAACCAACUAGUGGUGCdTdT-3' (SEQ ID NO: 1), and the plasmid vector can be pLKO.1-Puro.

[0083] In some specific embodiments, the target sequence of the TNF-α silencing gene is GACAACCAAC TAGTGGTGC, SEQ ID NO: 4.

[0084] In some specific embodiments, the TNF-α silencing gene exists in the form of an expression vector containing the TNF-α silencing gene, and the corresponding sequence of the shRNA expressed on the expression vector is GACAAC CAACTAGTGGTGCCTCGAGGCACCACTAGTTGGTTGTCTTTTT (SEQ ID NO:5).

[0085] In some specific embodiments, the TNF-α silencing gene exists in the form of a plasmid containing the TNF-α silencing gene, with a backbone of pLKO.1-Puro, and the overall sequence is as follows:

[0086] ttggggttgcgccttttccaaggcagccctgggtttgcgcagggacgcggctgctctgggcgtggttccggga

[0087] aacgcagcggcgccgaccctgggtctcgcacattcttcacgtccgttcgcagcgtcacccggatcttcgccgctaccc

[0088] ttgtgggccccccggcgacgcttcctgctccgcccctaagtcgggaaggttccttgcggttcgcggcgtgccggacgt

[0089] gacaaacggaagccgcacgtctcactagtaccctcgcagacggacagcgccagggagcaatggcagcgcgccga

[0090] ccgcgatgggctgtggccaatagcggctgctcagcagggcgcgccgagagcagcggccgggaaggggcggtgc

[0091] gggaggcggggtgtggggcggtagtgtgggccctgttcctgcccgcgcggtgttccgcattctgcaagcctccgga

[0092] gcgcacgtcggcagtcggctccctcgttgaccgaatcaccgacctctctccccagggggatccaccggagcttacca

[0093] tgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccg

[0094]

[0095]

[0096]

[0097] In some specific embodiments, the mass ratio of the GSH-responsive branched cationic gene carrier grafted with aminoglycoside antibiotics to the TNF-α silencing gene is preferably (50-70):1, more preferably (60-70):1.

[0098] In some specific embodiments, in the preparation process of a multifunctional nanoparticle for regulating macrophage polarization and having antibacterial and anti-inflammatory effects, the GSH-responsive branched cationic gene carrier grafted with aminoglycoside antibiotics (for the preparation method, see: Yajun, H., Xiaokang, D., Yu, Q., Bingran, Y., Biomaterials, 2016, 106, 134-143) is dispersed in enzyme-free water and ultrasonically dispersed for 30-60 s, preferably 30-50 s, more preferably 30-40 s. The TNF-α silencing gene is quickly added and then vortexed, and the vortex rotation speed is preferably 10-20 rpm, more preferably 15 rpm. The vortex time of the complex is preferably 30-60 s, more preferably 30-40 s, and it is left to stand at 20-25 °C for 8-15 min, more preferably 15 min. The cut-off amount of the ultrafiltration tube is preferably 3000-100000 Da, more preferably 3000-10000 Da.

[0099] In some specific embodiments, the preparation method of the above-mentioned aminoglycoside antibiotic-grafted branched cationic gene carrier with GSH responsiveness includes: adding 2.5 mmol (665 mg) of dithioglycerol ether (HDDE) to 5 mL of dimethyl sulfoxide (DMSO) containing 1 mmol of aminoglycoside drug (467 mg of tobramycin) to obtain a reaction mixture. The reaction mixture is bubbled with nitrogen gas for 10 min to remove the gas therein, and then 300 μL of triethylamine (TEA) is added. Subsequently, the reaction is carried out under nitrogen protection at 40 °C with continuous stirring. After 24 h, an excessive amount of ethylenediamine (ED, 1.0 mL) is added to the reaction mixture, and the reaction is continued at 60 °C for 1 h to terminate the hyperbranched reaction. The crude product is dialyzed in deionized water using a dialysis bag with a molecular weight cut-off of 1000 to remove unreacted small molecules, and then the hyperbranched product (i.e., SS-HPT prepared from tobramycin) is freeze-dried.

[0100] Preparation of the multifunctional nanoparticles for regulating macrophage polarization, antibacterial, and anti-inflammatory effects and their application in the treatment of infectious liver injury described in this application.

[0101] This application also discloses a dissociation process of the multifunctional nanoparticles for regulating macrophage polarization, antibacterial, and anti-inflammatory effects. After the action of a reducing agent, the nanoparticles dissociate, releasing aminoglycoside antibiotics and positively charged molecules, which can eliminate bacteria in vivo (including Gram-negative and Gram-positive bacteria), adsorb free nucleic acids, release regulatory genes to reduce the level of TNF-α, relieve the deterioration of sepsis, and reduce liver injury.

[0102] The reducing agent is preferably one of dithiothreitol (DTT), glutathione (GSH), and tris(2-carboxyethyl)phosphine hydrochloride (TCEP), and the reducing agent is preferably dithiothreitol (DTT) or glutathione (GSH).

[0103] According to this application, for the dissociation of the multifunctional nanoparticles for regulating macrophage polarization, antibacterial, and anti-inflammatory effects, the molar amount of the reducing agent used is preferably 1 to 20 mM, more preferably 5 to 10 mM, and the in vitro dissociation time is preferably 4 to 8 h, more preferably 6 to 8 h.

[0104] The preparation process of the nanoparticles in this application is simple and easy to operate; the nanoparticles can be degraded in a short time under the action of low-concentration DTT, releasing small molecule antibiotics and positively charged molecules, which is beneficial to achieving good antibacterial performance and free nucleic acid adsorption performance; the nanoparticles have good gene transfection performance and can be used to transfect TNF-α silencing genes, regulate the macrophage phenotype in vivo, reduce the release of inflammatory cytokines, relieve sepsis-induced fulminant hepatitis, and improve the prognosis of patients.

[0105] The experimental operation steps involved in the embodiments of this application are all methods well-known to those skilled in the art and are not subject to special limitations. Specifically:

[0106] (1) Cell culture: In this application, cell lines such as 293T, RAW264.7, and BMDM are selected. The cell culture method is a method well-known to those skilled in the art and is not subject to special limitations. In this application, DMEM medium containing 10% fetal bovine serum and RPMI 1640 containing 10% fetal bovine serum are preferably used to culture the cells. The culture conditions are preferably continuous culture in an incubator with a volume fraction of 5% carbon dioxide, and the culture temperature is preferably 37°C.

[0107] (2) Cytotoxicity: In this application, the RAW264.7 cell line is selected for cytotoxicity evaluation. The cells are seeded in a 96-well plate at a density of 1.0×10 4 and cultured overnight. After co-culturing different concentrations of the material with the cells for 24 h, 20 μL of CCK-8 solution is added to each well and cultured for another 1 h. The absorbance value of each well at 450 nm is detected by an enzyme-linked immunosorbent assay (ELISA) reader. The cell survival rate is calculated by the following formula.

[0108] Cell survival rate (%) = (A sample - A blank) × 100 / (A control - A blank)

[0109] (3) Cell gene transfection ability: In this application, for the test of the gene loading ability and cell transfection ability of the material, nanoparticles are assembled by mixing different mass ratios of the material with a gene labeled with green fluorescent protein. The obtained nanoparticles are co-incubated with 293T cells at 37°C for 24 h, and the transfection effect is photographed using a fluorescence inverted microscope.

[0110] (4) Degradability: In this application, DNA gel electrophoresis and transmission electron microscopy are selected for the test of the degradability of the material. The nanoparticles assembled from the material are co-incubated with 10 mM DTT at 37°C for 2 - 8 h, and then samples are taken for negative staining and photographed using a transmission electron microscope; nanoparticles with different material-to-plasmid mass ratios are added to the DNA gel electrophoresis tank at 10 μL and the DNA leakage is tested at a voltage of 120 V.

[0111] (5) Total antioxidant capacity: For the test of the total antioxidant capacity of the nanoparticles, the FRAP method is selected. First, a 0.3 - 1.5 mM FeSO4 solution is prepared as a standard sample, and then nanoparticles with a final concentration of 1 - 64 μg / mL are prepared. The above solutions are respectively added to a 96-well plate containing the detection solution, incubated at room temperature for 5 min, and the absorbance of the mixture at a wavelength of 593 nm is detected using an ELISA reader.

[0112] (6) Hydroxyl radical scavenging ability: First, prepare 2 mM CuSO4 working solution, 1 mM 3,3',5,5'-tetramethylbenzidine (TMB) working solution, and 5 mM H2O2 working solution. Then, prepare nanoparticles with different concentration gradients and mix them with the CuSO4 working solution and incubate for 5 min. After that, mix the TMB working solution and H2O2 evenly and add them to the mixture of the material and Cu 2+ . After incubating in a 37°C incubator for 30 min, use a microplate reader to detect the absorbance of the mixture at around 650 nm.

[0113] (7) Superoxide anion scavenging ability: First, prepare 50 U / mL xanthine oxidase, 1 g / mL xanthine, and 3 mg / mL dihydroethidium (DHE) working solutions. Then, dilute the xanthine and xanthine oxidase working solutions and mix them evenly according to a volume ratio of 1:1 and incubate at 37°C for 40 min (the final concentration of xanthine is 0.1 mg / mL, and the final concentration of xanthine oxidase is 0.05 U / mL). Finally, prepare nanoparticles with different concentrations and add them to the above mixture and repeat the incubation at 37°C for 40 min. Use a multifunctional microplate reader to measure the fluorescence spectrum excited at 470 nm and absorbed at 610 nm.

[0114] (8) Antibacterial ability of nanoparticles: In this application, the antibacterial ability test includes the minimum inhibitory concentration (MIC) test, antibacterial kinetic curve, and plate count test. The selected bacterial strains are Gram-negative Escherichia coli and Gram-positive Staphylococcus aureus, and the bacterial culture medium is LB broth medium.

[0115] For the minimum inhibitory concentration (MIC) test, first dilute the bacterial solution to 1×10 5 CFU, and evenly add an equal volume of bacterial culture solution to a 96-well plate. Use the serial dilution method to add nanoparticles or drugs, seal with a sealing film, and incubate at 37°C for 24 h. Use a microplate reader to measure the absorbance at 600 nm.

[0116] For the antibacterial kinetic curve test, first dilute the bacterial solution to 1×10 6CFU, and add an equal volume of bacterial culture solution evenly into a 96-well plate. Add nanoparticles or drugs using the serial dilution method, seal with a sealing film, and incubate at 37 °C. Use a microplate reader to measure the absorbance at 600 nm at 6 h and 12 h, and plot the absorbance change curve of nanoparticles at different concentrations. Additionally, select the minimum inhibitory concentration determined in the above antibacterial experiment. For example, the minimum inhibitory concentration for the Gram-negative bacterium Escherichia coli is 4 μg / mL and the minimum inhibitory concentration for the Gram-positive bacterium Staphylococcus aureus is 8 μg / mL. Similarly, add an equal volume of bacterial culture solution evenly into a 96-well plate, add nanoparticles or free drugs at the minimum inhibitory concentration, seal with a sealing film, and incubate at 37 °C. Use a microplate reader to measure the absorbance at 600 nm every 2 h and plot the absorbance change curve of nanoparticles at the minimum inhibitory concentration.

[0117] For the plate counting experiment, dilute the bacterial solution obtained from the minimum inhibitory concentration MIC test and the antibacterial kinetic curve and spread it evenly on a sterile LB agar plate. Then incubate at 37 °C for 24 h, take a photo, and perform colony counting.

[0118] (9) Macrophage polarization regulation: In this application, mouse bone marrow-derived macrophages (BMDMs) are used in all in vitro macrophage polarization regulation experiments. The specific culture process is as follows: Take the femurs and tibias of mice, remove the muscle tissue, soak and disinfect with 75% ethanol. Then, in a laminar flow hood, use sterile scissors to cut off both ends of the bones, inject pre-cooled RPMI 1640 complete medium into a syringe, and flush the bone marrow into a pre-cooled centrifuge tube. Centrifuge at 1500 rpm for 5 min to collect the cells, and culture with 20 ng / mL M-CSF for 7 days (change half of the medium every other day). The specific macrophage polarization regulation process is as follows: Add LPS (5 ng / mL) to BMDMs and incubate at 37 °C for 20 min. Then add nanoparticles and incubate overnight under the same conditions. Finally, take the cell culture supernatant to test the TNF-α concentration, and take the cells for flow cytometry staining to distinguish macrophage phenotypes.

[0119] (10) Animal model: The animal model in this application is sepsis-induced fulminant hepatitis. The model construction method is as follows: Select male C57 mice weighing 21 - 25 g, routinely disinfect and depilate the abdominal surgical area in an isoflurane gas anesthesia atmosphere. Under sterile conditions, make a cut about 2 cm long on the abdominal wall with a scalpel, enter the abdomen through the incision, separate the distal end of the ileocecal valve, and ligate 1 / 3 of the cecum with a No. 3 silk thread. Then, use an 18-gauge injection needle to puncture the ligated end and squeeze out a little feces, trying to avoid damaging blood vessels. Then, suture the peritoneum and skin intermittently with a No. 4 silk thread, and immediately inject 50 mL / kg body weight of normal saline subcutaneously for shock prevention.

[0120] (11) Evaluation of the therapeutic effect of fulminant hepatitis: Prepare a sufficient amount of nanoparticles and administer them at 24.5 mg / kg at 2 h, 6 h, and 12 h after modeling, and continuously monitor the survival, clinical score, and body weight changes within the subsequent 5 days. Then, take the mouse serum for biochemical detection, take the mouse peritoneal lavage fluid for colony plating to analyze the bacterial content, and take the mouse liver for flow cytometry analysis, enzyme-linked immunosorbent assay, and histopathological analysis of tissue sections.

[0121] It should be understood that the expression "one or more of..." individually includes each of the objects recited after the expression and various different combinations of two or more of the recited objects, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited objects should be understood to have the same meaning, unless otherwise understood from the context.

[0122] The terms "comprising", "having", or "containing", including the use of their grammatical synonyms, should generally be understood as open and non-restrictive, for example, not excluding other unrecited elements or steps, unless specifically stated otherwise or understood from the context.

[0123] It should be understood that as long as the present application is still operable, the order of steps or the order of performing certain actions is not important. In addition, two or more steps or actions can be performed simultaneously.

[0124] The use of any and all examples or exemplary language herein, such as "for example" or "including", is merely intended to better illustrate the present application and does not limit the scope of the present application. No language in this specification should be construed as indicating that any unclaimed element is essential for the practice of the present application.

[0125] In addition, the numerical ranges and parameters used to define the present application are approximate values. The relevant values in the specific embodiments have been presented as precisely as possible herein. However, any value inherently and inevitably contains standard deviations due to individual testing methods. Therefore, unless otherwise explicitly stated, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.

[0126] Unless otherwise specified, the raw materials, reagents, consumables, and instruments involved in the present application are all ordinary commercially available products and can be purchased from the market.

[0127] The present invention will be further described below in conjunction with embodiments.

[0128] Examples 1 to 16

[0129] The GSH-responsive branched cationic gene carrier grafted with an aminoglycoside antibiotic (tobramycin) was dispersed in enzyme-free water or Opti-MEM buffer, and a plasmid containing the TNF-α silencing gene (the plasmid sequence is shown in SEQ ID NO: 6) was rapidly added at room temperature and vortexed and allowed to stand. Finally, nanoparticles were obtained by ultrafiltration and centrifugal concentration. Table 1 shows the mass ratios and complexation times of the aminoglycoside-branched gene carriers and the plasmid containing the TNF-α silencing gene in Examples 1 to 16.

[0130] Table 1

[0131]

[0132] Effect Example 1

[0133] Nanoparticles were prepared according to Example 14, and the nanoparticles obtained in Example 14 were analyzed using a transmission electron microscope. As Figure 1 shown, the results indicate that the average size of the SS-HPT / pshTNF-α nanoparticles prepared in Example 14 was between 80 and 100 nm.

[0134] Effect Example 2

[0135] According to Examples 9 to 16, nanoparticles were assembled from materials with different mass ratios and the gene labeled with green fluorescent protein. The obtained nanoparticles were co-incubated with 293T cells at 37 °C for 24 h, and the transfection effect was photographed using a fluorescence inverted microscope. The experimental results (as shown in the fluorescence microscopic images in Figure 2 ) showed that the nanoparticles obtained in Example 14 had the optimal transfection effect.

[0136] Effect Example 3

[0137] Nanoparticles were prepared according to Example 14 (the mass ratios of SS-HPT to the plasmid were 0:1, 1:4, 1:2, 1:1, 2:1, and 3:1 respectively), and they were co-incubated with 10 mM DTT at 37 °C for 8 h. Subsequently, the nanoparticles were added to a DNA gel electrophoresis tank at 10 μL, and gel electrophoresis was carried out under the conditions of 120 V and 120 min. Finally, the DNA leakage was detected under ultraviolet light irradiation as shown in Figure 3 . The more DNA leakage, the greater the band brightness, indicating that the material degraded under the action of DTT and could not effectively load DNA.

[0138] Examples 17 to 22

[0139] Nanoparticles were prepared according to Example 14, and the RAW264.7 cell line was selected to evaluate cytotoxicity. The above-cultured cells were seeded at 1.0×10 per well 4The density seeds were placed in a 96-well plate and incubated overnight with 200 μL of culture medium. After adding the nanoparticles obtained in Example 14 to the wells at the concentrations shown in Table 2 and co-culturing with the cells for 24 h, 20 μL of CCK-8 solution was added to each well and the incubation continued for 1 h. The absorbance value of each well at 450 nm was detected by an enzyme-linked immunosorbent assay (ELISA) reader and the results were calculated. The working concentrations of the aminoglycoside-branched gene carriers and the TNF-α silencing gene nanoparticles in Examples 17-22 are shown in Table 2.

[0140] Table 2

[0141]

[0142] Effect Example 4

[0143] The cytotoxicity evaluation results of Examples 17-22 are as Figure 4 shown. It can be seen that the nanoparticles have no obvious cytotoxicity below 128 μg / mL, proving that the branched gene carriers constructed with aminoglycoside antibiotics have biosafety.

[0144] Effect Example 5

[0145] The nanoparticles were prepared according to Example 14, and the FRAP method was used to test the change of their antioxidant ability with concentration. First, a 0.3-1.5 mM FeSO4 solution was prepared as a standard sample, mixed evenly with the nanoparticles, and then added to a 96-well plate containing the detection solution so that the final concentration of the nanoparticles was 1-64 μg / mL. Incubate at room temperature for 5 min, and use an ELISA reader to detect the absorbance of the mixture at a wavelength of 593 nm. The results are as Figure 5 shown. As the concentration of the nanoparticles increases, the antioxidant performance gradually increases.

[0146] Effect Example 6

[0147] The nanoparticles were prepared according to Example 14. For the minimum inhibitory concentration (MIC) test, the bacterial solution was first diluted to 1×10 5 CFU, and then an equal volume of bacterial culture solution was evenly added to a 96-well plate. The nanoparticles were added using the serial dilution method, sealed with a sealing film, and incubated at 37 °C for 24 h. The absorbance at 600 nm was measured using an ELISA reader. For the plate coating experiment, the bacterial solution of the MIC test was diluted and evenly coated on a sterile LB agar plate, and then incubated at 37 °C for 24 h. Photographs were taken and colony counting was performed. The results are as Figure 6 shown. The number of colonies in the nanoparticle treatment group was significantly reduced.

[0148] Effect Example 7

[0149] The animal model selected for this application is sepsis-induced fulminant hepatitis, and the model construction method is as follows: Select C57 male mice weighing 21 - 25 g. Under the anesthesia atmosphere of isoflurane gas, the abdominal surgical area is routinely disinfected and depilated. Under sterile conditions, a scalpel is used to make an incision about 2 cm long on the abdominal wall. Through the incision, the abdomen is entered, and 1 / 3 of the cecum is separated and ligated with No. 3 silk thread at the distal end of the ileocecal valve. Then, an 18-gauge injection needle is used to puncture the ligated end, and a little feces is extruded, trying to avoid damaging blood vessels. Then, the peritoneum and skin are sutured intermittently with No. 4 silk thread, and at the same time, 50 mL / kg body weight of normal saline is immediately injected subcutaneously for shock prevention. A sufficient amount of nanoparticles is prepared and administered intraperitoneally at 24.5 mg / kg (24.5 mg nanoparticles / 1 kg mouse body weight) at 2 h, 6 h, and 12 h after modeling, and the survival, clinical score, and body weight changes are continuously monitored within the subsequent 5 days. Then, mouse serum is taken for biochemical detection, mouse peritoneal lavage fluid is taken for colony plating to analyze the bacterial content, and mouse liver is taken for flow cytometry analysis, enzyme-linked immunosorbent assay, and histopathological analysis of tissue sections.

[0150] The results show that the nanoparticles prepared according to Example 14 can effectively improve the survival period of mice ( Figure 7 ), reduce the proportion of M1 macrophages in the liver ( Figure 8 ), reduce the content of aspartate aminotransferase AST ( Figure 9 ), and relieve liver tissue lesions ( Figure 10 ), thus proving that the nanoparticles can effectively relieve sepsis-induced fulminant hepatitis.

[0151] Effect Example 8

[0152] To provide multiple alternative options, the gene sequence was tried to be replaced to verify the effect (with the remaining conditions being the same), such as 5’-CCUACGCCACCAAUUUCGUdTdT-3’ (SEQ ID NO:2), 5’-GTACGTC GATGCAGAGCAAA-3’ (SEQ ID NO:3), but it was found that SEQ ID NO:1 has outstanding antioxidant properties in the liver injury mouse model. As Figure 11 shown, the content (%) of 2’,7’-dichlorofluorescein (DCF), the oxidation product of 2,7-dichlorofluorescein diacetate in the liver of the SEQ ID NO:1 group is significantly lower than that of the SEQ ID NO:2 group and the SEQ ID NO:3 group, indicating that selecting SEQ ID NO:1 can make the level of reactive oxygen species (ROS) in the liver significantly lower, showing more excellent antioxidant properties.

[0153] The above are only the preferred embodiments of the present application. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A nanoparticle, characterized in that, Comprising a polyhydroxy nucleic acid carrier and a nucleic acid molecule for silencing TNF-α; The polyhydroxy nucleic acid carrier includes a branched cationic gene carrier grafted with an aminoglycoside antibiotic and having GSH responsiveness; The branched cationic gene carrier grafted with an aminoglycoside antibiotic includes SS-HPT.

2. The nanoparticle according to claim 1, wherein The nucleic acid molecule expresses an oligonucleotide molecule having: (1) a nucleotide sequence as shown in SEQ ID NO:1; or (2) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (1), and having the same or similar function as (1); or (3) a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in (1) or (2); The plurality is from 2 to 5.

3. The nanoparticle according to claim 1 or 2, characterized in that, The mass ratio of the polyhydroxy nucleic acid carrier to the nucleic acid molecule is (50-70):

1.

4. The method for preparing the nanoparticles according to any one of claims 1 to 3, characterized in that, Comprising: Mixing and vortexing a buffering substance, the polyhydroxy nucleic acid carrier and the nucleic acid molecule, and subjecting to ultrafiltration centrifugation to obtain the nanoparticles.

5. The preparation method according to claim 4, characterized in that, Comprising the following steps: Dispersing the polyhydroxy nucleic acid carrier in the buffering substance, then mixing with the nucleic acid molecule, vortexing, standing, and subjecting to ultrafiltration centrifugation to obtain the nanoparticles.

6. The preparation method according to claim 4 or 5, characterized in that The buffering substance is Opti-MEM medium.

7. Nanoparticles prepared by the preparation method according to any one of claims 4 to 6.

8. Use of the nanoparticles according to any one of claims 1 to 3 or the nanoparticles according to claim 7 in any of the following: (i) Preparing a preparation for improving sepsis; (ii) Preparing a preparation for regulating the level of serum aspartate aminotransferase; (iii) Preparing a preparation for treating liver injury; The liver injury includes fulminant hepatitis.

9. A drug, characterized in that, Comprising the nanoparticles according to any one of claims 1 to 3 or the nanoparticles according to claim 7.

10. The drug according to claim 9, characterized in that, Also comprising acceptable excipients or adjuvants.

Images