Application of composition in preparation of osteoarthritis medicine

Abstract

The invention provides application of a composition in preparation of an osteoarthritis medicine, and belongs to the technical field of arthritis. The composition comprises helicid, N-acetylcysteine, seaweed oligopeptide and PDGF (Platelet Derived Growth Factor), and the chondrogenic differentiation capability and migration capability of cartilage stem cells in an inflammatory environment are remarkably enhanced through the combination of combined medicines. Besides, in an SD rat gonitis model, the Wakitani histological score of the cartilage stem cells treated by the enhanced culture medium is reduced from 8.83 to 2.17 + / -0.98, and the repairing effect is superior to that of a traditional method. Therefore, the invention provides a basis for efficient treatment of osteoarthritis.

Description

Technical Field

[0001] The invention belongs to the technical field of arthritis, and in particular relates to application of a composition in the preparation of osteoarthritis medicine. Background Art

[0002] Osteoarthritis (OA) is a chronic degenerative disease characterized by degeneration of articular cartilage, often accompanied by subchondral bone sclerosis, synovial inflammation and periarticular tissue damage. The pathogenesis of OA is complex, involving multiple factors such as mechanical stress, release of inflammatory factors, chondrocyte metabolic disorders and cartilage matrix degradation. At present, the treatment of OA mainly includes drug therapy (such as non-steroidal anti-inflammatory drugs), physical therapy and surgical intervention (such as joint replacement). However, these methods can only relieve symptoms or temporarily improve joint function, and cannot fundamentally solve the problem of cartilage tissue regeneration. In recent years, with the development of regenerative medicine, stem cell therapy is considered to be a potential breakthrough in the treatment of OA, especially the application of chondrogenic stem cells (CSCs) in cartilage repair has attracted widespread attention.

[0003] Chondrogenic stem cells are a type of mesenchymal stem cells with multidirectional differentiation potential, which are widely distributed in cartilage tissue and its microenvironment. These cells can not only differentiate into chondrocytes, but also have the ability to secrete a variety of growth factors and extracellular matrix, playing an important role in maintaining cartilage homeostasis and promoting tissue repair. Studies have shown that CSCs can effectively inhibit cartilage degeneration and promote cartilage regeneration by secreting anti-inflammatory factors (such as IL-10, TGF-β) and synthesizing cartilage-specific matrix components (such as type II collagen and chondroitin sulfate).

[0004] Although CSCs show great potential in cartilage repair, their performance often decreases significantly in the inflammatory environment associated with osteoarthritis. The chronic inflammatory state in the joints of OA patients leads to the release of a large number of proinflammatory factors (such as IL-1β, TNF-α, IL-6), which have multiple negative effects on the function of CSCs, such as reducing the differentiation potential and migration ability of CSCs. In summary, although cartilage stem cells show great application prospects in the treatment of osteoarthritis, their performance decline in the inflammatory environment is still a key problem that needs to be solved. Summary of the invention

[0005] The present invention aims to provide an application of a composition in the preparation of a drug for osteoarthritis, in particular, by enhancing the chondrogenic differentiation and migration ability of cartilage stem cells in an inflammatory environment, significantly improving the therapeutic effect on osteoarthritis. The present invention also discloses an injectable drug for the efficient treatment of osteoarthritis, a preparation method for enhancing the therapeutic ability of cartilage stem cells, and a related culture medium.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides an application of a composition in the preparation of a drug for osteoarthritis, and the composition comprises the following components:

[0008] 20 - 30 μg / mL of helicid and 10 - 20 μg / mL of N-acetylcysteine;

[0009] 90 - 100 μg / mL of seaweed oligopeptide and 20 - 30 μg / mL of platelet-derived growth factor;

[0010] The amino acid sequence of the seaweed oligopeptide is Pro-Asp-Asp-Val-Ala.

[0011] Preferably, the composition is used to treat osteoarthritis by enhancing the chondrogenic differentiation ability and migration ability of mesenchymal stem cells in an inflammatory environment.

[0012] Preferably, the osteoarthritis is knee osteoarthritis.

[0013] In a second aspect, the present invention provides an injection drug for highly effectively treating osteoarthritis diseases, and the injection drug is composed of mesenchymal stem cells with enhanced therapeutic ability and a solvent;

[0014] The mesenchymal stem cells with enhanced therapeutic ability are prepared by the following method:

[0015] (1) Enzymatically digest and culture articular cartilage to obtain mesenchymal stem cells;

[0016] (2) Inoculate the mesenchymal stem cells into a culture vessel and culture until the cells are completely adherent;

[0017] (3) Remove the original culture medium, add a mesenchymal stem cell-enhanced culture medium and continue to culture for 24 - 72 h to obtain the mesenchymal stem cells with enhanced therapeutic ability;

[0018] The components of the mesenchymal stem cell-enhanced culture medium are as follows:

[0019] 20 - 30 μg / mL of helicid and 10 - 20 μg / mL of N-acetylcysteine;

[0020] 90 - 100 μg / mL of seaweed oligopeptide and 20 - 30 μg / mL of platelet-derived growth factor;

[0021] 10% FBS and DMEM / F12 culture medium;

[0022] The amino acid sequence of the seaweed oligopeptide is Pro-Asp-Asp-Val-Ala.

[0023] Preferably, the content of the chondrocyte stem cells with enhanced therapeutic ability in every 50 μL of the injection drug is 1×10 6 cells.

[0024] Preferably, the solvent is PBS or physiological saline.

[0025] In a third aspect, the present invention provides a preparation method for enhancing the osteoarthritis treatment ability of chondrocyte stem cells, which is characterized in that the preparation method includes the following steps:

[0026] (1) Enzymatically digest and culture the articular cartilage to obtain chondrocyte stem cells;

[0027] (2) Inoculate the chondrocyte stem cells into a culture vessel and culture until the cells are completely adherent;

[0028] (3) Remove the original culture medium, add a chondrocyte stem cell enhancing culture medium and continue to culture for 24 - 72 h to obtain chondrocyte stem cells with enhanced therapeutic ability;

[0029] The components of the chondrocyte stem cell enhancing culture medium are as follows:

[0030] 20 - 30 μg / mL helicid and 10 - 20 μg / mL N-acetylcysteine;

[0031] 90 - 100 μg / mL seaweed oligopeptide and 20 - 30 μg / mL platelet-derived growth factor;

[0032] 10% FBS and DMEM / F12 culture medium;

[0033] The amino acid sequence of the seaweed oligopeptide is Pro-Asp-Asp-Val-Ala.

[0034] Preferably, the preparation method enhances the chondrogenic differentiation ability and migration ability of chondrocyte stem cells in an inflammatory environment, thereby improving the osteoarthritis treatment ability.

[0035] In a fourth aspect, the present invention provides a method for enhancing the chondrogenic differentiation ability and migration ability of chondrocyte stem cells in an inflammatory environment, which is characterized in that the method is the same as the above preparation method.

[0036] In a fifth aspect, the present invention provides a culture medium for enhancing the chondrogenic differentiation ability and migration ability of chondrocyte stem cells in an inflammatory environment, and the culture medium is composed of the following components:

[0037] 20 - 30 μg / mL helicid and 10 - 20 μg / mL N-acetylcysteine;

[0038] 90 - 100 μg / mL of seaweed oligopeptide and 20 - 30 μg / mL of platelet-derived growth factor;

[0039] 10% FBS and DMEM / F12 medium;

[0040] The amino acid sequence of the seaweed oligopeptide is Pro - Asp - Asp - Val - Ala.

[0041] Preferably, the medium consists of the following components:

[0042] 20 μg / mL of helicid and 20 μg / mL of N-acetylcysteine;

[0043] 90 μg / mL of seaweed oligopeptide and 30 μg / mL of platelet-derived growth factor;

[0044] 10% FBS and DMEM / F12 medium.

[0045] The beneficial effects of the present invention are as follows:

[0046] By providing a composition, an injection drug and an enhanced medium, the present invention significantly improves the functional performance of chondral stem cells in an inflammatory environment, providing an innovative solution for the treatment of osteoarthritis. After treatment with the enhanced medium, the chondrogenic differentiation ability and migration ability of chondral stem cells are significantly improved, and the expression level of COL2A1 gene and the cell migration rate are both superior to those of cells under normal culture conditions, which can effectively promote cartilage regeneration and tissue repair. In addition, the combined use of combined drug A (helicid + NAC) and combined drug B (seaweed oligopeptide + PDGF) shows a significant synergistic effect, and the synergy coefficient q value is greater than 1.15, further optimizing the functional performance of chondral stem cells.

[0047] Meanwhile, the present invention shows excellent therapeutic effects in animal model experiments. Especially in the SD rat knee arthritis model, the chondral stem cells treated with the enhanced medium significantly reduce the Wakitani histological score, from 8.83 in the model group to 2.17 ± 0.98, indicating that it can effectively improve cartilage damage and inflammatory response. Description of the Drawings

[0048] Figure 1 Shows the differences in the relative expression levels of COL2A1 gene among different experimental groups and control groups under the treatment of IL-1β inflammatory factor;

[0049] Figure 2 Shows the differences in cell migration rates among different experimental groups and control groups under the treatment of IL-1β inflammatory factor;

[0050] Figure 3 Shows the differences in the therapeutic effects of different experimental groups in the SD rat knee arthritis model. Detailed implementation mode

[0051] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0052] Sources of the core components involved in the present invention:

[0053] Helicid (CAS#: 80154-34-3): Nanjing Qingyun Biotechnology Co., Ltd., product number: QY00378;

[0054] N-acetylcysteine (NAC): Merck Life Science, product number: A9165;

[0055] Marine short peptide: synthesized by GL Biochem (Shanghai) Ltd.;

[0056] Platelet-derived growth factor (PDGF): Yeasen Biotechnology (Shanghai), product number: 91609ES10;

[0057] DMEM / F12 medium: Gibco, product number: 11320033;

[0058] Fetal bovine serum (FBS): Gibco, product number: 10270106.

[0059] Example 1

[0060] Obtaining rat chondral stem cells

[0061] Select 5-day-old SD rats and dissect the rats under sterile conditions using sterile scissors and forceps to expose the knee joint;

[0062] Carefully separate the muscles and connective tissues around the knee joint, remove the complete knee joint, peel off the attached cartilage tissue (hyaline cartilage), and wash it in pre-cooled PBS;

[0063] Carefully remove the blood vessels, fat and other non-cartilage tissues on the surface of the cartilage under a stereomicroscope, and use a sterile scalpel to cut the cartilage into small pieces of 1-2 mm 3 in size;

[0064] Transfer the chopped cartilage tissue to a sterile centrifuge tube, add an appropriate amount of 0.25% trypsin solution, incubate at 37°C for 30 minutes, and gently mix every 10 minutes to promote cell release;

[0065] After incubation, wash the cartilage tissue with PBS twice to remove the residual trypsin;

[0066] Add an appropriate amount of collagenase IV and incubate at 37 °C for 4 hours. Gently shake every 30 minutes during incubation. After digestion is completed, filter through a cell sieve (pore size 70 μm) to remove undigested tissue fragments;

[0067] Centrifuge the filtered cell suspension at 1000 rpm for 5 minutes and discard the supernatant.

[0068] Resuspend the cell pellet with complete medium and adjust the cell density to an appropriate concentration (1×10 6 cells / mL). Inoculate the cell suspension into a culture flask, add an appropriate amount of complete medium, and culture in an incubator at 37 °C and 5% CO2;

[0069] Do not change the medium on the first day to allow the cells to adhere. Replace the fresh medium on the second day to remove non-adherent cells and impurities. Change the medium every 2 - 3 days and observe the cell growth;

[0070] When the cell confluence rate reaches 80% - 90%, digest the cells with 0.25% trypsin for subculture, and obtain the 4th - 6th generation of chondrocyte stem cells for subsequent experiments.

[0071] Example 2

[0072] Chondrocyte stem cell enhanced medium a

[0073] The composition of this enhanced medium is as follows:

[0074] Combined drug A: 30 μg / mL helicid and 10 μg / mL NAC (N-acetylcysteine);

[0075] Combined drug B: 100 μg / mL seaweed oligopeptide (amino acid sequence: Pro - Asp - Asp - Val - Ala) and 20 μg / mL PDGF (platelet-derived growth factor);

[0076] DMEM / F12 medium and 10% FBS.

[0077] Example 3

[0078] Chondrocyte stem cell enhanced medium b

[0079] The composition of this enhanced medium is as follows:

[0080] Combined drug C: 20 μg / mL helicid and 20 μg / mL NAC (N-acetylcysteine);

[0081] Combined drug D: 90 μg / mL seaweed oligopeptide (amino acid sequence: Pro - Asp - Asp - Val - Ala) and 30 μg / mL PDGF (platelet-derived growth factor);

[0082] DMEM / F12 medium and 10% FBS.

[0083] Example 4

[0084] Chondrocyte stem cell enhanced medium c

[0085] The composition of the enhanced medium is as follows:

[0086] Combined drug E: 30 μg / mL helicid and 30 μg / mL NAC (N-acetylcysteine);

[0087] Combined drug F: 80 μg / mL seaweed oligopeptide (amino acid sequence: Pro-Asp-Asp-Val-Ala) and 40 μg / mL PDGF (platelet-derived growth factor);

[0088] DMEM / F12 medium and 10% FBS.

[0089] Control 1

[0090] Chondrocyte stem cell comparison medium a

[0091] Combined drug A: 30 μg / mL helicid and 10 μg / mL NAC (N-acetylcysteine);

[0092] DMEM / F12 medium and 10% FBS.

[0093] Control 2

[0094] Chondrocyte stem cell comparison medium b

[0095] Combined drug B: 100 μg / mL seaweed oligopeptide (amino acid sequence: Pro-Asp-Asp-Val-Ala) and 20 μg / mL PDGF (platelet-derived growth factor);

[0096] DMEM / F12 medium and 10% FBS.

[0097] Control 3

[0098] Chondrocyte stem cell comparison medium c

[0099] Combined drug C: 20 μg / mL helicid and 20 μg / mL NAC (N-acetylcysteine);

[0100] DMEM / F12 medium and 10% FBS.

[0101] Control 4

[0102] Chondrocyte stem cell comparison medium d

[0103] Combined drug D: 90 μg / mL algal oligopeptide (amino acid sequence: Pro - Asp - Asp - Val - Ala) and 30 μg / mL PDGF (platelet - derived growth factor);

[0104] DMEM / F12 medium and 10% FBS.

[0105] Control group 5

[0106] Chondrogenic progenitor cell control medium e

[0107] Combined drug E: 30 μg / mL helicid and 30 μg / mL NAC (N - acetylcysteine);

[0108] DMEM / F12 medium and 10% FBS.

[0109] Control group 6

[0110] Chondrogenic progenitor cell control medium f

[0111] Combined drug F: 80 μg / mL algal oligopeptide (amino acid sequence: Pro - Asp - Asp - Val - Ala) and 40 μg / mL PDGF (platelet - derived growth factor);

[0112] DMEM / F12 medium and 10% FBS.

[0113] Example 5

[0114] Detect the difference in chondrogenic differentiation ability of chondrogenic progenitor cells after being treated with different media under the treatment of IL - 1β inflammatory factor.

[0115] Inoculate the chondrogenic progenitor cells of passage P4 into a 5 - well plate. After the cells are completely adherent, change the medium according to the following treatments:

[0116] Control group: Change to basic DMEM / F12 medium;

[0117] Model group: Change to basic DMEM / F12 medium + 10 ng / ml IL - 1β;

[0118] Experimental group a: Change to enhanced medium a + 10 ng / ml IL - 1β;

[0119] Experimental group b: Change to enhanced medium b + 10 ng / ml IL - 1β;

[0120] Experimental group c: Change to enhanced medium c + 10 ng / ml IL - 1β;

[0121] Control group a: Change to control medium a + 10 ng / ml IL - 1β;

[0122] Control group b: replaced with control medium b + 10 ng / ml IL-1β;

[0123] Control group c: replaced with control medium c + 10 ng / ml IL-1β;

[0124] Control group d: replaced with control medium d + 10 ng / ml IL-1β;

[0125] Control group e: replaced with control medium e + 10 ng / ml IL-1β;

[0126] Control group f: replaced with control medium f + 10 ng / ml IL-1β;

[0127] After 24 hours of treatment with the culture medium, RNA was extracted using TRIzol reagent. After reverse transcription, PCR detection was performed using the SYBR Green Master Mix fluorescent quantitative kit. The primer sequences of the COL2A1 gene are as follows:

[0128] Upstream primer: acagcattgcctacctggac;

[0129] Downstream primer: tcagggcagtgtacgtgaac;

[0130] Table 1 Differences in cartilage differentiation ability of cartilage stem cells

[0131]

[0132]

[0133] Combining Table 1 and Figure 1 It can be seen from the results that compared with the control group, the relative expression level of COL2A1 gene in the model group was higher, indicating that the inflammatory environment simulated by the present invention successfully reduced the chondrogenic differentiation ability of cartilage stem cells.

[0134] The relative expression of COL2A1 gene in the experimental groups (a, b and c) was significantly increased compared with that in the model group, indicating that the chondrogenic differentiation ability of chondrogenic stem cells can be effectively enhanced by using the chondrogenic stem cell enhanced culture medium prepared by the present invention.

[0135] The relative expression of COL2A1 gene in the control group (af) was higher than that in the model group, but significantly lower than that in the experimental group, indicating that the use of combined drugs alone is not sufficient to fully reverse the decreased chondrogenic differentiation ability of cartilage stem cells caused by the inflammatory environment.

[0136] Further research can find that the synergy coefficient q of experimental group a using combined drug A and combined drug B in combination is: Eab / Ea+Eb-Ea×Eb = 1.49;

[0137] The synergy coefficient q of experimental group b using combined drug C and combined drug D in combination is 1.43;

[0138] The synergy coefficient q of experimental group c using combined drug E and combined drug F in combination is 1.14;

[0139] It can be seen that experimental group a using combined drug A and combined drug B in a mass ratio of 1:3 and experimental group b using combined drug C and combined drug D in a mass ratio of 1:3 have a synergistic effect, while experimental group c using combined drug E and combined drug F in a mass ratio of 1:2 only has an additive effect.

[0140] The above results show that when the composition of 20-30 μg / mL helicid and 10-20 μg / Ml NAC is combined with the composition of 90-100 μg / mL seaweed oligopeptide and 20-30 μg / mL PDGF, it can significantly reverse the decline in the chondrogenic differentiation ability of chondrocytes caused by the inflammatory environment, thereby effectively enhancing the chondrogenic differentiation ability of chondrocytes in the inflammatory environment.

[0141] Example 6

[0142] Detect the difference in the migration ability of chondrocytes after being treated with different culture media under the treatment of IL-1β inflammatory factor.

[0143] Inoculate passage 4 chondrocytes into a 6-well plate and culture them using basic DMEM / F12 medium until the cells reach 90-100% confluence;

[0144] Aspirate the medium in the 6-well plate, wash the cells twice with PBS, and then use a sterile 200 μL pipette tip to vertically draw a straight line in the center of the cell monolayer in each well;

[0145] Use PBS to gently wash the well plate again to remove the detached cell debris, and treat the cells according to the following treatments:

[0146] Control group: Replace with basic DMEM / F12 medium;

[0147] Model group: Replace with basic DMEM / F12 medium + 10 ng / ml IL-1β;

[0148] Experimental group a: Replace with enhanced medium a + 10 ng / ml IL-1β;

[0149] Experimental group b: replaced with enhanced medium b + 10 ng / ml IL-1β;

[0150] Control group a: replaced with control medium a + 10 ng / ml IL-1β;

[0151] Control group b: replaced with control medium b + 10 ng / ml IL-1β;

[0152] Control group c: replaced with control medium c + 10 ng / ml IL-1β;

[0153] Control group d: replaced with control medium d + 10 ng / ml IL-1β;

[0154] Place the 6-well plate in a cell culture incubator at 37°C and 5% CO2 for 24 hours.

[0155] Immediately after making the scratch (0 hour), take an initial image of the scratched area, and then take an image of the same area again after 24 hours. Use the image analysis software ImageJ to measure the width of the scratched area and calculate the cell migration rate.

[0156] Table 2 Differences in the migration ability of soft bone stem cells

[0157]

[0158]

[0159] It can be seen from the results in Table 2 that compared with the model group, the cell migration rates of experimental group a and experimental group b were significantly increased, and the recovery rate of migration ability was significantly higher than that of control group a-d, indicating that the soft bone stem cells treated with the enhanced medium a or b prepared by the present invention have stronger cell migration ability in an inflammatory environment.

[0160] Further research can find that the synergy coefficient q of experimental group a using combined drug A and combined drug B in combination is 1.28;

[0161] The synergy coefficient q of experimental group b using combined drug C and combined drug D in combination is 1.29.

[0162] This result shows that when the composition of 20 - 30 μg / mL helicid and 10 - 20 μg / mL NAC is combined with the composition of 90 - 100 μg / mL seaweed oligopeptide and 20 - 30 μg / mL PDGF, it can produce an obvious reversal effect on the decrease in the migration ability of soft bone stem cells caused by an inflammatory environment, thereby effectively enhancing the migration ability of soft bone stem cells in an inflammatory environment.

[0163] Example 7

[0164] Detect the therapeutic effect of chondral stem cells treated with enhanced medium on the rat knee arthritis model

[0165] Thirty SD rats were randomly divided into 5 groups: sham operation group (only expose the joint structure and then directly suture the joint capsule and close the incision), knee arthritis model group, ordinary chondral stem cell group (chondral stem cells collected after being treated with basic DMEM medium for 24 h), enhanced chondral stem cell group a (chondral stem cells a collected after being treated with enhanced medium a for 24 h), and enhanced chondral stem cell group b (chondral stem cells b collected after being treated with enhanced medium b for 24 h);

[0166] Modeling steps:

[0167] Weigh the SD rats, calculate the anesthetic dose according to the body weight (10% chloral hydrate, 0.3 mL / 100 g), inject anesthetic intraperitoneally. After anesthesia, inject 80,000 units of penicillin intramuscularly to prevent infection;

[0168] Shave the hair of the hind limbs of the rats, disinfect with iodophor, cover with a sterile surgical drape, make an incision in the middle of the anterior knee joint of the hind limbs of the rats, cut part of the patellar ligament, quadriceps femoris and joint capsule medially beside the patella to fully expose the trochlear groove of the femur and the femoral condyle;

[0169] Using the midpoint of the trochlear groove of the femur as the center, make a full-thickness cartilage defect with a ring drill with a diameter of 2 mm, and the depth is about 0.5 mm (avoid damaging the subchondral bone). Continuously cool with normal saline during the drilling process to protect the normal cartilage at the edge of the drill hole;

[0170] Rinse the joint cavity and wound surface repeatedly with normal saline, wipe the defect area with sterile gauze, straighten the knee joint and reduce the patella, suture the joint capsule, deep fascia and skin layer by layer, and disinfect the surgical incision;

[0171] After the operation, put the rats back into the cage and continue to culture for 1 week.

[0172] Drug treatment:

[0173] Sham operation group: Inject 50 μL of PBS at the defect;

[0174] Knee arthritis model group: Inject 50 μL of PBS at the defect;

[0175] Ordinary chondral stem cell group: Inject 50 μL of PBS containing 1×10 6 chondral stem cells at the defect;

[0176] Enhanced chondral stem cell group a: Inject 50 μL of PBS containing 1×10 6 chondral stem cells a at the defect;

[0177] Enhanced cartilage stem cell group B: 50 μL containing 1×10 6 b of chondrogenic stem cells in PBS.

[0178] The drug treatment lasted for 12 weeks, with injections every other week.

[0179] Histological scoring:

[0180] After the experiment, the SD rats were killed, and the femoral condyle specimens were cut about 0.5-1 cm away from the distal end of the condyle. After staining, the Wakitani scoring standard was used to perform histological scoring on the specimens: cell morphology matrix staining, cartilage surface flatness, new cartilage thickness and integration with surrounding tissues, matrix-specific staining. The total score is 14 points, and the lower the score, the better the repair effect.

[0181] from Figure 3 The results clearly show that the scores of different experimental groups showed significant differences. Specifically, the score of the sham operation group was 0.33±0.52, indicating that the knee joints of the rats in this group were not significantly damaged and the score was low;

[0182] The score of the knee arthritis model group was 8.83, indicating that the symptoms of knee arthritis in the model group were more severe and there were obvious pathological changes;

[0183] The score of the conventional cartilage stem cell treatment group was 5.33±1.03, which was improved to a certain extent compared with the model group, but still at a high level, indicating that the cartilage stem cells cultured by conventional methods have a certain therapeutic effect, but the effect is limited;

[0184] The score of enhanced chondrogenic stem cell group a was 3.33±1.03, while the score of enhanced chondrogenic stem cell group b was further reduced to 2.17±0.98, indicating that both types of chondrogenic stem cells cultured with the enhanced culture medium of the present invention showed better effects in treating knee arthritis, especially the chondrogenic stem cells cultured with enhanced culture medium b had the most significant effect.

[0185] The above results fully demonstrate that compared with chondrogenic stem cells cultured by traditional methods, chondrogenic stem cells cultured using enhanced culture medium a and enhanced culture medium b in the present invention can significantly improve the therapeutic effect when used to treat SD rats with a knee arthritis model, thereby providing a basis for the efficient treatment of knee arthritis.

Claims

1. Use of a composition in the preparation of a drug for osteoarthritis, characterized in that, The composition comprises the following components: 20 - 30 μg / mL helicid and 10 - 20 μg / mL N-acetylcysteine; 90 - 100 μg / mL seaweed oligopeptide and 20 - 30 μg / mL platelet-derived growth factor; The amino acid sequence of the seaweed oligopeptide is Pro-Asp-Asp-Val-Ala.

2. The application according to claim 1, wherein The composition is used to treat osteoarthritis by enhancing the chondrogenic differentiation ability and migration ability of mesenchymal stem cells under an inflammatory environment.

3. An injection drug for the efficient treatment of osteoarthritis, characterized in that, The injection drug is composed of mesenchymal stem cells with enhanced therapeutic ability and a solvent; The mesenchymal stem cells with enhanced therapeutic ability are prepared by the following method: (1) Enzymatically digest and culture articular cartilage to obtain mesenchymal stem cells; (2) Inoculate the mesenchymal stem cells into a culture vessel and culture until the cells are completely adherent; (3) Remove the original culture medium, add the mesenchymal stem cell enhancement medium and continue to culture for 24 - 72 h to obtain the mesenchymal stem cells with enhanced therapeutic ability; The components of the mesenchymal stem cell enhancement medium are as follows: 20 - 30 μg / mL helicid and 10 - 20 μg / mL N-acetylcysteine; 90 - 100 μg / mL seaweed oligopeptide and 20 - 30 μg / mL platelet-derived growth factor; 10% FBS and DMEM / F12 medium; The amino acid sequence of the seaweed oligopeptide is Pro-Asp-Asp-Val-Ala.

4. The injectable drug according to claim 3, wherein The content of the soft bone stem cells with enhanced therapeutic ability in every 50 μL of the injection drug is 1×10 6 cells; The mesenchymal stem cells with enhanced therapeutic ability are mesenchymal stem cells with enhanced chondrogenic ability and migration ability under an inflammatory environment.

5. A preparation method for enhancing the osteoarthritis treatment ability of mesenchymal stem cells, characterized in that, The preparation method comprises the following steps: (1) Enzymatically digest and culture articular cartilage to obtain mesenchymal stem cells; (2) Inoculate the mesenchymal stem cells into a culture vessel and culture until the cells are completely adherent; (3) Remove the original culture medium, add the mesenchymal stem cell enhancement medium and continue to culture for 24 - 72 h to obtain mesenchymal stem cells with enhanced therapeutic ability; The components of the mesenchymal stem cell enhancement medium are as follows: 20 - 30 μg / mL helicid and 10 - 20 μg / mL N-acetylcysteine; 90 - 100 μg / mL seaweed oligopeptide and 20 - 30 μg / mL platelet-derived growth factor; 10% FBS and DMEM / F12 medium; The amino acid sequence of the seaweed oligopeptide is Pro-Asp-Asp-Val-Ala.

6. According to the preparation method described in claim 5, the preparation method enhances the chondrogenic differentiation ability and migration ability of mesenchymal stem cells under an inflammatory environment, thereby improving the therapeutic ability for osteoarthritis.

7. A method for enhancing the chondrogenic differentiation ability and migration ability of mesenchymal stem cells in an inflammatory environment, characterized in that, The method is the same as the preparation method described in claim 5.

8. A culture medium for enhancing the chondrogenic differentiation ability and migration ability of mesenchymal stem cells in an inflammatory environment, characterized in that, The medium is composed of the following components: 20 - 30 μg / mL helicid and 10 - 20 μg / mL N-acetylcysteine; 90 - 100 μg / mL seaweed oligopeptide and 20 - 30 μg / mL platelet-derived growth factor; 10% FBS and DMEM / F12 medium; The amino acid sequence of the seaweed oligopeptide is Pro-Asp-Asp-Val-Ala.

9. The culture medium according to claim 8, wherein The medium is composed of the following components: 20 μg / mL helicid and 20 μg / mL N-acetylcysteine; 90 μg / mL seaweed oligopeptide and 30 μg / mL platelet-derived growth factor; 10% FBS and DMEM / F12 medium.

Images