Highland barley flavonoid glycosyl transferase gene and application thereof

Through the expression of the glycosylation transferase gene HOVUSG6091200 of the flavonoid compound in highland barley, the problem of unclear enzymatic mechanism of glycosylation modification of flavonoid compounds in highland barley is solved, and the efficient glycosylation of a variety of flavonoid compounds is achieved, which enhances the health care value and application potential of barley and tobacco.

CN120330281AActive Publication Date: 2025-07-18AGRI RES INST TIBET ACADEMY OF AGRI & ANIMAL HUSBANDRY SCI +1

Patent Information

Application Number
CN202510549021.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-28
Publication Date
2025-07-18
Estimated Expiration
2045-04-28

AI Technical Summary

Technical Problem

In the prior art, the enzymatic mechanism of glycosylation modification of flavonoids in highland barley has not been fully understood, resulting in low biosynthesis efficiency and limiting its application potential in the fields of functional food and pharmaceutical intermediates.

Method used

It provides a flavonoid glycosyltransferase gene HOVUSG6091200, a recombinant carrier and recombinant bacteria, which can catalyze the conversion of a variety of flavonoid compounds into flavonoid glucoside, and express the enzyme in flavonoids and tobacco through genetic engineering technology, thereby improving its biological activity and stability.

Benefits of technology

It has achieved efficient glycosylation modification of a variety of flavonoids, enhanced the health value and application potential of barley and tobacco, and provided a wide range of application prospects for genes, vectors and recombinant bacteria.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330281A_ABST
    Figure CN120330281A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a highland barley flavonoid glycosyl transferase gene and application thereof. A novel glycosyl transferase gene HOVUSG6091200 in highland barley is found, and protein expressed by the gene can efficiently catalyze glycosylation modification of various flavonoid compounds, so that flavonoid compound glucoside is prepared, and the health-care value of the highland barley is improved; the gene is also transferred into tobacco, so that the highland barley flavonoid glycosyl transferase gene is also expressed in a tobacco plant, flavonoid glucoside is further generated, and the value of the tobacco plant is improved; the novel gene, the recombinant vector, the recombinant bacteria and the transgenic plant provided by the invention have good application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a glucosyltransferase gene of flavonoid compounds in hulless barley and its uses. Background Art

[0002] As a cold-resistant crop unique to the Qinghai-Tibet Plateau region, hulless barley has long adapted to extreme environments with high altitude, low oxygen, and strong ultraviolet radiation. Its seeds and stems are rich in flavonoid compounds, and these secondary metabolites play a key role in plant stress resistance, antioxidant activity, and interaction with soil microorganisms. However, the biological activity and stability of natural flavonoid compounds are easily affected by environmental factors, and the realization of their functions in plants depends on the regulation of glycosylation modification.

[0003] Flavonoid glycosylation modification significantly enhances its water solubility, chemical stability, and transmembrane transport ability by adding sugars (such as glucose, rhamnose, etc.) to the flavonoid skeleton structure. In addition, glycosylation modification can regulate the biological activity of flavonoid compounds and affect their functional specificity in plant disease resistance, ultraviolet absorption, and signal transduction. Although the role of glycosyltransferases (GTs) in plant secondary metabolism has been widely studied, the enzymatic mechanism of flavonoid glycosylation modification in hulless barley is still in the exploratory stage.

[0004] In recent years, through transcriptomics and metabolomics analysis, multiple glucosyltransferase genes (such as HvGT1-4) involved in flavonoid glycosylation modification have been identified in hulless barley. However, existing studies mostly focus on glycosyltransferases with single substrate specificity, and no multifunctional glycosyltransferase capable of achieving efficient glycosylation modification on multiple flavonoid substrates has been found. This technical gap limits the biosynthesis efficiency of flavonoid compounds in hulless barley and their application potential in fields such as functional foods and pharmaceutical intermediates. Summary of the Invention

[0005] In view of the problems of the prior art, the present invention provides a glucosyltransferase gene of flavonoid compounds in hulless barley and its uses.

[0006] Use of a gene with a nucleotide sequence as shown in SEQ ID NO.3 in the preparation of flavonoid glucosides; the flavonoid glucosides are selected from at least one of chrysoeriol-7-O-glucoside, luteolin-7-O-glucoside, eriodictyol-7-O-glucoside, apigenin-7-O-glucoside, quercetin-7-O-glucoside, kaempferol-3-O-glucoside, and cyanidin-3-O-glucoside.

[0007] The present invention also provides the use of a recombinant vector containing a gene with a nucleotide sequence as shown in SEQ ID NO.3 in the preparation of flavonoid glucosides; the flavonoid glucosides are selected from at least one of chrysoeriol-7-O-glucoside, luteolin-7-O-glucoside, eriodictyol-7-O-glucoside, apigenin-7-O-glucoside, quercetin-7-O-glucoside, kaempferol-3-O-glucoside, and anthocyanin-3-O-glucoside.

[0008] Preferably, the recombinant vector is recombinant pGEX-6P-1 or recombinant pEAQ.

[0009] The present invention also provides the use of a recombinant bacterium containing a gene with a nucleotide sequence as shown in SEQ ID NO.3 in the preparation of flavonoid glucosides; the flavonoid glucosides are selected from at least one of chrysoeriol-7-O-glucoside, luteolin-7-O-glucoside, eriodictyol-7-O-glucoside, apigenin-7-O-glucoside, quercetin-7-O-glucoside, kaempferol-3-O-glucoside, and anthocyanin-3-O-glucoside.

[0010] Preferably, the recombinant bacterium is recombinant Escherichia coli or recombinant Agrobacterium;

[0011] Preferably, the recombinant bacterium is recombinant Transetta or recombinant Agrobacterium EHA105.

[0012] The present invention also provides the use of a protein with an amino acid sequence as shown in SEQ ID NO.4 in the preparation of flavonoid glucosides; the flavonoid glucosides are selected from at least one of chrysoeriol-7-O-glucoside, luteolin-7-O-glucoside, eriodictyol-7-O-glucoside, apigenin-7-O-glucoside, quercetin-7-O-glucoside, kaempferol-3-O-glucoside, and anthocyanin-3-O-glucoside.

[0013] The present invention also provides a method for preparing flavonoid glucosides, which uses a protein with an amino acid sequence as shown in SEQ ID NO.4, with glucose as a glycosyl donor and a flavonoid as a glycosyl acceptor to prepare flavonoid glucosides; the flavonoids are selected from at least one of chrysoeriol, luteolin, eriodictyol, quercetin, apigenin, kaempferol, and anthocyanin.

[0014] The present invention also provides a method for constructing a transgenic plant for producing flavonoid glucosides, which includes the following steps:

[0015] The gene with the nucleotide sequence shown in SEQ ID NO.3 is transferred into a plant, and a plant expressing the protein with the amino acid sequence shown in SEQ ID NO.4 is obtained; the plant is hulless barley or tobacco.

[0016] Preferably, the method for transferring into the plant is one of the Agrobacterium method, the gene gun method, the electrotransformation method, the PEG-mediated method, the liposome method, and the calcium phosphate-DNA coprecipitation method.

[0017] The present invention also provides the use of the gene with the nucleotide sequence shown in SEQ ID NO.3, the recombinant vector containing the gene with the nucleotide sequence shown in SEQ ID NO.3, and the recombinant bacterium containing the gene with the nucleotide sequence shown in SEQ ID NO.3 in the preparation of transgenic plants for producing flavonoid glucosides; the plant is hulless barley or tobacco; the flavonoid glucosides are selected from at least one of chrysoeriol-7-O-glucoside, luteolin-7-O-glucoside, eriodictyol-7-O-glucoside, apigenin-7-O-glucoside, quercetin-7-O-glucoside, kaempferol-3-O-glucoside, and cyanidin-3-O-glucoside.

[0018] The present invention provides a glycosyltransferase gene HOVUSG6091200 derived from hulless barley with broad substrate adaptability. The protein expressed by this gene, hulless barley flavonoid glycosyltransferase, can convert a variety of flavonoids into flavonoid glucosides, improve the health value of hulless barley, and promote the directional improvement of hulless barley; in the present invention, the gene fragment is used for in vitro expression to obtain hulless barley flavonoid glycosyltransferase. Glucose is used as the glycosyl donor and flavonoids are used as the glycosyl acceptor in the in vitro reaction, and flavonoid glucosides are successfully prepared; the present invention also transfers this gene into tobacco, so that the hulless barley flavonoid glycosyltransferase gene is also expressed in tobacco plants, further producing flavonoid glucosides and improving the value of tobacco plants. The new gene, its recombinant vector, recombinant bacterium, and transgenic plants provided by the present invention all have good application prospects.

[0019] Obviously, based on the above content of the present invention, according to the common general knowledge and customary means in the art, without departing from the above basic technical idea of the present invention, various other forms of modification, substitution, or change can be made.

[0020] The above content of the present invention will be further described in detail below through specific embodiments in the form of examples. However, this should not be understood as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 For the purification and analysis of HvUGT71A2 protein. The HvUGT71A2 protein was purified using an Escherichia coli expression system. SP (supernatant) is the total soluble protein after cell disruption and centrifugation; FT (flow-through) is the protein that did not bind to the resin; W2, W3, and W4 are the collected solutions of the second, third, and fourth elution fractions respectively; E1 and E2 are the first and second elution fractions; M is the protein molecular weight marker (protein ladder), Marker: 100, 70, 55, 40, 35, 25 kDa.

[0022] Figure 2 A. HvUGT71A2 catalyzes the glycosylation reaction of anthocyanins. The results of the enzymatic reaction show that HvUGT71A2 can catalyze the O-glucosylation reaction of Cyanidin at the 3-hydroxyl group. B. Schematic diagram of the one-step reaction mechanism of HvUGT71A2-catalyzed anthocyanin modification.

[0023] Figure 3 Regarding the glycosylation activity of HvUGT71A2 towards various flavonoid compounds, the results of the enzymatic reaction show that HvUGT71A2 can catalyze the O-glucosylation reaction of Chrysoeriol (Chr), Luteolin (Lut), Eriodictyol (Eri), Quercetin (Que), and Apigenin (Api) at the 7-hydroxyl group, and catalyze the O-glucosylation reaction of Kaempferol (Kae) at the 3-hydroxyl group.

[0024] Figure 4 For the speculation of the reaction steps for the in vitro enzymatic activity function verification of HvUGT71A2. All experiments were based on three independent replicates (n = 3), and the data are presented as mean ± standard deviation.

[0025] Figure 5 Mass spectra of Chrysoeriol 3-O-glucoside, Chrysoeriol 7-O-glucoside, Luteolin 7-O-glucoside, Eriodictyol 7-O-glucoside, Kaempferol 3-O-glucoside, Quercetin 7-O-glucoside, and Apigenin 7-O-glucoside. Specific implementation manners

[0026] In the following examples and experimental examples, the reagents and raw materials not specifically described are commercially available products.

[0027] Example 1 Construction of HOVUSG6091200 gene, vector, and prokaryotic expression

[0028] This example mainly describes the methods for obtaining the HvUGT71A2 (HOVUSG6091200) gene, constructing a vector, and prokaryotic expression.

[0029] 1. Obtaining the target gene HOVUSG6091200

[0030] Weigh 2 grams of fresh leaves of hulless barley, extract the RNA of hulless barley, and use the M-MLV Reverse Transcriptase from Thermo Fisher Company to synthesize cDNA. Design primers as follows:

[0031] F: ATGGCGCCCCCGC (SEQ ID NO.1)

[0032] R: TCACACCCGACAAACTATCTCGACA (SEQ ID NO.2)

[0033] Perform PCR amplification to obtain a fragment of the target band size (the result is as Figure 1 shown). Purify the PCR product using a Gel Extraction Kit (Gel Extraction Kit D2500-02, OMEGA).

[0034] The nucleotide sequence (SEQ ID NO.3) of the amplified target fragment HOVUSG6091200 gene is:

[0035]

[0036] The HOVUSG6091200 gene described by the foregoing nucleotide sequence can be obtained by using the above method or directly synthesized.

[0037] 2. Construction of vector

[0038] The gene HOVUSG6091200 was transferred into the vector pGEX-6P-1 to obtain a recombinant vector.

[0039] 3. Construction of recombinant strain

[0040] The above recombinant vector was transferred into the Transetta(DE3) strain to obtain a recombinant strain containing the target fragment.

[0041] 4. Expression of target gene

[0042] (1) PCR was used to detect positive clones, and plasmids were extracted for sequencing.

[0043] (2) The plasmid vector with correct sequencing was heat-shock transformed into Escherichia coli transeta(DE3) with resistance to CN.

[0044] (3) Randomly pick 2 normal-sized clones into 5 mL of LB medium containing ampicillin (Amp) and culture them in a shaking flask at 37 °C for 7 hours. Select one of them and transfer 4 mL of the activated bacterial solution (concentration 1×10 6 ~10 7 cfu / ml) to 200 mL of LB medium in a large flask according to a 1:50 ratio, and culture it on a large shaker at 37 °C with a rotation speed of 200 rpm. After 3 - 4 hours, add 2 μL of 1 M IPTG inducer to the 200 mL medium and induce overnight at 20 °C and 160 rpm. The remaining 1 mL of bacterial solution is used for preserving bacteria.

[0045] (4) Collect the bacterial cells the next morning, put them into a 500 mL centrifuge bottle, and centrifuge at 4000 rpm for 10 min.

[0046] (5) Resuspend the bacterial cells with 50 mL of Lysis buffer, vortex to mix evenly, transfer them into a 50 mL centrifuge tube, add 50 μL of PMSF and 10 μL of β-mercaptoethanol respectively, mix well and place on ice.

[0047] (6) Conduct an experiment on disrupting Escherichia coli cells using a high-pressure cell disruptor.

[0048] (7) After the sample is broken, take 20 μL as the total protein sample. Then take 1 mL of the broken sample, centrifuge it at 13,000 rpm for 10 min at 4 °C, and take 20 μL of the supernatant as the supernatant sample. Add an equal volume of 2*Loading buffer to the supernatant sample, boil it for 5 min, and detect the protein expression by SDS-PAGE electrophoresis. The remaining supernatant can be temporarily stored in a -20 °C refrigerator. The remaining uncentrifuged sample can be stored in an -80 °C refrigerator.

[0049] (8) After SDS-PAGE electrophoresis is completed, add Coomassie Brilliant Blue staining solution, boil it in a microwave oven for 1 min and then stain for half an hour, and add decolorizing solution for decolorization. Change the decolorizing solution every 1 h until the protein bands are clear, and transfer to clean water.

[0050] (9) Purification of GST-tagged fusion protein. Centrifuge all the uncentrifuged broken samples, mix the supernatant with 1 mL of resin on a 4 °C mixer for 3 h. After mixing, pass the mixture through the chromatography column and flow through it twice. First, wash the resin with pre-cooled Lysis buffer (Glutathione SepharoseTM 4B, GE Healthcare) while detecting the effluent with Bradford Assay until it no longer turns blue, indicating that the contaminating proteins have been washed away. Then, elute the target protein with 15 mmol / L reduced glutathione solution (0.09 g dissolved in 20 mL lysis buffer), add 1 mL each time, collect at the bottom of the chromatography column with 1.5 mL centrifuge tubes, about 1 mL per tube, and label them as E1, E2, E3, E4, E5, E6 respectively until Bradford Assay detects that there is no protein in the eluate. The remaining reduced glutathione solution is used to continue eluting the resin completely, and then wash it with Lysis buffer, ddH2O, and 20% ethanol respectively, and store it in 20% ethanol.

[0051] (10) The collected protein is detected by SDS-PAGE, and a band of 76 kDa is obtained ( Figure 1 ). The molecular weight of the GST tag is 26 kDa, and the molecular weight of the remaining target protein is approximately 50 kDa, which is the same as the molecular weight calculated from the amino acids, indicating that the target protein with GST tag is prepared by the present invention.

[0052] The amino acid sequence of the target protein (SEQ ID NO.4) is as follows:

[0053] MAPPPPHIAVVAFPFSSHAAVLFSFARALAAAAPAGTSLSFLTTADNAAQLRKAGALPGNLRFVEVPDGVPPGETSWLSPPRRMELFMAAAEAGGVRAGLEAACASAGGARVSCVVGDAFVWMAADAASAAGAPWVAVWTAASCALLAHLRTDALRRDVRDQAASRADELLTAHAGLGGYRVRDLPDGVVSGDFNYVISLLVHRQAQRLPKAATAVALNTFPGLDPPDLTAALAAELPNCQPLGPYHLLPGAEPTADTNEAPADPHGCLAWLDRRPARSVAYVSFGTNATARPDELQELAAGLEASGAPFLWSLREESWPLLPPGFLERAPGLVVPWAPQVGVLRHAAVGAFVTHAGWASVMEGVSSGVPMACRPFFGDQTMNARSVASVWGFGTAFDGPMTRGAVANAVATLLRGEDGERMRAKAQELQAMVGKAFEPDGGCRKNFDEFVEIVCRV

[0054] Example 2 Construction of Transgenic Tobacco

[0055] ① Transform the Agrobacterium tumefaciens (EHA105) with the transient expression vector containing the target gene HOVUSG6091200 (the transient expression vector pEAQ, from John Innes Centre).

[0056] ② Pick positive Agrobacterium clones and inoculate them into 500 μl of LB containing the corresponding antibiotic (kn), and culture for 20 - 24 hours.

[0057] ③ Transfer 200 μl to 5 ml of LB containing the corresponding antibiotic (kn), and shake at 220 rpm on a shaker at 28°C until OD = about 2.0.

[0058] ④ Centrifuge at 10000 rpm for 2 min at room temperature to collect the bacteria, resuspend the bacteria with the pre-prepared transformation buffer, and shake on a shaker for 3 h; the components and concentrations of the buffer working solution are as follows: 10 mM MES (pH 5.7), 10 mM MgCl2, 100 μM UDP - glucose.

[0059] ⑤ Take a prepared 1-ml syringe, remove the needle, select a syringe with a smooth outlet, suck in the bacterial liquid, take 1-month-old Nicotiana benthamiana, hold the leaf with your hand, and inject from the back of the leaf to allow the Agrobacterium to penetrate. Mark each tobacco plant that has been injected, and the area where the Agrobacterium has penetrated can be circled on the leaf; inject tobacco with an equal volume of transformation buffer as the control tobacco.

[0060] ⑥ The tobacco injected with Agrobacterium is cultured in the dark for 24 h, and then transferred to a tobacco incubator for light culture for 24 - 48 hours to obtain transgenic tobacco.

[0061] The beneficial effects of the present invention are illustrated by the following experimental examples:

[0062] Experimental Example 1 Enzyme Activity Detection of HOVUSG6091200 Protein

[0063] 1. Experimental Method

[0064] 1.1 Obtaining of HOVUSG6091200 Protein

[0065] The target protein with a molecular weight of 76 kDa and a GST tag prepared according to the method of Example 1.

[0066] 1.2 Enzyme Activity Detection

[0067] In Tris-HCl buffer (100 mM, pH 7.4), an in vitro glycosyltransferase assay was performed with a total volume of 100 μl containing 200 μM anthocyanins (Cyanidin, Cya), Chrysoeriol (Chr), Luteolin (Lut), Eriodictyol (Eri), Quercetin (Que), Apigenin (Api), Kaempferol (Kae) as glycosyl acceptors, 100 μM UDP-glucose as glycosyl donor, and 500 ng of purified protein. After incubation for 10 min, 300 μL of ice-cold methanol was added to stop the reaction. Then the reaction mixture was filtered through a 0.2-μm filter (microporous) and then used for LC-MS analysis.

[0068] 2. Experimental Results

[0069] Figure 2 For the glycosylation reaction of Cyanidin catalyzed by HvUGT71A2, the enzymatic reaction results showed that HvUGT71A2 could catalyze the O-glucosylation reaction of Cyanidin at the 3-position hydroxyl group. Figure 3 、 4For the glycosylation activity of HvUGT71A2 towards various flavonoids, the results of enzymatic reactions showed that HvUGT71A2 was able to catalyze the O-glucosylation reaction of Chrysoeriol (Chr), Luteolin (Lut), Eriodictyol (Eri), Quercetin (Que), and Apigenin (Api) at the 7-hydroxyl group, as well as the O-glucosylation reaction of Kaempferol (Kae) at the 3-hydroxyl group. Figure 5 By analyzing the mass spectrometry of the in vitro enzymatic products, it was demonstrated that the HOVUSG6091200 protein of the present invention had the ability to catalyze the glycosylation conversion of Chrysoeriol (Chr), Luteolin (Lut), Eriodictyol (Eri), Quercetin (Que), Apigenin (Api), and Kaempferol (Kae) into Chrysoeriol 7-O-glucoside, Luteolin 7-O-glucoside, Eriodictyol 7-O-glucoside, Quercetin 7-O-glucoside, Apigenin 7-O-glucoside, and Kaempferol 3-O-glucoside, showing good prospects for market application.

[0070] In summary, the present invention provides a glycosyltransferase gene HOVUSG6091200 derived from hulless barley with broad substrate adaptability. The protein expressed by this gene - hulless barley flavonoid glycosyltransferase can convert various flavonoids into flavonoid glucosides, improving the health value of hulless barley and promoting the targeted improvement of hulless barley. The present invention carried out in vitro expression using this gene fragment to obtain hulless barley flavonoid glycosyltransferase. In the in vitro reaction, glucose was used as the glycosyl donor and flavonoids as the glycosyl acceptor, and flavonoid glucosides were successfully prepared. The present invention also transferred this gene into tobacco, enabling the expression of the hulless barley flavonoid glycosyltransferase gene in tobacco plants, further producing flavonoid glucosides and increasing the value of tobacco plants. The new gene provided by the present invention, as well as its recombinant vector, recombinant bacterium, and transgenic plant, all have good application prospects.

Claims

1. Use of a gene with a nucleotide sequence as shown in SEQ ID NO.3 in the preparation of flavonoid glucosides; the flavonoid glucosides are selected from at least one of chrysoeriol-7-O-glucoside, luteolin-7-O-glucoside, eriodictyol-7-O-glucoside, apigenin-7-O-glucoside, quercetin-7-O-glucoside, kaempferol-3-O-glucoside, and cyanidin-3-O-glucoside.

2. Use of a recombinant vector containing a gene with a nucleotide sequence as shown in SEQ ID NO.3 in the preparation of flavonoid glucosides; the flavonoid glucosides are selected from at least one of chrysoeriol-7-O-glucoside, luteolin-7-O-glucoside, eriodictyol-7-O-glucoside, apigenin-7-O-glucoside, quercetin-7-O-glucoside, kaempferol-3-O-glucoside, and cyanidin-3-O-glucoside.

3. The use according to claim 2, characterized in that: The recombinant vector is recombinant pGEX-6P-1 or recombinant pEAQ.

4. Use of a recombinant bacterium containing a gene with a nucleotide sequence as shown in SEQ ID NO.3 in the preparation of flavonoid glucosides; the flavonoid glucosides are selected from at least one of chrysoeriol-7-O-glucoside, luteolin-7-O-glucoside, eriodictyol-7-O-glucoside, apigenin-7-O-glucoside, quercetin-7-O-glucoside, kaempferol-3-O-glucoside, and cyanidin-3-O-glucoside.

5. The use according to claim 4, wherein: The recombinant bacterium is recombinant Escherichia coli or recombinant Agrobacterium; preferably, the recombinant bacterium is recombinant Transetta or Agrobacterium EHA105.

6. Use of a protein with an amino acid sequence as shown in SEQ ID NO.4 in the preparation of flavonoid glucosides; the flavonoid glucosides are selected from at least one of chrysoeriol-7-O-glucoside, luteolin-7-O-glucoside, eriodictyol-7-O-glucoside, apigenin-7-O-glucoside, quercetin-7-O-glucoside, kaempferol-3-O-glucoside, and cyanidin-3-O-glucoside.

7. A method for preparing flavonoid glucosides, characterized in that: It uses a protein with an amino acid sequence as shown in SEQ ID NO.4, with glucose as the glycosyl donor and flavonoid as the glycosyl acceptor to prepare flavonoid glucosides; the flavonoid is selected from at least one of chrysoeriol, luteolin, eriodictyol, quercetin, apigenin, kaempferol, and cyanidin.

8. A method for constructing a transgenic plant for producing flavonoid glucosides, characterized in that: It includes the following steps: Take a gene with a nucleotide sequence as shown in SEQ ID NO.3, transfer it into a plant, and obtain a plant expressing a protein with an amino acid sequence as shown in SEQ ID NO.4; the plant is hulless barley or tobacco.

9. The construction method according to claim 8, characterized in that: The method of transferring into the plant is one of Agrobacterium method, gene gun method, electroporation method, PEG-mediated method, liposome method, and calcium phosphate-DNA coprecipitation method. Use of a gene with a nucleotide sequence as shown in SEQ ID NO.3, a recombinant vector containing the gene with a nucleotide sequence as shown in SEQ ID NO.3, and a recombinant bacterium containing the gene with a nucleotide sequence as shown in SEQ ID NO.3 in the preparation of transgenic plants for producing flavonoid glucosides; the plant is hulless barley or tobacco; the flavonoid glucosides are selected from at least one of chrysoeriol-7-O-glucoside, luteolin-7-O-glucoside, eriodictyol-7-O-glucoside, apigenin-7-O-glucoside, quercetin-7-O-glucoside, kaempferol-3-O-glucoside, and anthocyanin-3-O-glucoside.

Citation Information

Patent Citations

  • Establishment method of maize male sterile line

    CN111518828A

  • Highland barley cyanidin rhamnosyltransferase gene and application thereof

    CN114763550A

  • Highland barley cyanidin glycosyl transferase gene and application thereof

    CN114763551A

  • Flavonoid glycosyl transferase as well as coding gene and application thereof

    CN115927240A

  • Application of corn glycosyl transferase ZmUGT84A1 and ZmUGT84A2 in synthesis of flavone glycoside derivatives

    CN117431285A

Cited By

  • Highland barley multifunctional glycosyl transferase and application thereof in flavonoid compound glycosylation modification

    CN122189039A