Sinorhizobium Y18, bacterial agent, coating agent and application thereof

Abstract

This invention belongs to the field of agricultural technology and relates to microorganisms, particularly Sinorhizobium rhizobium Y18, a bacterial agent, a coating agent, and their applications. It was deposited with the Guangdong Provincial Microbial Culture Collection on April 7, 2025, under the accession number GDMCC No. 66071. The address of the deposit is the Institute of Microbiology, Guangdong Academy of Sciences, Building 59, 100 Xianlie Middle Road, Guangzhou. This strain exhibits broad-spectrum nodulation properties and effectively promotes soybean nodulation and growth, thus possessing excellent practical application value.

Description

Technical Field

[0001] The invention belongs to the technical field of agriculture and relates to microorganisms, in particular to soybean rhizobia. Background Art

[0002] Nitrogen fertilizer is one of the most important means of production in modern agriculture. Its production releases large amounts of greenhouse gases, exacerbating global warming. Furthermore, excessive nitrogen fertilizer application leads to increased soil compaction, which reduces the soil's natural air and water permeability, thus affecting crop growth and development. Furthermore, the loss of large amounts of nitrogen fertilizer into water bodies can lead to eutrophication, triggering algae blooms and ultimately disrupting the balance of aquatic ecosystems. These problems seriously hinder the sustainable development of agriculture.

[0003] Soybeans are an important dual-use crop for both grain, oil, and feed in my country. They form nodules in a symbiotic relationship with rhizobia in the soil, converting nitrogen from the air into ammonia. Globally, soybeans produce 16.44 million tons of nitrogen annually, making them the leading symbiotic nitrogen-fixing system among legumes in agricultural ecosystems. The nitrogen fixed by soybeans in this symbiotic relationship with rhizobia not only meets soybean growth needs but is also absorbed and utilized by subsequent crops, making them an irreplaceable and crucial component of green agriculture, ecological agriculture, and sustainable agricultural development. Currently, the major soybean-producing countries are the United States, Canada, Argentina, Brazil, and China. The first four countries primarily inoculate soybeans with microbial inoculants, primarily based on rhizobia, to replace the majority of chemical nitrogen fertilizers. In the United States, over 50% of soybean-growing areas are inoculated with rhizobia, resulting in an annual reduction of 6.19 million tons of chemical nitrogen fertilizer. In Brazil, soybean rhizobium usage is nearly 100%, reducing nitrogen fertilizer use by approximately $2.5 billion annually. In contrast, in my country, the inoculation rate for soybean rhizobia inoculants is less than 3%, primarily concentrated in Northeast China. In recent years, my country has also increasingly prioritized the use of rhizobia inoculants. The promotion of soybean rhizobium inoculants is one of the key technologies for expanding soybean and oilseed plantings and increasing fertilizer efficiency through reduced fertilizer use. A national symposium on the promotion and application of soybean rhizobium inoculants was organized and related promotion and application work was organized. However, most of the currently registered rhizobia in my country are slow-growing rhizobia. Fast-growing rhizobia are the predominant rhizobia in the alkaline soils of soybean-producing regions in the Huanghuai and Haihe regions. However, existing rhizobium inoculants lack efficient, fast-growing rhizobia strains, a major factor contributing to the low level of rhizobium application in these regions and hindering the development of my country's soybean industry. To fully leverage the nitrogen-fixing benefits of the soybean-rhizobium symbiosis, it is essential to select broad-spectrum rhizobia strains with strong nodulation and excellent nitrogen-fixing properties. Summary of the Invention

[0004] In order to solve the above technical problems, the present invention proposes a Sinorhizobium Y18, a bacterial agent, a coating agent and applications thereof.

[0005] The technical solution of the present invention is achieved as follows:

[0006] The present invention was isolated, purified and screened from soybean nodules in the main soybean producing areas of Huanghuaihai in my country. The 16srDNA sequence was identified as Sinorhizobium, which is classified as Sinorhizobium sp. , was deposited in the Guangdong Provincial Microbiological Culture Collection on April 7, 2025, with the deposit number GDMCC No: 66071. The deposit address is Building 59, No. 5, 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences.

[0007] The isolated rhizobium Y18 strain forms round or approximately round, sticky, smooth, moist milky white colonies on the HM medium.

[0008] The present invention provides a Sinorhizobium strain with broad-spectrum nodulation characteristics for use in soybean planting.

[0009] Furthermore, the present invention provides a method for culturing the above-mentioned Sinorhizobium Y18, which comprises inoculating the Sinorhizobium Y18 into a fermentation medium for culturing.

[0010] Furthermore, the present invention provides a liquid bacterial agent, which includes the bacterial liquid obtained after fermentation and culture of the above-mentioned Sinorhizobium Y18.

[0011] Furthermore, the present invention provides a soybean rhizobium agent for soybean seed coating, wherein the preparation method of the soybean rhizobium agent comprises the Sinorhizobium Y18, fermentation medium and adhesive described in the above technical solution, and the number of viable bacteria of Sinorhizobium Y18 in the soybean rhizobium agent is not less than 2×10 9 CFU / ml. The adhesive is a 0.5%-2% arabinose solution.

[0012] Furthermore, under greenhouse or field conditions, inoculating the above-mentioned Sinorhizobium Y18 and soybean rhizobium agents into multiple soybean varieties can significantly increase soybean nodulation and promote soybean growth.

[0013] The present invention has the following beneficial effects:

[0014] The present invention isolated and screened a nodulating rhizobium strain from the Huanghuaihai soybean-producing region. The strain exhibits broad-spectrum nodulation, high nodulation rates, and strong nitrogen-fixing capabilities, providing a new microbial resource for soybean cultivation in the Huanghuaihai region. The soybean rhizobium inoculant significantly increased soybean nodule count and aboveground and belowground biomass under greenhouse potting conditions. Field experiments in the Huanghuaihai soybean-producing region demonstrated that the strain effectively promoted nodulation, plant growth, and yield of the main soybean varieties cultivated in the region, achieving the goal of increasing soybean production and reducing weight. Therefore, the strain has excellent practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0016] Figure 1 This is a diagram of the colony morphology of Sinorhizobium Y18 in Example 1 of the present invention on culture media with different pH and salt concentrations.

[0017] Figure 2 This is a diagram showing the effect of back-inoculation of Sinorhizobium Y18 and other candidate strains in Example 1 of the present invention.

[0018] Figure 3 This is the phylogenetic tree of 16s rDNA sequence analysis of Sinorhizobium Y18 in Example 1 of the present invention.

[0019] Figure 4 This is the effect of inoculating Sinorhizobium Y18 and the control strain Sinorhizobium SMH12 on the symbiotic nitrogen fixation and growth of soybean in the greenhouse potted plants in Example 2 of the present invention.

[0020] Figure 5 This is the effect of inoculating Sinorhizobium Y18 on symbiotic nitrogen fixation and growth of soybean during the flowering period in the field experiment of Example 3 of the present invention.

[0021] Figure 6 This figure shows the effect of inoculation with Sinorhizobium Y18 on soybean yield in the field experiment in Example 3 of the present invention.

[0022] Figure 7 This is a diagram showing the effect of inoculating Sinorhizobium Y18 on soybean yield in the field trial in Example 3 of the present invention. DETAILED DESCRIPTION

[0023] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0025] The recipe used is as follows:

[0026] HM medium formula:

[0027] Na2HPO40.125 g / L, Na2SO40.125 g / L, NH4Cl 0.125 g / L, MgSO4·7H2O 0.18 g / L, yeast extract 0.25 g / L, D-Arbinose1 g / L, Sodium Gluconate 1g, FeCl30.004g, CaCl20.013g, HEPES 1.30g, MES 1.30g, adjust the pH to 6.6-7.0 with NaOH.

[0028] Low nitrogen Hoagland's nutrient solution formula:

[0029] Na2HPO4·12H2O 300.00mg / L, KH2PO4100mg / L, MgSO4·7H2O 120mg / L, EDTAFe·Na29.36mg / L, KNO3202mg / L, KCl 111.68 mg / L, CaCl275.50 mg / L, MnSO4·H2O 1.540mg / L, H3BO32.860 mg / L, ZnSO4·7H2O 0.220 mg / L, CuSO4·5H2O 0.080 mg / L, Na2MoO4·2H2O0.130 mg / L.

[0030] Example 1: Sinorhizobium Sinorhizobium Isolation and identification of Y18

[0031] Soil was collected from soybean fields in Pingyuan New District, Xinxiang City, Henan Province, a soybean-producing region in the Huanghuaihai region, down to 10 cm below the surface, placed in sterile, sealed bags, and immediately brought back to the laboratory. Ten soybean lines, representing the Huanghuaihai region, northern China, and the Yangtze River Basin, were selected. Appropriately sized, structurally intact soybean seeds from each line were sterilized with chlorine gas and planted in sterile plug trays containing 500 g of the collected soil sample. The soil was then regularly watered with sterile water to maintain moisture.

[0032] After soybean plants enter the flowering stage, wash all roots with sterile water and remove nodules with sterile tweezers. Treat with 3.5% sodium hypochlorite solution for 5 minutes, 75% ethanol for 4 minutes, and then wash with sterile water 3-5 times. In a clean bench, grind the nodules into a slurry using a sterile grinding rod. Use a sterile inoculating needle to streak the slurry onto HM medium. The medium is then incubated at 28°C until colonies appear.

[0033] All the single colonies that grew were picked and streaked onto new HM medium for purification three times, and then transferred to HM medium containing 0.01% bromothymol blue (BTB), inverted and cultured at 28°C for 5 days. The strains whose medium turned yellow were selected as candidate fast-growing rhizobia ( Figure 1 ), a high-efficiency nodulation rhizobium strain was screened through the soybean backgrafting experiment and named Y18 ( Figure 2 ).

[0034] The 16S rRNA gene was amplified using the universal bacterial primer pair 27F and 1429R. The PCR reaction system consisted of a 50 µL system containing 2 µL of Y18 bacterial culture as template, 25 µL of KAPA HiFi HotStart ReadyMix, and 4 µL of 10 µM primers (primers 27F and 1429R, 2 µL each). The mixture was then brought to 50 µL with ddH2O (sterile deionized water). The reaction conditions were a 3-minute initial denaturation at 95°C, followed by 30 cycles of denaturation at 95°C for 15 seconds, annealing at 56°C for 15 seconds, and extension at 72°C for 1 minute 30 seconds, followed by a 5-minute back-off extension at 72°C. The amplified products were verified by agarose gel electrophoresis and bidirectionally sequenced and assembled by Beijing Qingke Biotechnology Co., Ltd. The resulting sequence is the Y18 16S rRNA gene sequence, SEQ ID No. 1.

[0035] The universal primers are:

[0036] 27F: AGAGTTTGATCCTGGCTCAG;

[0037] 1492R: GGTTACCTTGTTACGACTT;

[0038] The 16S rRNA gene sequence of Y18 was compared with the National Center for Biological Information (NCBI) by BLAST. Thirteen reference strain sequences were selected and the 16S rRNA sequences of Y18 and reference strains were analyzed using MEGA11. A phylogenetic tree of Y18 and reference strains was constructed ( Figure 3 ), analysis revealed that strain Y18 was Sinorhizobium Sinorhizobium sp. , and preserve it.

[0039] Sinorhizobium rhizobium strains are classified as Sinorhizobium. The deposit number is GDMCC No: 66071, the deposit time is April 7, 2025, and the depository is Guangdong Provincial Microbiological Culture Collection Center.

[0040] Observation on HM medium Sinorhizobium sp. The Y18 colony is characterized by a sticky, smooth, moist surface and milky white colonies with neat edges.

[0041] In order to detect its viability in alkaline soil, solid culture media with different pH (7-11) and different NaCl concentrations (0%-4%) were prepared, and the same concentration of bacterial liquid was inoculated on the solid culture medium. After 48 hours, the growth of the colonies on the plate was observed.

[0042] The results showed that strain Y18 could still grow well on plates with a pH of 10 and at a NaCl concentration of 4%.

[0043] Example 2: Greenhouse potted plant experiment

[0044] 1. Liquid inoculant preparation: Take a small amount of the bacterial culture stored in a -80°C cryovial with a sterile inoculating loop and inoculate it onto HM solid medium for streak activation. Grow in a 25°C biochemical incubator for 48 hours until distinct colonies appear. Furthermore, pick a single colony from the plate and inoculate it into a flask containing 50 mL of HM liquid medium. Place the flask in a shaker at 28°C at 200 rpm / min for 48 hours. Measure the OD600 of the bacterial culture and adjust it to OD600 = 0.3 to obtain the liquid inoculum for inoculation of greenhouse potted plants.

[0045] 2. Sterilization

[0046] Vermiculite, plug trays, beakers, and other materials required for the experiment were sterilized under high temperature and high pressure at 121°C for 30 minutes. The soybean seeds used in this experiment were sterilized using chlorine gas. The specific procedure was as follows: Soybean seeds were spread flat in a Petri dish and placed in a glass desiccator. 100 mL of sodium hypochlorite solution and 4.2 mL of concentrated hydrochloric acid were quickly added to the beaker in that order. The glass desiccator was then sealed and sterilized for 12 hours. After sterilization, the Petri dish containing the soybean seeds was placed in a clean hood for air ventilation for at least 2 hours before being closed and set aside.

[0047] 3. Inoculation of microbial agents

[0048] This experiment selected five soybean varieties (Williams 82, Zhonghuang 13, Jidou 12, Jidou 17, and Qihuang 34). Appropriate amounts of soybean seeds of these varieties were sterilized with chlorine gas and sown evenly on the surface of sterilized vermiculite at a planting density of 2 seeds per square centimeter. The seeds were then covered with sterilized vermiculite approximately 1 cm thick. Two liters of low-nitrogen Hoagland's nutrient solution were added to the sterilized vermiculite until the vermiculite was fully absorbed.

[0049] The soybeans in this experiment were cultured in a greenhouse (temperature: 25°C, photoperiod: day / night = 14h / 10h). When the soybeans grew to 4 days old, 8 mL of the prepared inoculum was added along the rhizome junction and around the soybean root system. At the same time, a blank control (CK) with only sterilized ddH2O added was set up. Fast-growing rhizobia were inoculated. Sinorhizobium fredii SMH12 was used as the control strain. Each treatment was replicated 12 times. When the soybeans were 25 days old, phenotypic indicators such as soybean nodule number, single nodule weight, nitrogenase activity, aboveground dry weight, and underground dry weight were measured.

[0050] There was no nodule formation in the blank control (CK). Figure 4 The results showed that under sterilized vermiculite potting conditions, the control strain SMH12 was able to nodulate with all five soybean varieties. The highest number of nodules formed with Jidou 12 and Jidou 17 was an average of 52, and the average number of nodules formed with all five varieties was 46. Compared to SMH12, Y18 also nodulated with all five soybean varieties, with the highest number of nodules formed with Qihuang 34 being 194, and the average number of nodules formed with all five varieties being 147, significantly outperforming the control strain SMH12. Furthermore, the average nodule weight and enzyme activity per plant of the nodules formed by Y18 on all five soybean varieties were 14.02 mg and 4.01 μmol / h, respectively, significantly outperforming the control strain SMH12. This suggests that the Y18 rhizobium has broad-spectrum nodulation properties and high nitrogen fixation efficiency, suggesting promising application prospects.

[0051] Example 3: Field inoculation experiment

[0052] 1. Preparation of adhesive: Weigh 20g of gum arabic and slowly add it to 1L of water, stirring again to prepare a 2% gum arabic adhesive for later use.

[0053] 2. Preparation of Field Inoculant: Take a small amount of culture from a cryovial stored at -80°C. Use a sterile inoculating loop to inoculate a small amount of the culture onto HM solid medium for streak activation. Grow in a biochemical incubator at 25°C for 48 hours until distinct colonies form. Furthermore, select a single colony from the plate and inoculate it into a flask containing 50 mL of HM liquid medium. Place the flask in a shaker at 28°C at 200 rpm / min for 18 hours. Then, inoculate 10 mL of the culture at a 1:100 ratio into 1 liter of HM liquid medium to expand the culture until the logarithmic phase. The resulting Y18 fermentation broth should have an OD600 of 1.0. Thoroughly mix the fermentation broth with 2% binder at a 1:1 volume ratio to prepare the seed coating agent.

[0054] 3. Field Experiment: This experiment was conducted at the Henan University Biological Breeding Base in Yuanyang County, Xinxiang City, Henan Province. The local soil is fluvo-aquic soil with basic physical and chemical properties: pH 7.94, organic matter content 2.42%, total nitrogen content 0.6 mg / g, alkaline-hydrolyzable nitrogen content 108.6 mg / kg, total phosphorus content 0.7 mg / g, available phosphorus 9.7 mg / kg, and medium soil fertility.

[0055] This experiment employed three fertilization levels: 1. No fertilizer. 2. Full fertilizer: 25 kg of 15-15-15% (NPK) compound fertilizer per mu (applied as a basal fertilizer). 3. Half fertilizer: 12.5 kg of 15-15-15% (NPK) compound fertilizer per mu (applied as a basal fertilizer). Fertilizer was applied as a uniform base fertilizer. Soybean seeds were treated with or without rhizobium inoculum at fertilization levels 1 and 2.

[0056] This experiment was replicated three times in a single plot. Mainstream soybean varieties from the Huanghuaihai region (Zhonghuang 13, Jidou 12, Jidou 17, and Qihuang 34) were selected. Within each plot, two seeds were sown manually in each hole, with row spacing of 40 cm × 13 cm. Seedlings were thinned out at the seedling stage, with one plant per hole. If a seedling was missing, two plants were added to the adjacent hole. Field management was consistent across all plots, with fertilization, sowing, intertillage, and weeding completed within a single day. Drip irrigation was used for irrigation.

[0057] 4. Field phenotypic survey: Field surveys are conducted during the flowering period and mature harvest period to examine soybean phenotypes such as the number of nodules, plant height, aboveground biomass, underground biomass, and single-plant yield.

[0058] The field phenotype was examined during the flowering period. Figure 5 It can be seen that under the treatments of no fertilizer and half fertilizer, the four soybean varieties showed that the number of nodules inoculated with Y18 was significantly higher than that of the varieties without inoculation. The four soybean varieties inoculated with Y18 had an average of 46 nodules, while the non-inoculated treatment had an average of 23 nodules, which was doubled. The aboveground fresh weight of each plant of the four soybean varieties inoculated with Y18 was higher than that of the non-inoculated treatment. Among them, under the condition of no fertilizer, the aboveground fresh weight of Zhonghuang 13, Jidou 12, and Jidou 17 after inoculation with Y18 was significantly higher than that of the control. Under the condition of half fertilizer, Jidou 12 and Qihuang 34 showed that the aboveground fresh weight after inoculation with Y18 was significantly higher than that of the non-inoculated treatment. Figure 6 、 Figure 7 The results show that soybean yield was examined at the mature harvest stage. Overall, under the same fertilization level, Y18 inoculation significantly increased soybean pod number compared to the uninoculated treatment, both under no fertilization and under half fertilization. Compared to the unfertilized and uninoculated treatment, Y18 inoculation significantly increased pod number by 22.8%. In terms of yield, Y18 inoculation significantly increased per-plant yield by 35% compared to the unfertilized and uninoculated treatment. Under no fertilization and half fertilization conditions, the per-plant yield of Y18 inoculation was still 2.3% higher than that of the full fertilization treatment, indicating that Y18 inoculation can achieve the effect of reducing fertilizer and increasing yield.

[0059] This experimental study shows that under the conditions of no fertilizer or half fertilizer application, rhizobium Y18 can symbiotically nodulate with the mainstream soybean varieties in the Huanghuaihai area, which has a significant yield-increasing effect on soybeans and can be used for large-scale promotion and application.

[0060] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Use of a strain of Sinorhizobium Y18, a bacterial agent containing Sinorhizobium Y18, or a coating agent containing Sinorhizobium Y18, characterized in that: The Sinorhizobium Y18 is classified as Sinorhizobium sp. , has been deposited in Guangdong Provincial Microbiological Culture Collection on April 7, 2025, with the deposit number GDMCC No: 66071, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences; The application is selected from any one of the following: (1) Promote the growth of legumes; (2) Promote the nodulation of legumes; The legume is soybean.

2. The use according to claim 1, characterized in that: The leguminous plants grow in alkaline soil.

3. A method for cultivating Sinorhizobium Y18, characterized in that: Inoculate Sinorhizobium rhizobium Y18 onto the fermentation medium and culture at 25°C-28°C; The Sinorhizobium Y18 is classified as Sinorhizobium sp. , was deposited in the Guangdong Provincial Microbial Culture Collection on April 7, 2025, with the deposit number GDMCC No: 66071. The deposit address is the Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

4. A microbial agent containing Sinorhizobium Y18, characterized in that: The Sinorhizobium Y18 is classified as Sinorhizobium sp. , was deposited in the Guangdong Provincial Microbial Culture Collection on April 7, 2025, with the deposit number GDMCC No: 66071. The deposit address is the Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

5. The microbial agent according to claim 4, characterized in that: The viable bacterial count of Sinorhizobium Y18 is not less than 2×10 9 CFU / ml.

6. A seed coating agent, characterized in that: It contains Sinorhizobium Y18, the Sinorhizobium Y18 is classified as Sinorhizobium sp. , was deposited in the Guangdong Provincial Microbial Culture Collection on April 7, 2025, with the deposit number GDMCC No: 66071. The deposit address is the Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

7. The seed coating agent according to claim 6, characterized in that: Also includes an adhesive.

8. The seed coating agent according to claim 7, characterized in that: The adhesive is a 0.5%-2% arabinose solution.

Images