SNP molecular marker of PRRX2 gene associated with African swine fever virus antibody level, primer and application

Abstract

The invention belongs to the technical field of molecular markers, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker of a PRRX2 gene associated with an African swine fever virus antibody level, a primer and application. The locus of the SNP molecular marker is located at the 143bp position of the third exon of the porcine PRRX2 gene with the gene version number of XM005654574.2, the SNP molecular marker has T / C polymorphism, and the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.3. The invention also discloses a kit for detecting the porcine PRRX2 gene with the gene version number of XM005654574.2. The molecular marker provided by the invention is closely associated with the African swine fever virus antibody level of the pig, and compared with the pig with the genotype of TC / CC at the site, the pig blood with the genotype of TT has a higher African swine fever virus antibody level; the molecular marker can be applied to breeding of high-quality breeding pigs resistant to African swine fever, so that the economic benefit of breeding pigs is effectively improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and specifically relates to an SNP molecular marker, primer and application of the PRRX2 gene associated with the African swine fever virus antibody level. Background Art

[0002] African swine fever (ASF) is a highly contagious disease of pigs caused by infection with African swine fever virus (ASFV). Clinical features include high fever, depression, anorexia, skin cyanosis, and bleeding in various organs. This disease poses a serious threat to the pig industry.

[0003] At present, there are still certain difficulties in the development of ASFV vaccines. The immunogenicity of inactivated vaccines, subunit vaccines, and gene-deleted vaccines has not been fully explored, and complete protection cannot be achieved after vaccination. Research shows that key structural proteins of ASFV, such as the p72 protein located in the viral capsid and the CD2v protein located in the viral envelope, are important antigenic proteins that induce humoral immune responses. The expression of the p72 gene occurs in the late stage of virus infection and is regulated by the viral late promoter. p72 antibodies can be detected on the 17th day after African swine fever virus infection. Its duration is long and the antibody level is high, which is a sign of persistent virus infection or established immunity.

[0004] After pigs are vaccinated with the African swine fever vaccine, there are significant differences in the levels of African swine fever virus antibodies produced. Approximately 67% of individuals have a high level and can provide complete protection, while the rest have a low level and cannot provide complete protection. Therefore, it is necessary to explore SNP molecular markers of genes related to antibody formation and apply them to the breeding of pigs with high African swine fever virus antibody levels. Summary of the Invention

[0005] In order to solve the above technical problems, the present invention provides an SNP molecular marker, primer and application of the PRRX2 gene associated with the African swine fever virus antibody level, in order to provide a new technical means for the genetic improvement of pig breeds.

[0006] The present invention first provides a molecular marker of the PRRX2 gene associated with the African swine fever virus antibody level and the application of this marker in pig breeding; secondly, it provides a primer group for amplifying the molecular marker of the PRRX2 gene associated with the African swine fever virus antibody level, the application of the primer group, and a specific application method.

[0007] In the first aspect of the present invention, an SNP molecular marker of the PRRX2 gene associated with the African swine fever virus antibody level is provided. The SNP molecular marker is located at the 143bp of the 3rd exon of the porcine PRRX2 gene with the gene version number XM_005654574.2, and has T / C polymorphism. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.3.

[0008] TGTCCCGTGACTTTGTGCATGCAGAGCGGTTGGCAAATGGAAGCTCTTGGTTGGAGGGAACGTGAAGCACAGCGAGACCAAAAAGGATGCTGTAGGACCCCAGCCCCTCGAAACAGGTAAAGCTGGAGGTGCTGGGGTCCCTTGCATGTGGCTGGCTGCCCCGTCACCTGCGAAATCCTGCTCAAACTTCAGAAGGCAGTTTAAGGCCCCTTCCGGAGGGCAGCCCTCCCCGGGGCCCCTGCCCCAGCCCACTCCCCCGTGGAGCCCAGATCTGCTCTTCTCCACTGAGCCTGGCTGATTGGCTTCTCTACAGGACCGGACTAACTGGGTCACCACTCTCTCCTCAGCACCCTGGCCGGCTCCCAGCACTGTCAGGCATTCAGTAACAACGTGTTGATGGAAGTCCCAAGCCCTGCTGCATCGGCTGGTGAGCTGGAGCCGGGGTGGGGCTGGGGTCAAACAGGACAGGTCCTGCCCGCAGGCTCTGCTCTAGATCTGGGGGAGCGGTGACGGCGGTGACAGTGGCCGCTGTTGTAAGTGGACATGTGCTATGGGCGGGGCACCCAGCAGATGCTAAGGGTGCCCAGCAGACCCTTCTCGCAGCCTCGTGGTGACCCAGAGGGGCCTGTGTGACTCTTTTGATCCCCCCGCTGGACAGATAAATGAAGCTTTAGGGAAACTTGGAGGGGGGGGCGGTGTTGGAGAGCAGCCAG。

[0009] In the second aspect of the present invention, a primer set for amplifying the SNP molecular marker associated with the African swine fever virus antibody level described in claim 1 is provided. The nucleotide sequence of the upstream primer of the primer set is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.2:

[0010] SEQ ID NO.1: TGTCCCGTGACTTTGTGCAT.

[0011] SEQ ID NO.2: CTGGCTGCTCTCCAACACC.

[0012] In the third aspect of the present invention, a kit for the genotype of the SNP molecular marker associated with the African swine fever virus antibody level is provided. The kit contains the primer set described in the second aspect of the present invention.

[0013] Furthermore, the kit further includes a DNA extraction reagent, a DNA purification reagent, a PCR reaction reagent, an agarose solution, an electrophoresis buffer, and a staining solution.

[0014] In the fourth aspect of the present invention, an application of the SNP molecular marker associated with the African swine fever virus antibody level, the primer set, or the kit in pig breeding is provided.

[0015] Furthermore, the application includes the following steps:

[0016] Performing PCR amplification on the DNA template of the pig using the primer set to obtain a PCR product.

[0017] Performing agarose gel electrophoresis and sequencing on the PCR product.

[0018] Detecting that the African swine fever virus antibody level of the pig breed with the TT genotype at the 143bp position of the 3rd exon of the pig PRRX2 gene is higher than that of the pig breeds with the TC or CC genotype.

[0019] Furthermore, the reaction system for PCR amplification is:

[0020] 2×Taq Master Mix 10 μL, DNA template 1 μL, upstream primer 0.3 μL, downstream primer 0.3 μL, ddH2O 8.4 μL.

[0021] Furthermore, the reaction program for PCR amplification is:

[0022] Pre-denaturation at 95°C for 5 min, denaturation at 95°C for 25 s, annealing at 61°C for 18 s, extension at 72°C for 15 s, 39 cycles; extension at 72°C for 5 min, storage at 10°C.

[0023] In summary, compared with the prior art, the present invention has the following beneficial advantages and effects:

[0024] The present invention provides an SNP molecular marker associated with the African swine fever virus antibody level. The locus of the SNP molecular marker is located at the 143bp of the 3rd exon of the porcine PRRX2 gene with the gene version number XM_005654574.2, having T / C polymorphism. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3. Through in-depth research on the key genes in the porcine antigen presentation pathway, the present invention for the first time provides a new locus significantly related to the African swine fever virus antibody level, and through verification, it is found that the T / C mutation at the 143bp of the 3rd exon of the PRRX2 gene (XM_005654574.2) is negatively correlated with the serum African swine fever virus antibody level of pigs.

[0025] The molecular marker provided by the present invention can be applied to the breeding of African swine fever-resistant pig breeds, thereby improving the breeding efficiency of pig breeds, increasing the disease resistance of animals, improving the health level of animals, and reducing unnecessary breeding costs and time costs. Precision breeding targeting the molecular marker can reduce the elimination rate caused by undesirable traits and further save production costs. In addition, the present invention also has important scientific value for studying the molecular mechanism affecting the African swine fever virus antibody level. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is an image of the correlation analysis between the expression level of the target gene of PRRX2 in lymph nodes and the PRRX2 binding site of the target gene; in the figure, the green dots represent the two-dimensional scatter plot of the binding site score of the target gene regulated by PRRX2 and the expression level of the target gene. The size of the green dots represents the level of the weighted value. The yellow curve in the figure is the weighted fitting curve of the transcription factor binding site score of the target gene and the expression level of the target gene, and the green curve is the average value of the expression level of the target gene.

[0027] Figure 2 It is a sequencing result diagram of 3 pigs with different PRRX2 genotypes; the T143C mutation site is shown in the blue box.

[0028] Figure 3 It is a diagram of the influence of the T143C mutation site of the PRRX2 gene on the African swine fever virus antibody level trait; the ordinate in the figure is the African swine fever virus antibody level (S / N), and the abscissa is the genotype. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0029] In order to enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and the accompanying drawings.

[0030] In the description of the present invention, unless otherwise specified, the reagents used are commercially available, and the methods used are conventional techniques in the art.

[0031] The antigen presentation signaling pathway is closely related to the antibody production of African swine fever, involving the activation of antigen-presenting cells, B cells, and helper T cells. The level of African swine fever virus antibodies is an important indicator characterizing the ability of animals to resist African swine fever and the health level of animals. Since relatively few molecular markers directly related to the trait of African swine fever virus antibody level have been developed currently, it has restricted the application of molecular marker breeding technology in the cultivation of African swine fever-resistant pig breeds.

[0032] The present invention first analyzed the transcriptome sequencing data of pigs infected with African swine fever virus using GRIT / FLAVER software, and found that PRRX2 is a key transcription factor regulating African swine fever virus infection. Among the target genes regulated by PRRX2, ANAPC5, UBE2K, KIF11, and DCTN6 are related to the antigen presentation and antibody production signaling pathways. By comparing the re-sequencing data of 30 Duroc×Landrace×Yorkshire pigs, it was found that there is a T / C polymorphism at the 143bp of the 3rd exon of the PRRX2 gene (XM_005654574.2) of pigs. After designing primers for this specific region and genotyping the DNA samples of 206 pigs, it was found that the genotype frequencies of the SNP locus of the PRRX2 gene showed a trend of TT>TC>CC. Subsequently, it was verified that the SNP molecular marker provided by the present invention is negatively correlated with the level of African swine fever virus antibodies in pig serum and is easy to detect.

[0033] Example 1: Obtaining of PRRX2 gene fragment and SNP molecular marker

[0034] For 6 representative pigs, including 3 pigs infected with African swine fever virus and 3 uninfected control pigs, transcriptome sequencing analysis was carried out, the measurement values of the expression levels of infection / control differentially expressed genes were calculated, and the weighted Kendall correlation of GRIT / FLAVER software was used to statistically test the correlation between the expression levels of pig differentially expressed genes and the transcription factor binding sites in each gene sequence.

[0035] The results are as Figure 1 shown. The higher the score of the transcription factor binding site (gene-set) in the gene sequence, the higher the expression level (gene-list) of the gene. For the gene containing the PRRX2 binding site, there is a significant positive correlation between its expression level and the transcription factor binding site, p<0.05.

[0036] By comparing the re-sequencing data of 30 Duroc×Landrace×Yorkshire pigs, it was found that there is a T / C polymorphism at the 143bp of the 3rd exon of the PRRX2 gene of pigs; 3 individuals with different genotypes were selected for sequencing by the Sanger method, and the comparison results are asFigure 2 As shown, the T143C mutation site is shown at the yellow box.

[0037] Collect 206 blood samples from positive pigs infected with African swine fever virus from a farm in Jingzhou City, Hubei Province, centrifuge to separate serum and cells, and use a peripheral blood DNA extraction kit purchased from Beijing Solarbio Science & Technology Co., Ltd. to extract genomic DNA from the cells.

[0038] According to the nucleotide sequence of the PRRX2 gene with the accession number XM_005654574.2 published in the GenBank database, use Oligo software to design specific primers for the SNP region of the PRRX2 gene, and perform PCR amplification using 206 genomic DNAs of blood cells as templates.

[0039] The upstream primer sequence of the PRRX2 gene is shown in SEQ ID NO.1; the downstream primer sequence is shown in SEQ ID NO.2:

[0040] SEQ ID NO.1: TGTCCCGTGACTTTGTGCAT.

[0041] SEQ ID NO.2: CTGGCTGCTCTCCAACACC.

[0042] Table 1 shows the specific parameters of the PCR reaction system.

[0043] Table 1 PCR reaction system

[0044] Component Content (μL) 2×TaqMasterMix 10 Forward primer (10μM) 0.3 Reverse primer (10μM) 0.3 DNA template 1.0 <![CDATA[ddH2O]]> 8.4

[0045] The PCR amplification program is shown in Table 2.

[0046] Table 2 PCR amplification program

[0047]

[0048] Note: "-" indicates no such item.

[0049] Take 4 μL from each tube of PCR product for agarose gel electrophoresis. After imaging, send the PCR product containing a single band to Shanghai Bioengineering Co., Ltd. for sequencing. Use SeqMan software to compare and analyze the sequencing results, find the mutation sites in the sequence, and record the T143C mutation types at the corresponding sites in each individual.

[0050] The T143C mutation site of the PRRX2 gene showed three genotypes in 206 samples to be tested, with genotype frequencies of TT: 0.78; TC: 0.21; CC: 0.01, showing a trend of TT > TC > CC. The frequency of allele T was 0.88 and the frequency of allele C was 0.12, with the frequency of the T allele being greater than that of the C allele.

[0051] Example 2. Verification of SNP molecular markers related to African swine fever virus antibody levels

[0052] To establish the relationship between the PRRX2 gene and the trait of African swine fever virus antibody levels in pigs, the blocking ELISA method was used to measure the African swine fever virus p72 antibody levels in the 206 pig sera in Example 1. The results were expressed as the S / N value (sample OD 450nm value / negative control OD450nm average value). The larger the S / N value, the lower the antibody level, and vice versa. The results showed that 150 pig serum samples had higher antibody levels (S / N ≤ 0.5, positive), 6 pig serum samples had lower antibody levels (S / N ≥ 0.6, negative), and the S / N values of 50 pig serum samples were between 0.5 and 0.6.

[0053] The ANOVA program in R 4.1 software was used to perform a correlation analysis on the SNP locus of the PRRX2 gene and the data of African swine fever virus antibody level traits for each individual. The results were as Figure 3 shown. The S / N value of African swine fever antibodies in 160 serum samples with the TT genotype by sequencing was 0.46 ± 0.05, the S / N value of 43 serum samples with the TC genotype by sequencing was 0.51 ± 0.06, and the S / N value of 3 serum samples with the CC genotype by sequencing was 0.73 ± 0.15. There was a significant difference in the African swine fever virus antibody levels in serum of TT > TC > CC, p < 0.05. This was basically consistent with the results measured by the blocking ELISA method, proving that the SNP molecular marker screened in Example 1 of the present invention can be used to detect African swine fever virus antibody levels.

[0054] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity in description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope recorded in this specification.

[0055] The above-described embodiments merely represent several implementation manners of the present invention. The description thereof is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. SNP molecular markers associated with African swine fever virus antibody levels, characterized in that, The locus of the SNP molecular marker is located at the 143bp of the 3rd exon of the porcine PRRX2 gene with the gene version number XM_005654574.2, having T / C polymorphism. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.

3.

2. A primer set for amplifying the SNP molecular marker associated with the African swine fever virus antibody level described in claim 1, characterized in that, The nucleotide sequence of the upstream primer of the primer set is as shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.

2.

3. A kit for detecting the genotype of SNP molecular markers associated with the antibody level of African swine fever virus, characterized in that, The kit contains the primer set described in claim 2.

4. The kit according to claim 3, wherein The kit further includes DNA extraction reagent, DNA purification reagent, PCR reaction reagent, agarose solution, electrophoresis buffer, staining solution.

5. Use of the SNP molecular marker associated with the African swine fever virus antibody level described in claim 1, the primer set described in claim 2, or the kit described in claim 3 in swine breeding.

6. The application according to claim 5, characterized in that Comprising the following steps: Performing PCR amplification on the DNA template of pigs using the primer set described in claim 2 to obtain a PCR product; Performing agarose gel electrophoresis and sequencing on the PCR product; Detecting that the African swine fever virus antibody level of the pig breed with the TT genotype of the T / C polymorphism at the 143bp of the 3rd exon of the porcine PRRX2 gene is higher than that of the pig breed with the TC or CC genotype.

7. The application according to claim 6, wherein The reaction system for PCR amplification is: 2×TaqMasterMix 10μL, DNA template 1.0μL, upstream primer 0.3μL, downstream primer 0.3μL, ddH2O 8.4μL.

8. The application according to claim 6, characterized in that, The reaction program for PCR amplification is: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 25 s, annealing at 61°C for 18 s, extension at 72°C for 15 s, 39 cycles; extension at 72°C for 5 min, storage at 10°C.

Images