Wheat saline-alkaline tolerant ERF transcription factor gene TaERF109 and application thereof

Abstract

The invention belongs to the technical field of plant heredity and genetic engineering, and particularly relates to a wheat saline-alkaline tolerant ERF transcription factor gene TaERF109 and application thereof. The invention discloses the wheat saline-alkali stress response gene TaERF109 obtained by cloning by utilizing the existing plant gene engineering technology for the first time, the gene is overexpressed in wheat through an agrobacterium tumefaciens mediated method, and comparative analysis proves that the saline-alkali tolerance of a transgenic plant is obviously improved, and the transgenic plant has a good application prospect. And interference on expression of the TaERF109 can reduce the resistance of the wheat to salt and alkali stress. Therefore, the invention fully proves that the wheat saline-alkaline tolerant ERF transcription factor gene plays an important role in plant saline-alkaline tolerant regulation and control, and shows that the gene can be widely applied to cultivation and improvement of plant saline-alkaline tolerant varieties, so that the wheat saline-alkaline tolerant ERF transcription factor gene has good practical application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetics and genetic engineering, and particularly relates to a wheat salt-tolerant ERF transcription factor gene TaERF109 and its application. Background Art

[0002] Disclosing the information of this background art section is only intended to enhance the understanding of the overall background of the present invention, and is not necessarily to be regarded as an admission or any form of implication that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] Soil salinization is a major problem that plagues agricultural production and is also one of the main abiotic stress factors leading to reduced agricultural yields. For a long time, extensive research has been carried out on the improvement and utilization of saline-alkali land at home and abroad. Although certain achievements have been made by adopting engineering measures, there are still many drawbacks. Exploring crop salt-tolerant genes and analyzing their regulatory mechanisms, and improving the salt tolerance of crops through genetic breeding methods is the most effective way to develop and utilize saline-alkali land.

[0004] Using transgenic technology to improve plants by transferring new traits into high-biomass plants, thereby developing efficient new transgenic plant varieties for use in saline-alkali areas and improving the salt tolerance of crops is a technology with broad application prospects.

[0005] Certain progress has been made in the research on plant salt tolerance using molecular genetics-related technologies. A large number of related genes have been cloned for the study of plant salt tolerance mechanisms. Some experiments have shown that transferring genes related to salt tolerance in plants themselves and other organisms into plants can improve the salt tolerance of transgenic plants through their heterologous transcription and translation products. Currently, some genes that can significantly improve the salt tolerance of plants have been discovered. However, there are few reports on the correlation of wheat ERF transcription factors with salt tolerance. Summary of the Invention

[0006] Aiming at the deficiencies in the prior art, the purpose of the present invention is to provide a wheat salt-tolerant ERF transcription factor gene TaERF109 and its application. Specifically, the present invention isolates the ERF transcription factor gene TaERF109 from wheat, and through experiments, it is proved that it plays an important role in the regulation of plant salt tolerance. Based on the above research results, the present invention is completed.

[0007] In order to achieve the above technical purpose, the technical solution provided by the present invention is as follows:

[0008] In the first aspect of the present invention, a wheat salt-tolerant ERF transcription factor gene is provided, named TaERF109, and the wheat salt-tolerant ERF transcription factor gene is selected from:

[0009] (a1) The nucleotide sequence shown in SEQ ID NO.1;

[0010] (a2) A protein encoded by the nucleotide sequence of (a1) and having the same amino acid sequence, but a nucleotide sequence that is different in sequence due to the degeneracy of the genetic code;

[0011] (a3) A nucleotide sequence having ≥90% identity with the nucleotide sequence shown in (a1) or (a2) and encoding a protein with the same or similar functional protein;

[0012] (a4) A nucleotide sequence complementary to any one of (a1)-(a3).

[0013] In the second aspect of the present invention, there is provided a protein encoded by the above-mentioned wheat salt-tolerant ERF transcription factor gene, and the protein is specifically a wheat salt-tolerant ERF transcription factor.

[0014] In the third aspect of the present invention, there is provided a recombinant expression vector comprising the above-mentioned wheat salt-tolerant ERF transcription factor gene.

[0015] In the fourth aspect of the present invention, there is provided a transgenic cell line, host bacterium or transgenic plant containing the above-mentioned wheat salt-tolerant ERF transcription factor gene.

[0016] In the fifth aspect of the present invention, there is provided the application of the above-mentioned wheat salt-tolerant ERF transcription factor gene, wheat salt-tolerant ERF transcription factor, recombinant expression vector containing the above-mentioned wheat salt-tolerant ERF transcription factor gene, transgenic cell line, host bacterium or transgenic plant in any one or more of the following:

[0017] (b1) Regulation of plant salt tolerance;

[0018] (b2) Improvement and cultivation of salt-tolerant plants.

[0019] In the sixth aspect of the present invention, there is provided a method for improving and cultivating salt-tolerant plants, the method comprising increasing the expression level and / or activity of the TaERF109 gene in the target plant.

[0020] The beneficial technical effects of the above one or more technical solutions:

[0021] The above technical solution first disclosed that by using the existing plant genetic engineering technology, the wheat salt-alkali stress-responsive gene TaERF109 was cloned, and this gene was overexpressed in wheat by the method mediated by Agrobacterium tumefaciens. Through comparative analysis, it was proved that the salt-alkali tolerance ability of the transgenic plants was significantly improved, while interfering with the expression of TaERF109 would reduce the resistance of wheat to salt-alkali stress. Therefore, the above technical solution fully proves that the above wheat salt-alkali tolerance ERF transcription factor gene plays an important role in the regulation of plant salt-alkali tolerance, indicating that this gene can be widely applied to the cultivation and improvement of plant salt-alkali tolerance varieties, and thus has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained according to the provided drawings.

[0023] Figure 1 RT-PCR analysis of TaERF109 under salt-alkali stress.

[0024] (A) RT-PCR of TaERF109 under alkali stress.

[0025] (B) RT-PCR of TaERF109 under salt stress.

[0026] Figure 2 Identification of the expression level of TaERF109 transgenic wheat.

[0027] (A) Identification of the expression level of TaERF109-pGA3426 transgenic lines.

[0028] (B) Identification of the expression level of TaERF109-pTCK303 transgenic lines.

[0029] Figure 3 Phenotype of TaERF109 transgenic wheat under salt-alkali stress.

[0030] (A) Phenotype of TaERF109-OE transgenic wheat under alkali stress.

[0031] (B) Phenotype of TaERF109-RNAi transgenic wheat under alkali stress.

[0032] (C) Fresh weight statistics of TaERF109-OE transgenic wheat under alkali stress.

[0033] (D) Fresh weight statistics of TaERF109-RNAi transgenic wheat under alkali stress.

[0034] (E) Phenotype of TaERF109 - OE transgenic wheat under salt stress.

[0035] (F) Phenotype of TaERF109 - RNAi transgenic wheat under salt stress.

[0036] (C) Fresh weight statistics of TaERF109 - OE transgenic wheat under salt stress.

[0037] (D) Fresh weight statistics of TaERF109 - RNAi transgenic wheat under salt stress. Detailed implementation manners

[0038] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0039] It should be noted that the terms used herein are only for describing the specific implementation manners and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular forms are also intended to include the plural forms. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. The present invention uses conventional techniques and methods in the fields of genetic engineering and molecular biology. Those skilled in the art can adopt other conventional techniques, methods, and reagents in the art based on the embodiments provided by the present invention, without being limited to the specific embodiments of the present invention.

[0040] In the present invention, the term "identity" or "consistency" refers to the sequence similarity with a nucleotide sequence. Identity can be evaluated by the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0041] For sequence comparison, generally, one sequence is used as a reference sequence and compared with the test sequence. When using a sequence comparison algorithm, the test and reference sequences are input into a computer, and if necessary, the coordinates of the subsequence are specified, and the parameters of the sequence algorithm program are specified. Then, according to the selected program parameters, the sequence comparison algorithm will calculate the percentage sequence identity (consistency) of the test sequence relative to the reference sequence.

[0042] Genes (nucleic acid molecules) can be DNA, such as cDNA, genomic DNA, or recombinant DNA, etc.

[0043] In addition, a large number of transformation vectors that can be used for plant transformation are known to those skilled in the art of plant transformation, and the nucleic acid molecules of the present invention can be used in combination with any vector. The choice of vector will depend on the preferred transformation technique used for transformation and the target plant species, and will not be specifically limited herein.

[0044] In the first aspect of the present invention, a wheat salt-tolerant and alkali-tolerant ERF transcription factor gene is provided, named TaERF109. The wheat salt-tolerant and alkali-tolerant ERF transcription factor gene is selected from:

[0045] (a1) the nucleotide sequence shown in SEQ ID NO.1;

[0046] (a2) a nucleotide sequence that encodes a protein with the same amino acid sequence as that encoded by the nucleotide sequence of (a1), but is different in sequence due to the degeneracy of the genetic code;

[0047] (a3) a nucleotide sequence that has ≥90% identity with the nucleotide sequence shown in (a1) or (a2) and encodes a protein with the same or similar functional protein;

[0048] (a4) a nucleotide sequence complementary to any one of (a1)-(a3).

[0049] In yet another specific embodiment of the present invention, a protein is provided. The protein is encoded by the above-mentioned wheat salt-tolerant and alkali-tolerant ERF transcription factor gene, and the protein is specifically a wheat salt-tolerant and alkali-tolerant ERF transcription factor.

[0050] In yet another specific embodiment of the present invention, a recombinant expression vector is provided. The recombinant expression vector contains the above-mentioned wheat salt-tolerant and alkali-tolerant ERF transcription factor gene.

[0051] Furthermore, the recombinant expression vector is obtained by effectively linking the wheat salt-tolerant and alkali-tolerant ERF transcription factor gene to an expression vector. The expression vector can be any one or more of a viral vector, plasmid, phagemid, cosmid, or artificial chromosome; wherein, the expression vector can be a plant expression vector, such as pGA3426, pTCK303, etc., and will not be specifically limited herein.

[0052] In yet another specific embodiment of the present invention, a transgenic cell line, host bacterium, or transgenic plant containing the above-mentioned wheat salt-tolerant and alkali-tolerant ERF transcription factor gene is provided.

[0053] The transgenic cell line can be isolated, in vitro, cultured, or preferably a part of a plant; wherein, the plant cell can be a crop cell, and the crop is a monocotyledonous crop, such as sorghum, corn, rice, barley, wheat, quinoa, etc., and wheat is preferred.

[0054] Among them, the host bacterium can be a eukaryotic fungus (such as a fungus, further such as yeast) or a prokaryotic bacterium (such as a bacterium, further such as Escherichia coli, Agrobacterium tumefaciens, Bacillus subtilis or Bacillus pumilus).

[0055] In the present invention, the transgenic plant is a transgenic crop, further preferably a monocotyledonous crop, such as sorghum, corn, rice, barley, wheat, quinoa, etc., and wheat is preferred among them.

[0056] In another specific embodiment of the present invention, there is provided the use of the above-mentioned wheat salt-alkali-tolerant ERF transcription factor gene, wheat salt-alkali-tolerant ERF transcription factor, recombinant expression vector containing the above-mentioned wheat salt-alkali-tolerant ERF transcription factor gene, transgenic cell line, host bacterium or transgenic plant in any one or more of the following:

[0057] (b1) Regulation of plant salt-alkali tolerance;

[0058] (b2) Improvement and cultivation of salt-alkali-tolerant plants.

[0059] Among them, in the above-mentioned (b1), the regulation of plant salt tolerance is specifically manifested as follows: when the wheat salt-alkali-tolerant ERF transcription factor gene is overexpressed in wheat, compared with the control group, the fresh weight of the overexpressed wheat increases in a salt / alkali environment, indicating that this gene can improve / promote plant salt-alkali tolerance; conversely, when RNA interference is used to reduce the expression of this gene in wheat, the fresh weight of the wheat after RNA interference of this gene decreases in a salt / alkali environment, thereby reducing / inhibiting plant salt-alkali tolerance.

[0060] In the above-mentioned (b2), the improvement and cultivation of plants are specifically manifested as the improvement and cultivation of plant varieties with salt-alkali tolerance. The plant is a crop, further preferably a monocotyledonous crop, such as sorghum, corn, rice, barley, wheat, quinoa, etc., and wheat is preferred among them.

[0061] In another specific embodiment of the present invention, there is provided a method for improving and cultivating salt-alkali-tolerant plants, and the method includes increasing the expression level and / or activity of the TaERF109 gene in the target plant.

[0062] In the above method, the increase in the expression level and / or activity of the TaERF109 gene in the target plant can be achieved by means such as introducing a recombinant expression vector containing the TaERF109 gene, operably connecting a strong promoter to the TaERF109 gene, and introducing an enhancer, etc., and no specific limitation is made here.

[0063] The target plant can be any plant at any developmental stage. In particular, the plant is a crop, further preferably a monocotyledonous crop, such as sorghum, corn, rice, barley, wheat, quinoa, etc., and wheat is preferred among them.

[0064] The content of the present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments. In the following embodiments, materials, reagents, carriers, strains, etc. used are obtained from commercial sources unless otherwise specified. The experimental methods described are conventional methods in the art unless otherwise specified.

[0065] Example 1: Cloning of TaERF109

[0066] 1.1 Extraction of wheat Total RNA

[0067] (1) Put the tissue material and steel beads into a 2.0 mL RNase-free EP tube, quickly freeze with liquid nitrogen and grind into powder with a tissue grinder;

[0068] (2) Add 1 mL of TRIzol extraction solution from Invitrogen, vigorously shake and mix the sample to fully lyse the sample, and let it stand at room temperature for 5 min;

[0069] (3) Add 0.2 mL of chloroform, invert and mix well, and let it stand at room temperature for 10 min;

[0070] (4) Centrifuge at 12,000 rpm for 15 min at 4 °C;

[0071] (5) Take the supernatant and transfer it to a 1.5 mL RNase-free EP tube, add an equal volume of isopropanol (about 500 μL), fully invert and mix well, and let it stand at room temperature for 10 min;

[0072] (6) Centrifuge the above sample at 12,000 rpm for 10 min at 4 °C, and discard the supernatant;

[0073] (7) Add 1 mL of 75% ethanol to wash the precipitate, centrifuge at 12,000 rpm for 10 min at 4 °C to collect the precipitate;

[0074] (8) Repeat step (7) once;

[0075] (9) Remove the supernatant, dry the RNA precipitate on a sterile workbench for about 7 - 10 min. After the water in the test tube is completely dried, add an appropriate volume (30 - 50 μL) of RNase-free water to fully dissolve it;

[0076] (10) Detect the quality and concentration of RNA by 1% agarose gel electrophoresis and ultraviolet spectrophotometer.

[0077] Note: a) Detect the quality and size of RNA by 1% Agrose gel electrophoresis. Prepare a 1% Agrose gel containing EB, pipette 1 μL of RNA, add 3 μL of RNAase-free water, then add 1 μL of loading buffer, mix well quickly and immediately perform electrophoresis at 120 V for 15 min. After electrophoresis, immediately remove the gel from the electrophoresis tank for observation. RNA with good quality should show three clear and neat bands.

[0078] b) Detect the concentration of RNA with a UV spectrophotometer. Measure the ratio of RNA at OD 260 / OD 280 to detect the purity of RNA. The ratio at OD 260 / OD 280 should be between 1.8 and 2.0, indicating high purity of RNA without contamination by DNA and proteins.

[0079] 1.2 cDNA Reverse Transcription

[0080] Use a reverse transcription kit: FastKing cDNA First Strand Synthesis Kit (Genome Removing) (KR116) to synthesize cDNA. The steps are as follows:

[0081] (1) Prepare the genomic DNA removal system according to the following system, mix well, centrifuge briefly, then incubate at 42 °C for 3 min. Then place it on ice.

[0082] 5×gDNA Buffer 2 μL

[0083] Total RNA 50 ng - 2 μL

[0084] RNAase-Free ddH2O Make up to 10 μL

[0085] (2) Prepare the reverse transcription reaction system mixture Mix and add it to the reaction solution in ①, mix well. Incubate at 42 °C for 15 min.

[0086]

[0087] (3) Incubate at 95 °C for 3 min, then place on ice and store the obtained cDNA at low temperature.

[0088] 1.3 Cloning and Sequencing of Open Reading Frame

[0089] (1) Primer sequences: According to the sequencing results, design the upstream and downstream primers TaERF109-F and TaERF109-R for the gene to amplify the open reading frame of the gene.

[0090] TaERF109-F: ATGGAGAAGAGCCGGCAGT

[0091] TaERF109-R: CTAGTAGCAGAGGGGTACC

[0092] (2) PCR reaction system (50 μL):

[0093]

[0094] (3) PCR reaction procedure is as follows:

[0095]

[0096] (4) After the amplified fragment was recovered, it was ligated to the pEASY-Blunt simple vector and transformed into Escherichia coli Trans1T1.

[0097] 1.4 Gene expression analysis

[0098] (1) RNA extraction

[0099] When wheat seeds germinated normally and were cultured in Hoagland nutrient solution until the plant height reached about 10 cm (about 2 weeks), they were treated with alkaline salt (100 mM NaHCO3:Na2CO3 = 9:1). At 0, 24 h, and 48 h after treatment, root tissues were taken to extract RNA.

[0100] (2) Reverse transcription to generate cDNA

[0101] Reverse transcription was carried out to generate cDNA, and the method was the same as above.

[0102] (3) PCR reaction and electrophoresis

[0103] a. Using cDNA as a template, PCR reaction was carried out. The primers were as follows:

[0104] TaERF109-qF: GGCGGCGGAGGAACAAGAA

[0105] TaERF109-qR: AAGCCGTCCCAGAGCAGGT

[0106] b. PCR system:

[0107]

[0108] c. PCR procedure:

[0109] 95 °C for 5 min; 25 - 30 cycles of 95 °C for 20 s, 57 °C for 60 s, 72 °C for 60 s; 72 °C for 7 min.

[0110] Determine the number of PCR cycles based on the amplification of internal reference cyclophilin A, and adjust the amount of cDNA template added.

[0111] The results are shown in Figure 1 。

[0112] Example 2. Construction of plant expression vector (Ubi promoter)

[0113] 2.1 Construction of plant expression vector with Ubi promoter

[0114] Using the plant expression vector pGA3426, double digest the pGA3426 vector with KpnⅠ and HindⅢ, recover the large fragment of the vector, amplify the target fragment with phanta max super-fidelity DNA polymerase, recover the amplified fragment, and transform the competent cells of Escherichia coli Trans1 T1 by homologous recombination with Basic Assembly Mix. After identifying the recombinant, the plant expression vector carrying the target gene is obtained.

[0115] (1) Double digestion of plant expression vector pGA3426 with KpnⅠ and HindⅢ

[0116] Extract the empty vector plasmid of pGA3426 by alkaline lysis method, take 4 μg for each digestion, and the digestion system is as follows:

[0117]

[0118] Digest at 37°C in a constant temperature water bath for 1 hour. After double digestion, use 1×TAE as the electrophoresis buffer, and perform 1% agarose gel electrophoresis on the digestion products. Cut off the 11 kb large fragment of the vector in pGA3426 with a clean blade under the ultraviolet transilluminator, and recover this band.

[0119] (2) Amplification of target gene

[0120] a. The primers are as follows:

[0121] TaERF109-pGA3426-F:

[0122] CTGCAGGAATTCGATATCAAGCTTATGGAGAAGAGCCGGCAGT

[0123] TaERF109-pGA3426-R:

[0124] GGGGAAATTCGGGTACCCTAGTAGCAGAGGGGTACCCCT

[0125] b. The PCR system is as follows

[0126]

[0127]

[0128] c. PCR procedure:

[0129] 95°C for 3 min; 25 - 35 cycles of 95°C for 15 s, 57°C for 15 s, 72°C for 60 s; 72°C for 5 min.

[0130] Perform 1% agarose gel electrophoresis on the PCR products. Use a clean blade to cut out the target fragment under an ultraviolet transilluminator and recover the band.

[0131] (3) Homologous recombination of the recovered pGA3426 vector fragment and the target fragment is carried out using Basic AssemblyMix homologous recombinase at a molar ratio of 1:2 at 50°C.

[0132] (4) Transform Escherichia coli Trans1 T1 competent cells by heat shock method with the homologous recombination products. Incubate the transformed bacteria on an LB solid plate containing 50 μg / mL Kan at 37°C for about 16 hours.

[0133] (5) Identification of recombinants

[0134] a. PCR verification of plasmids

[0135] Pick single colonies and inoculate them into 5 mL of LB liquid medium containing Kan, and incubate them at 37°C with shaking overnight. Extract the plasmids by alkaline denaturation method and perform PCR amplification using the primers UBF (upstream primer) and UTA (downstream primer) on the vector. The primers are as follows:

[0136] UBF: 5’-GCCCTGCCTTCATACGCT-3’

[0137] UTA: 5’-GCGGGACTCTAATCATAAA-3’

[0138] The reaction system is as follows:

[0139] The PCR reaction conditions are as follows:

[0140]

[0141] Identify the PCR products by 1.0% agarose gel electrophoresis.

[0142] b. Restriction enzyme digestion identification of plasmids

[0143] Extract plasmids and perform double digestion with KpnⅠ and HindⅢ. The digestion system is the same as above. Perform 1.0% agarose gel electrophoresis to detect whether there are fragments with the expected molecular weight to verify the correct construction of the vector.

[0144] Example 3: Preparation and Transformation of Agrobacterium Competent Cells

[0145] 3.1 Preparation of Agrobacterium EHA105 Competent Cells

[0146] (1) Pick a single colony of Agrobacterium tumefaciens from a YEP plate (containing 50 μg / mL rifampicin) and inoculate it into a YEP liquid medium containing 50 μg / mL rifampicin. Incubate overnight at 28 °C with shaking at 200 rpm.

[0147] (2) Transfer 2 mL of the overnight culture into 50 mL of YEP liquid medium containing the same antibiotic and incubate under the same conditions until the OD 600 reaches 0.5.

[0148] (3) Incubate the bacterial suspension on ice for 30 min, then centrifuge at 5,000 rpm for 10 min at 4 °C to collect the bacterial cells.

[0149] (4) Resuspend the bacterial cells in 10 mL of ice-cold 0.15 M NaCl, and centrifuge to collect the bacterial cells.

[0150] (5) Resuspend the cells in 1 mL of ice-precooled 20 mM CaCl2 solution, aliquot the suspension into 1.5 mL Eppendorf tubes at 200 μL / tube, and quickly freeze in liquid nitrogen for 1 min. Store at -70 °C for later use.

[0151] 3.2 Transformation of Agrobacterium EHA105 by Freeze-Thaw Method

[0152] (1) Thaw the Agrobacterium competent cells at room temperature, add 1 μg of the expression vector plasmid DNA, mix well, and incubate on ice for 5 min.

[0153] (2) Quickly freeze in liquid nitrogen for 5 min, immediately transfer to 37 °C for 5 min, and then incubate on ice for 5 min again.

[0154] (3) Add 800 μL of antibiotic-free YEP and incubate with shaking at 28 °C for 3 h.

[0155] (4) Centrifuge at 7,000 rpm for 30 s to collect the bacterial cells, spread them on a YEP plate containing 50 μg / mL rifampicin and 50 μg / mL Kan, and incubate in the dark at 28 °C for 2 - 3 days.

[0156] 3.3 Identification of Bacterial Cells by PCR

[0157] Pick single colonies and perform PCR amplification using UBF (upstream primer) and UTA (downstream primer). The primers are as follows:

[0158] UBF: 5’-GCCCTGCCTTCATACGCT-3’

[0159] UTA: 5’-GCGGGACTCTAATCATAAA-3’

[0160] The system is as follows:

[0161] The PCR reaction conditions are as follows:

[0162]

[0163] The PCR products were identified by 1.0% agarose gel electrophoresis.

[0164] Example 4, Transgenic Function Verification - Wheat Transformation and Screening

[0165] 4.1 Wheat Transformation

[0166] (1) Select plump YM20 seeds, soak them in 70% ethanol for 5 min, then rinse them 4 times with sterile water and soak them in sterile water overnight. Transfer the germinated YM20 seeds to a sterile petri dish lined with wet filter paper and incubate them in the dark for 3 days.

[0167] (2) One day before transformation, add 2 mL of activated Agrobacterium to 200 mL of YEP medium containing the corresponding antibiotics and incubate it overnight until OD 600 = 1.0 - 1.2.

[0168] (3) Centrifuge to collect the bacterial cells and resuspend them in the infection solution to make OD 600 = 0.8.

[0169] (4) Use the shoot tip method for wheat transformation. Cut the wheat young shoots with a scalpel to expose the growth point and soak them in the infection solution, then apply vacuum for 15 min and maintain the pressure for 15 min.

[0170] (5) After the vacuum treatment, pour out the infection solution and drain it. Lay the wheat seedlings flat on a sterile petri dish lined with wet filter paper and incubate them in the dark for 3 days, then incubate them at 4°C for 2 weeks.

[0171] (6) Transfer the wheat young shoots to the culture soil for normal growth.

[0172] (7) Take the leaves of the normally growing wheat seedlings and put them into a 2.0 mL EP tube filled with steel beads. Extract the wheat genomic DNA by the CTAB method and identify the wheat transgenic events using TaERF109 specific primers.

[0173] (8) Extract the wheat Total RNA and identify the change in the expression level of transgenic wheat plants using TaERF109 primers.

[0174] 4.2 Transgenic Wheat Function Verification

[0175] (1) Soak the transgenic wheat seeds and the control YM20 seeds overnight, lay them flat on the wet filter paper, and transfer them to a black culture box after the seeds germinate.

[0176] (2) When TaERF109 - OE, TaERF109 - RNAi and YM20 in some of the black culture boxes grow to the one - leaf - one - heart stage, apply 100 mM NaHCO3:Na2CO3 = 9:1 and 200 mM NaCl respectively for 10 days, and the remaining TaERF109 - OE, TaERF109 - RNAi and YM20 are cultured normally as controls.

[0177] (3) Taking the fresh weight as the phenotypic standard, when treated with 100 mM NaHCO3:Na2CO3 = 9:1 or 200 mM NaCl, the fresh weight of TaERF109 - OE is higher than that of YM20, while the fresh weight of TaERF109 - RNAi is lower than that of YM20, indicating that increasing the expression of TaERF109 enhances the salt - alkali tolerance of wheat, while RNAi interference of TaERF109 reduces the resistance of wheat to salt - alkali stress. See Figure 2 、 Figure 3 。

[0178] The nucleotide sequences involved in the present invention:

[0179] The salt - alkali tolerance gene TaERF109 of wheat

[0180] ATGGAGAAGAGCCGGCAGTACATGATCCGCTTCGAGGACCCGAGCTCCGC

[0181] GGCCGCGGAGCCACAGGTGCCGTTCGCCGGCAAGGTTTTCTCGCCGGAGC

[0182] AGGAGCAGAGCGTCATGGTCGCCGCGCTGCTGCACGTCGTCTCCGGGTAC

[0183] ACCACGCCGGCGCCGGAGTTCTTCTTCCCGGCGAGCAAGCAGGCGTGCTC

[0184] GGCGTGCGGGATGGACGGATGCCTCGGGTGCGGGTTCTTCAGCGCGGAGG

[0185] CCGGGCGCGCGATAAAGGCATTGGACGCGCCGAGAGCGCCGGCCGCGGC

[0186] GACGGCTGGCGGGCCGCAGAGGCGGCGGAGGAACAAGAAGAACCAGTAC

[0187] CGCGGCGTCAGGCAGCGGCCCTGGGGCAAGTGGGCGGCGGAGATCCGCG

[0188] ACCCGCGCCGCGCCGTGCGGGTGTGGCTCGGGACCTTCGAGACGGCCGAG

[0189] GACGCCGCCAGGGCCTACGACCGCGCCGCCGTCGAGTTCCGCGGCCCGCG

[0190] CGCCAAGCTCAACTTCTCCTTCCCCGAGCAGCAGCAGCAGCAGCAGCAGC

[0191] TAGGCGGCAGCGGCAATGCCGCCCCGGCCAAGTCAGACGCGTGCTCGCCG

[0192] TCGCCTTCGCCCCGCAGTGCGGACGAGGGGGAAACAGGGGACCTGCTCTG

[0193] GGACGGCTTTGTGGACTTGATGAAGCTGGACGAGAGCGAGCTCTGCTTAC

[0194] TGCTCCCGGTCGACAACACTTCGGATAAATTTCACGCACCGGGACAGAGACGATTAGGATCAGGGGTACCCCTCTGCTACTAG(SEQ ID NO.1)

[0195] It should be noted that the above examples are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the given examples, those of ordinary skill in the art can modify or equivalently replace the technical solution of the present invention according to needs, without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A wheat salt-tolerant ERF transcription factor gene, named TaERF109, characterized in that, The wheat salt-tolerant ERF transcription factor gene is selected from: (a1) the nucleotide sequence shown in SEQ ID NO.1; (a2) a nucleotide sequence that encodes a protein with the same amino acid sequence as that encoded by the nucleotide sequence of (a1), but is different in sequence due to the degeneracy of the genetic code; (a3) a nucleotide sequence that has ≥ 90% identity with the nucleotide sequence shown in (a1) or (a2) and encodes a protein with the same or similar functional protein; (a4) a nucleotide sequence complementary to any one of (a1)-(a3).

2. A protein, characterized in that, The protein is encoded by the wheat salt-tolerant ERF transcription factor gene described in claim 1, and the protein is specifically a wheat salt-tolerant ERF transcription factor.

3. A recombinant expression vector, characterized in that, The recombinant expression vector contains the wheat salt-tolerant ERF transcription factor gene described in claim 1.

4. A transgenic cell line, host bacterium or transgenic plant containing the wheat salt-tolerant ERF transcription factor gene described in claim 1.

5. The transgenic cell line, host bacterium or transgenic plant according to claim 4, characterized in that, The transgenic cell line is isolated, in vitro, cultured, or preferably a part of a plant; wherein, the plant cell is a crop cell, and the crop is a monocotyledonous crop, including the cells of any one of sorghum, soybean, corn, rice, barley, wheat, and quinoa; Wherein, the host bacterium is a eukaryotic fungus (including fungi) or a prokaryotic bacterium (including bacteria). The transgenic plant is a transgenic crop, and further preferably a monocotyledonous crop, including any one of sorghum, corn, rice, barley, wheat, and quinoa.

6. The application of the wheat salt-tolerant ERF transcription factor gene described in claim 1, the protein described in claim 2, the recombinant expression vector described in claim 3, or the transgenic cell line, host bacterium or transgenic plant containing the wheat salt-tolerant ERF transcription factor gene described in any one of claims 4-5 in any one or more of the following: (b1) Regulation of plant salt tolerance; (b2) Improvement and cultivation of plants.

7. The application according to claim 6, wherein In the above (b1), the regulation of plant salt tolerance is specifically manifested as: overexpressing the wheat salt-tolerant ERF transcription factor gene in wheat, then improving / promoting plant salt tolerance, and performing RNA interference in wheat to reduce its expression, then reducing / inhibiting plant salt tolerance.

8. The application according to claim 6, wherein In the above (b2), the improvement and cultivation of plants are specifically manifested as improving and cultivating plant varieties with salt tolerance.

9. A method for improving and cultivating salt-alkali tolerant plants, characterized in that, The method includes increasing the expression level and / or activity of the TaERF109 gene described in claim 1 in the target plant.

10. The method according to claim 9, wherein The target plant is a crop, and further a monocotyledonous crop, including sorghum, corn, rice, barley, wheat, and quinoa.

Images