Recombinant fusion protein and application thereof in preparation of anti-gastric cancer angiogenesis medicine

Abstract

The invention discloses a recombinant fusion protein and application thereof in preparation of anti-gastric cancer angiogenesis medicines, and relates to the technical field of biological medicines. The amino acid sequence of the recombinant fusion protein is as shown in SEQ ID NO. 1. According to the invention, the amino acid sequence of the gastric cancer vascular targeting peptide CNTGSPYEC and the potent vascular inhibitor Endostatin gene are recombined to construct the recombinant fusion protein, and the selective distribution capability of the targeting peptide is utilized to carry the anti-vascular drug Endostatin to be more specifically enriched in gastric cancer vascular endothelial cells, so that the anti-vascular effect and the anti-tumor effect are improved, and the tumor resistance of the gastric cancer vascular targeting peptide CNTGSPYEC is improved. Meanwhile, due to the fact that distribution of Endostatin in normal blood vessels and tissues is reduced, corresponding toxic and side effects can be reduced, and great significance is achieved for improving the current situation of gastric cancer anti-blood-vessel treatment.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to a recombinant fusion protein and its application in the preparation of anti-gastric cancer angiogenesis drugs. Background Art

[0002] The growth and metastasis of tumors require the participation of new blood vessels. This concept was proposed by Professor Folkman in the United States in 1971 and has now been widely accepted and increasingly emphasized. Correspondingly, tumor vascular targeting therapy has become a new hot spot in the field of anti-tumor research. Currently, there are already a variety of tumor vascular targeting drugs, including Bevacizumab, Endostatin, Sorafenib, Sunitinib, interferon, etc., used in the first- and second-line clinical treatments of various tumors such as colon cancer, lung cancer, breast cancer, liver cancer, and kidney cancer. However, the current situation of anti-angiogenic therapy in gastric cancer is not ideal. Classic drugs such as Bevacizumab, Sorafenib, and Sunitinib have not shown clinical benefits and have caused side effects such as leukopenia and thrombocytopenia; although the new anti-VEGFR-2 has been proven effective in phase III clinical trials, the extension of the overall survival (OS) and progression-free survival (PFS) of patients is only about 2 months. Ramucirumab and the EGFR-TKI apatinib both have side effects such as hypertension, proteinuria, hand-foot syndrome, and hematological toxicity, resulting in dose reduction or even discontinuation of the drugs. Currently, all tumor vascular targeting drugs have the problem of low specificity, resulting in toxic and side effects on normal blood vessels while inhibiting tumor angiogenesis, seriously affecting the clinical application of such drugs. To overcome the above problems, it is necessary to improve the targeting of vascular inhibitory drugs and achieve "precision guidance". Therefore, the development of highly selective targeting drugs for tumor blood vessels is of great significance for improving the safety, efficacy of tumor vascular targeting therapy, and reducing toxic and side effects. Summary of the Invention

[0003] The purpose of the present invention is to provide a recombinant fusion protein and its application in the preparation of anti-gastric cancer angiogenesis drugs to solve the problems existing in the above-mentioned prior art. This recombinant fusion protein can effectively target gastric cancer vascular endothelial cells and has good anti-angiogenic effects and anti-tumor effects.

[0004] To achieve the above purpose, the present invention provides the following solutions:

[0005] The present invention provides a recombinant fusion protein with a targeting anti-gastric cancer angiogenesis effect, and its amino acid sequence is as shown in SEQ ID NO.1.

[0006] The present invention also provides a coding gene for the above recombinant fusion protein.

[0007] Furthermore, the nucleotide sequence of the coding gene is as shown in SEQ ID NO.2.

[0008] The present invention also provides a recombinant plasmid, comprising the above-mentioned coding gene.

[0009] The present invention also provides a recombinant host cell, comprising the above-mentioned recombinant plasmid.

[0010] The present invention also provides the use of the above-mentioned coding gene, recombinant plasmid or recombinant host cell in the preparation of the above-mentioned recombinant fusion protein.

[0011] The present invention also provides a method for preparing the above-mentioned recombinant fusion protein, comprising the steps of fermenting and culturing the above-mentioned recombinant host cell, and separating and purifying to obtain the recombinant fusion protein.

[0012] The present invention also provides the use of the above-mentioned recombinant fusion protein in the preparation of an anti-gastric cancer angiogenesis drug.

[0013] The present invention also provides an anti-gastric cancer angiogenesis drug, the active ingredient of which comprises the above-mentioned recombinant fusion protein.

[0014] Further, the anti-gastric cancer angiogenesis drug further comprises a pharmaceutically acceptable excipient.

[0015] The present invention discloses the following technical effects:

[0016] The present invention recombines the amino acid sequence of the gastric cancer vascular targeting peptide CNTGSPYEC with the potent angiogenesis inhibitor Endostatin gene to construct a recombinant fusion protein. By utilizing the selective distribution ability of the targeting peptide, it can carry the anti-angiogenic drug Endostatin to specifically enrich in gastric cancer vascular endothelial cells, thereby enhancing the anti-angiogenic effect and anti-tumor effect. At the same time, since the distribution of Endostatin in normal blood vessels and tissues is reduced, the corresponding toxic and side effects can be reduced, which is of great significance for improving the current situation of anti-angiogenic therapy for gastric cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0018] Figure 1 It is the SDS-PAGE electrophoresis detection result of recombinant fusion protein 1; wherein, M1: protein Marker (Bio-Rad); R: reducing condition; NR: non-reducing condition;

[0019] Figure 2The Western blot detection results of recombinant fusion protein 1; among them, M2: protein Marker (GenScript); P: Multi-tag multi-epitope tag protein; R: reducing condition; NR: non-reducing condition;

[0020] Figure 3 The purity detection results of recombinant fusion protein 1;

[0021] Figure 4 The in vitro immunofluorescence analysis results of the targeting peptide; among them, A is the fluorescence staining map of Co-HUVEC cells; B is the fluorescence staining map of HUVEC cells; the scale bar is 50μm for both; Control peptide represents the control peptide, and Targetingpeptide represents the targeting peptide;

[0022] Figure 5 The in vitro immunofluorescence analysis results of the recombinant fusion protein; among them, A is the fluorescence staining map of recombinant fusion protein 1; B is the fluorescence staining map of recombinant fusion protein 2;

[0023] Figure 6 The statistical chart of the viability of HUVEC cells treated with PBS, control peptide, and targeting peptide; Control peptide represents the control peptide, and Targetingpeptide represents the targeting peptide;

[0024] Figure 7 The statistical chart of the viability of Co-HUVEC cells treated with PBS, control peptide, and targeting peptide; Control peptide represents the control peptide, and Targetingpeptide represents the targeting peptide;

[0025] Figure 8 The statistical chart of the inhibition rate of the targeting peptide on HUVEC and Co-HUVEC at different concentrations;

[0026] Figure 9 The statistical chart of the viability of HUVEC cells treated with Endostatin and recombinant fusion protein; rh-Endo represents Endostatin; peptide-Endo represents recombinant fusion protein;

[0027] Figure 10 The statistical chart of the viability of Co-HUVEC cells treated with Endostatin and recombinant fusion protein; rh-Endo represents Endostatin; peptide-Endo represents recombinant fusion protein;

[0028] Figure 11Observation diagrams of the formation of tubular structures by cells treated with PBS, control peptide, and targeting peptide in Matrigel; Control peptide represents the control peptide, and Targeting peptide represents the targeting peptide; The scale bars are all 200 μm;

[0029] Figure 12 Statistical graphs of the number of junctions under the treatment of PBS, control peptide, and targeting peptide; Control peptide represents the control peptide, and Targeting peptide represents the targeting peptide;

[0030] Figure 13 Observation diagrams (A) of the formation of tubular structures by cells treated with control peptide, targeting peptide, recombinant fusion protein, and Endostatin in Matrigel and statistical graphs (B) of the number of junctions; Among them, in A, peptide represents the targeting peptide, rh-Endo represents Endostatin; peptide-Endo represents the recombinant fusion protein; in B, pep represents the targeting peptide, es represents Endostatin; p-es represents the recombinant fusion protein;

[0031] Figure 14 Result diagrams of transwell experiments and cell scratch experiments; Among them, A and B are the result diagrams of transwell experiments of HUVEC and Co-HUVEC respectively; C and D are the result diagrams of cell scratch experiments of HUVEC and Co-HUVEC respectively; Endo represents Endostatin; peptide-Endo represents the recombinant fusion protein; The scale bars in C and D are both 200 μm;

[0032] Figure 15 Result diagrams of in vivo targeting identification experiments; The scale bars are all 100 μm;

[0033] Figure 16 Result diagrams of in vivo targeting identification of Cy5 and Cy5-labeled targeting peptides; Among them, A is the fluorescence detection diagram; B is the statistical graph of fluorescence intensity at different times; C is the fluorescence tissue distribution diagram; D is the statistical graph of fluorescence intensity in each tissue;

[0034] Figure 17 Result diagrams of in vivo targeting identification of Cy5 and Cy5-labeled recombinant fusion proteins; Among them, A is the fluorescence detection diagram; B is the statistical graph of fluorescence intensity at different times; C is the fluorescence tissue distribution diagram; D is the statistical graph of fluorescence intensity in each tissue; Cy5-peptide-Endo represents Cy5-labeled recombinant fusion protein;

[0035] Figure 18It is a result graph of the cytotoxicity detection experiment; among them, Endo293T represents the experimental group with Endostatin added to 293T cells; peptide-Endo293T represents the experimental group with peptide-Endo added to 293T cells; EndoL929 represents the experimental group with Endostatin added to L929 cells; peptide-EndoL929 represents the experimental group with peptide-Endo added to L929 cells;

[0036] Figure 19 It is a statistical graph of the tumor volumes of tumor-bearing nude mice in different treatment groups; among them, peptide represents the targeting peptide; Endo represents Endostatin; peptide-Endo represents the recombinant fusion protein;

[0037] Figure 20 It is the CD31 staining graph (A) and the microvessel density statistical graph (B) of tumor tissues in different treatment groups. Detailed implementation manners

[0038] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation to the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0039] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0040] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0041] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the specification of the present invention, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are only exemplary.

[0042] Terms such as "comprising", "including", "having", "containing", etc. used in this text are all open-ended terms, meaning including but not limited to.

[0043] Example 1

[0044] Construction of recombinant fusion protein:

[0045] The gastric cancer vascular targeting peptide was fused to the amino terminus of Endostatin by genetic recombination to construct a transient protein expression vector for pep-Endostatin in mammalian cells (PTT5 plasmid vector, purchased from Nanjing Genscript Biotech Corporation), expressed in CHO cells, and labeled with a His-tag at the terminus.

[0046] 1. Design of recombinant fusion protein

[0047] Design sequence: The amino acid sequence of the targeting peptide is CNTGSPYEC, and the cloning sites of the recombinant plasmid PTT5-Endostatin are EcoRI / HindIII. The following are the cloning strategy and sequence:

[0048] Recombinant fusion protein 1: EcoRI-Kozak seguence-Artificial signal peptide-Targeting peptide-GS Linker-Endostatin-His6tag-stop codon-HindIII; its amino acid sequence is shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.2.

[0049] SEQ ID NO.1:

[0050]

[0051] SEQ ID NO.2:

[0052] ATGGGCTGGTCCTGTATTATCCTGTTCCTGGTCGCCACAGCCACCGGAGTGCACTCTTGTAATACCGGATCTCCTTACGAGTGCGGCGGAGGTGGCTCTGGAGGCGGTGGATCTGGTGGTGGCGGATCAGCTCACAGCCACCGGGACTTCCAACCAGTGCTGCACCTGGTGGCCCTGAACAGCCCCCTGAGCGGCGGAATGCGGGGCATCAGAGGCGCTGATTTCCAGTGCTTCCAGCAGGCCAGAGCCGTGGGTCTGGCCGGCACCTTCAGAGCCTTCCTGTCTAGCAGACTGCAGGACCTGTACAGCATCGTTAGACGGGCCGATAGAGCTGCTGTGCCTATCGTGAACCTGAAAGACGAGCTGCTCTTTCCATCTTGGGAAGCCCTGTTCAGCGGCAGTGAAGGCCCTCTGAAGCCCGGCGCCAGAATCTTCAGCTTCGACGGCAAGGACGTGCTGAGACACCCTACATGGCCCCAGAAGAGCGTGTGGCACGGCTCCGATCCTAACGGCCGGAGGCTTACAGAAAGCTACTGCGAGACATGGCGCACCGAGGCCCCTAGCGCCACCGGCCAGGCTAGCAGCCTGCTGGGAGGCAGACTGCTGGGCCAGAGCGCCGCCAGCTGCCACCACGCCTATATCGTGCTGTGCATCGAGAACAGCTTTATGACCGCCTCCAAGCACCACCACCACCATCATTGA. Recombinant fusion protein 2: EcoRI - Kozak seguence - Artificial signal peptide - Targeting peptide - EAAAK Linker - Endostatin - His6 tag - Stop codon - HindIII; its amino acid sequence is shown in SEQ ID NO.3, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.4.

[0053] SEQ ID NO.3:

[0054]

[0055] SEQ ID NO.4:

[0056] ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCCACCGCCACCGGCGTGCATAGCTGTAATACCGGATCTCCATACGAGTGCGAGGCCGCCGCTAAGGAAGCTGCCGCTAAAGAAGCCGCCGCCAAGGCCCACAGCCACCGGGACTTCCAGCCTGTGCTGCACCTGGTCGCCCTGAACAGCCCACTGTCTGGCGGCATGAGGGGCATCCGGGGAGCCGATTTCCAATGTTTTCAGCAGGCTAGAGCCGTGGGCCTGGCCGGCACCTTCAGAGCCTTCCTGTCCAGCAGACTGCAGGACCTGTACAGCATCGTTAGACGGGCCGACAGAGCCGCCGTGCCCATCGTGAACCTGAAGGATGAGCTGCTGTTCCCCAGCTGGGAAGCCCTGTTCTCCGGCAGCGAGGGCCCTCTGAAGCCCGGCGCCAGAATCTTCAGCTTCGACGGCAAGGACGTGCTGAGACACCCTACATGGCCTCAGAAAAGCGTGTGGCACGGCTCTGATCCTAACGGCCGCAGACTCACCGAGAGCTACTGCGAAACCTGGCGGACAGAGGCCCCTAGCGCCACAGGACAGGCCAGCAGCCTGCTGGGAGGCAGACTGCTGGGCCAGAGCGCCGCTTCTTGCCACCACGCTTATATCGTGCTCTGCATTGAGAACTCCTTCATGACCGCATCTAAGCACCATCACCACCACCACTGA.

[0057] 2. Preparation of recombinant fusion protein

[0058] Two recombinant fusion proteins were prepared according to the following method:

[0059] (1) Construction of recombinant plasmid

[0060] ① Restriction enzyme digestion reaction: Pour melted 0.8% agarose into a small plate groove. After the gel solidifies, add 0.5×TBE electrophoresis buffer. Add a mixture of digested DNA and loading solution (containing sucrose, bromophenol blue, and EDTA) to the sample wells, connect the power supply, and perform electrophoresis at a voltage of 50 - 75V.

[0061] ② Preparation of competent Escherichia coli bacteria: Inoculate a single colony into LB medium without Ap and shake overnight at 37°C. The next day, transfer 2% of the culture to a pre-warmed LB culture flask and continue shaking for 2 - 3 h until the OD 600 is about 0.4. Stop culturing, centrifuge at 4°C, collect the bacteria in a new centrifuge tube, suspend with cold 100 mM CaCl2, incubate on ice for 40 min, centrifuge at 4°C for 5 min at 5000 rpm, pour off the supernatant, add 1 / 15 volume of cold CaCl2, continue incubating on ice for 40 min, add pure glycerol to a final volume concentration of 30%, aliquot into EP tubes, and store at -70°C in the refrigerator for long-term use.

[0062] ③ Ligation of DNA: The enzyme-digested products were separated by 1.5% agarose gel electrophoresis and recovered. Ligate to the PTT5 vector, and identify by double digestion with HindIII. At the same time, cut out a fragment of about 702 bp from the clone with the inserted fragment and recover for later use. Denature the synthesized nucleic acid fragment encoding the targeting peptide at 65°C for 5 min, anneal, and ligate with the above fragment and the PTT5 plasmid treated with EcoRI. The ligation product was transformed into competent Escherichia coli cells, and the recombinant plasmid was obtained by enzyme digestion identification and DNA sequencing.

[0063] (2) Cell culture and transient transfection of CHO-Expression:

[0064] ① CHO-Expression cells (purchased from Procell) were grown in serum-free expression medium. The cells were maintained in Erlenmeyer flasks on a shaker at 37°C and 5% carbon dioxide.

[0065] ② On the day of transfection, heat the expression medium to 25°C - 37°C. Add an inhibitor of 50 μM α-mannosidase II to the medium 1 h before transfection.

[0066] ③ Add the recombinant plasmid and PEI transfection reagent to the transfection buffer, mix well, and incubate at room temperature.

[0067] ④ Add the DNA / reagent mixture to the cells and return the culture to the incubator

[0068] ⑤ Add pre-warmed culture medium to the cell culture.

[0069] ⑥ The cell culture supernatant collected on the 7th day was used for purification.

[0070] (3) Purification and analysis:

[0071] ① Centrifuge the cell culture medium.

[0072] ② Add the cell culture supernatant to the HisTrap TM FF stock solution.

[0073] ③ After washing and eluting with the buffer, collect the eluted fractions and change the buffer to the final formulation buffer.

[0074] Binding buffer: 25 mM chloroform, 300 mM sodium chloride, pH 8.0.

[0075] Elution buffer: 25 mM Tris, 300 mM NaCl, 1 M imidazole, pH 8.0.

[0076] Final buffer: PBS, pH 7.2.

[0077] ④ Analyze the purified protein by SDS-PAGE and SEC-HPLC (column: TSKgel G3000sWxl) to determine its molecular weight and purity.

[0078] ⑤ Use A 280 to measure the concentration.

[0079] (4) SDS-PAGE electrophoresis and Western blot detection of recombinant protein

[0080] Take 1 mL of induced or uninduced bacterial solution, centrifuge to obtain the precipitate, add 15 μL of H2O and 15 μL of 2× loading buffer (5% 8-mercaptoethanol, 4% SDS, 0.025% bromophenol blue), mix well, boil in boiling water for 5 min, centrifuge at 12000 rpm for 2 min, and then take 5 μL of the supernatant for loading. Prepare a 12% separating gel and a stacking gel, and use Laemmli discontinuous PAGE. Then add 1× running buffer to the electrophoresis tank. After adding the sample, start electrophoresis at a voltage of 120 V. When the sample reaches the separating gel, adjust the voltage to 160 V until the bromophenol blue runs out of the gel. Stain the gel with Coomassie Brilliant Blue R-250 staining solution for more than 2 h. Decolorize overnight with the decolorizing solution (70 mL of glacial acetic acid, 200 mL of ethanol, diluted to 1000 mL with distilled water).

[0081] Transfer the sample protein to a nitrocellulose membrane by electrotransfer method. Use mouse anti-human Endostatin monoclonal antibody as the primary antibody and enzyme-labeled rabbit anti-mouse IgG as the secondary antibody for Western blot analysis.

[0082] The identification results show that the molecular weights of the two recombinant fusion proteins are as expected, and the purity of both reaches 98%. The identification results of recombinant fusion protein 1 are shown in Figures 1 - 3 , showing that the molecular weight of the recombinant fusion protein is between 18 - 32 KDa and the purity is 98%.

[0083] 3. Identification of the targeting property of gastric cancer vascular targeting peptide

[0084] Plate HUVECs or Co-HUVECs at an appropriate density on coverslips in a 24-well plate. Incubate the coverslips with normal goat serum for 30 minutes. Wash the slides three times in PBS (pH = 7.2) for 5 minutes each time. Incubate the two synthesized recombinant fusion proteins at a concentration of 100 μg / mL with the coverslips at room temperature for 1 h. Co-localize the control peptide (CNKSPSGNC), the targeting peptide (CNTGSPYEC), the recombinant fusion proteins with the endothelial marker CD31 to identify their binding ability. After washing away the recombinant fusion proteins, stain the coverslips with anti-CD31 antibody, and then stain the coverslips with fitc-conjugated anti-mouse IgG, anti-recombinant fusion protein His-tag fluorescent secondary antibody, and targeting peptide fluorescent secondary antibody. After washing three times with PBS (pH = 7.2), observe the cell coverslips under a fluorescence microscope (Nikon EZ-C1, Nikon, Tokyo, Japan).

[0085] In vitro immunofluorescence analysis of the targeting peptide showed that all cells were stained green with CD31, a biomarker of endothelial cells. In addition, all cell nuclei were stained blue. In the Co-HUVEC group, the peptide CNTGSPYEC that bound to Co-HUVECs showed red positive staining and co-localized with CD31 on the cell surface and perinuclear cytoplasm. In contrast, if stained with the control peptide or PBS instead of the targeting peptide CNTGSPYEC, Co-HUVEC also gave negative results ( Figure 4 in A). In the case of the HUVEC group, the situation observed was different. No light red positive staining was observed on control HUVECs regardless of whether the control peptide or the targeting peptide CNTGSPYEC was used for staining ( Figure 4 in B). These results indicate that the targeting peptide can only bind to tumor vascular endothelial cells and cannot non-specifically bind to normal vascular endothelial cells.

[0086] In vitro immunofluorescence analysis of the recombinant fusion proteins ( Figure 5 ) showed that when using recombinant fusion protein 2, all cells were stained green with CD31, and in addition, all cell nuclei were stained blue. Almost no red fluorescence of this recombinant fusion protein was seen either in normal vascular endothelial cells or in gastric cancer vascular endothelial cells ( Figure 5 in B); when using recombinant fusion protein 1, weak red fluorescence was visible in normal vascular endothelial cells, but stronger red fluorescence was visible in co-cultured gastric cancer vascular endothelial cells, and the position was consistent with the green fluorescence of CD31 ( Figure 5 in A). The results suggest that recombinant fusion protein 1 can specifically bind to Co-HUVEC and has gastric cancer vascular targeting, while the targeting ability of recombinant fusion protein 2 is insufficient.

[0087] The present invention speculates that the function of the targeting peptide may be easily affected by the steric hindrance of the recombinant fusion protein. Specifically, different Linkers will have a significant impact on the spatial conformation of the fusion protein and its interaction with the target molecule. For recombinant fusion protein 2, there may be a large steric hindrance effect, which has an adverse effect on the targeting function of the targeting peptide. Based on the above considerations, in subsequent studies, the present invention selected recombinant fusion protein 1 (named peptide-Endo) for further experimental verification.

[0088] Example 2

[0089] 1. Establishment of cell culture and co-culture model of tumor endothelial cells

[0090] Human gastric cancer cells (MKN45), human umbilical vein endothelial cells (HUVEC), and human microvascular endothelial cells (HMVEC) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in M200 basal medium (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS), low serum growth supplement (Cascade Biologics, USA), 100 U / mL penicillin, and 10 mg / mL streptomycin. The cells were stored in a CO2 incubator (Forma Scientific).

[0091] MKN45 and HUVEC cells were co-cultured in a transwell plate with a pore size of 0.4 μm. The two cells were separated by the semi-permeable membrane of the transwell plate, and the upper and lower chambers were interconnected. Therefore, HUVEC and MKN45 cells could interact through secreted soluble factors to simulate the tumor microenvironment and establish an in vitro culture model of gastric cancer vascular endothelial cells (Co-HUVEC).

[0092] 2. Cell proliferation assay

[0093] Cell proliferation was measured by the CCK8 method. 5×10 3 cells / well of HUVEC and Co-HUVEC in the logarithmic growth phase were seeded into 96-well plates. There were 5 parallel replicates in each group. After 8 hours, different concentrations of PBS, control peptide (CNKSPSGNC), targeting peptide (CNTGSPYEC), Endostatin, and recombinant fusion protein peptide-Endo were added and incubated for 24 hours. Then, 10 μL of CCK8 solution was added to each well. After incubation for 2 hours, the absorbance was measured at 450 nm using a microplate reader (Infinite M Nano, TECAN).

[0094] The results of the CCK8 assay are shown in Figures 5 - 9 .

[0095] The targeting peptide can reproducibly inhibit the proliferation of Co-HUVEC in a dose-dependent manner. The difference in relative cell numbers between cells treated with the targeting peptide and those treated with the control peptide was not significant for HUVEC( Figure 6 ), while it was significant for Co-HUVEC at concentrations of 10, 25, 50, 75, and 100 μM (P<0.01)( Figure 7 ). In addition, the inhibitory effect induced by the targeting peptide in Co-HUVEC was more obvious than that in HUVEC, and the inhibition rate increased to 61.7%( Figure 8 ).

[0096] The recombinant fusion protein can selectively inhibit the proliferation of Co-HUVEC, a gastric cancer vascular endothelial cell. At concentrations of 12.5 - 200 μg / mL, the inhibition rate increased with increasing concentration (P<0.05), while no obvious inhibitory effect on the proliferation of normal vascular endothelial cell HUVEC was observed. As Figure 9 shown, both Endostatin and the recombinant fusion protein had a certain degree of inhibition on normal vascular endothelial cells, but the difference between them was not significant. In the Co-HUVEC group of gastric cancer vascular endothelial cells, compared with Endostatin, the inhibitory effect of the recombinant fusion protein on gastric cancer vascular endothelial cells was dose-dependent and much higher than the 15% inhibition rate of Endostatin on Co-HUVEC. In addition, compared with HUVEC, the inhibitory effect of the recombinant fusion protein on the proliferation of Co-HUVEC was more significant, and the highest inhibition rate was 35%( Figure 10 ).

[0097] 3. Endothelial cell tube formation assay:

[0098] One day in advance, Matrigel stored at -20℃ was placed at 4℃ to dissolve. An ice box was prepared, and a 96-well plate was pre-cooled. The experiment was repeated 3 times. Matrigel was diluted to 2.5 mg / mL with serum-free culture medium and used to coat the 96-well plate (the whole process was carried out on ice), 50 μL / well, and incubated at 37℃ for 30 min for natural solidification. Co-HUVEC in the logarithmic growth phase was harvested and adjusted to a density of 5×10 4 cells / mL. The cells were seeded into the coated 96-well plate, 100 μL per well (about 5000 cells), and cultured at 37℃ overnight. After the cells adhered, 20 μM targeting peptide (CNTGSPYEC), control peptide, recombinant fusion protein peptide-Endo, Endostatin, or PBS were added respectively, and the cells were cultured for another 48 h. The formation of tubular structures of cells in Matrigel was observed under an inverted microscope.

[0099] As Figures 11 - 12As shown, both untreated HUVEC and Co-HUVEC began to aggregate, became bundled, and formed distinct long tubular structures on the Matrigel matrix. The addition of the control peptide and the targeting peptide had no significant effect on the tube formation of HUVEC. However, in the Co-HUVEC group, the control peptide showed little anti-angiogenic effect, where the cells formed disconnected tube-like structures but had a tendency to connect; in contrast, the group containing the targeting peptide showed a significant anti-angiogenic effect, with little formation of the cell network visible. The targeting peptide could inhibit the formation of microtubules, and the microvessel count decreased by 40%, suggesting that the targeting peptide has the ability to inhibit cancer angiogenesis.

[0100] As Figure 13 shown, in the normal vascular endothelial group, the addition of Endostatin or recombinant fusion protein treatment could significantly inhibit the formation of tubules by vascular endothelial cells, but there was no significant difference between the two. In the gastric cancer vascular endothelial group, the addition of Endostatin or recombinant protein treatment could significantly inhibit the formation of tubules by gastric cancer vascular endothelial cells, and the inhibitory ability of the recombinant protein group on the formation of tubules by gastric cancer vascular endothelial cells was more prominent, suggesting that the targeting peptide could enhance the ability of Endostatin to inhibit gastric cancer angiogenesis.

[0101] In addition, the results of transwell experiments and cell scratch experiments showed that compared with the control group, both Endostatin treatment and recombinant fusion protein treatment could significantly inhibit the migration of normal vascular endothelial cells HUVEC, but there was no significant difference between the two. In the gastric cancer vascular endothelial cell Co-HUVEC group, the addition of Endostatin or recombinant fusion protein treatment could significantly inhibit the migration of gastric cancer vascular endothelial cells, and the inhibitory ability of the recombinant fusion protein group on the migration of gastric cancer vascular endothelial cells was more prominent ( Figure 14 ).

[0102] 4. Cytotoxicity detection experiment

[0103] The activities of Endostatin and recombinant fusion protein peptide-Endo were measured in L929 and 293T cells. Briefly, 2×10 4 cells / well were seeded in 96-well plates containing 100 μL of growth medium. After 24 hours, the cells were treated with 100 μL of different concentrations of FBS-free 1640, Edostatin, and peptide-Endo, respectively. Next, the cells were cultured for another 24 hours. Finally, the cell viability was measured using the CCK8 method, and the results are shown in Figure 18 . The results showed that the recombinant protein had no significant effect on the cell viability of these cell lines even at high concentrations.

[0104] 5. In vivo targeting identification

[0105] In in vivo experiments, under general anesthesia, PBS, Cy3-labeled targeting peptide, Cy3-labeled control peptide, Cy3-labeled recombinant fusion protein or Endostatin (100 μL) was administered via the tail vein to tumor-bearing mice (n = 3). Three hours after administration, the mice were fixed by myocardial perfusion with 4% paraformaldehyde, and gastric cancer tissues and normal gastric tissues were isolated. Sections of gastric cancer and normal gastric tissues were incubated with CD31 overnight at 4°C. After washing off the primary antibody, the sections were incubated with FITC-conjugated anti-mouse IgG. The sections were observed under a fluorescence microscope (Nikon EZ-C1, Nikon, Tokyo, Japan).

[0106] Results of in vivo immunofluorescence analysis ( Figure 15 ) showed that the biomarker of endothelial cells, CD31 (green), could be shown in the vascular systems of normal gastric tissues and cancers, and DAPI (blue) could be shown at the nuclear position. At the same time, it was found that the recombinant protein (red) was only stained in the vasculature of gastric cancer tissues, and it co-localized with CD31, indicating that the peptide targeted the vascular system of cancers. However, in control organs including the heart, liver, spleen, lungs, kidneys and normal gastric tissues, no Cy3-labeled targeting peptide was observed, and no similar co-localization phenomenon was observed in these merged images. The results indicated that the recombinant protein was selectively enriched in gastric cancer blood vessels.

[0107] 6. Biological distribution of targeting peptide and recombinant fusion protein in tumor-bearing nude mice

[0108] Female nude mice aged 4 - 6 weeks with a body weight of 18 - 22 g and bearing tumors of 100 - 300 mm 3 were divided into 2 groups (n = 3), and Cy5, Cy5-labeled targeting peptide or Cy5-labeled recombinant fusion protein (0.5 mg / kg) was injected via the tail vein, respectively. A live imaging system (Spectral Instruments imaging Ami HTX, USA) (Ex = 640 nm, Em = 670 nm) was used to obtain the fluorescence signals of the mice at 1, 3, 6, 12 and 24 h after injection. The nude mice were sacrificed 24 h after the probe injection, and the hearts, livers, spleens, lungs, kidneys and tumors of the nude mice were collected using Aura Imaging 4.0 software (Spectral Instruments Imaging, LLC, USA) for semi-quantitative analysis.

[0109] The experimental results are shown in Figures 16 - 17 .

[0110] As Figure 16 shown in A, taking the mice injected with Cy5 as the control, stronger fluorescence signals were observed in the tumor tissues of the mice injected with Cy5-CNTGSPYEC. The fluorescence signal reached the peak at 3 hours after injection (Figure 16 In B), the in vitro tissue distribution of Cy5-CNTGSPYEC was examined 24 hours after injection ( Figure 16 In C), as Figure 16 shown in D), a large amount of retention of Cy5-CNTGSPYEC was detected in the tumor xenografts, with a small amount of fluorescence signal in the lungs, kidneys, and liver, and very little in other tissues. Except for the lower accumulation in tumor tissues, there was no significant difference in the in vitro distribution of Cy5 in the major organs.

[0111] As Figure 17 shown in A), using the mice injected with Cy5 as a control, in the peptide-Endo treatment group, the fluorescence intensity in the tumor tissues was higher than that in other organs, indicating good tumor targeting ability. The fluorescence signal reached the peak 6 hours after injection ( Figure 17 In B). The in vitro tissue distribution of the Cy5-labeled recombinant fusion protein was examined 24 hours after injection ( Figure 17 In C). As Figure 17 shown in D), a large amount of retention of the Cy5-labeled recombinant fusion protein was detected in the tumor xenografts, with a small amount of fluorescence signal in the lungs and kidneys, and very little in other tissues. Except for the lower accumulation in tumor tissues, there was no significant difference in the in vitro distribution of Cy5 in the major organs.

[0112] 7. Tumor growth inhibition experiment in nude mice and detection of blood routine, liver and kidney functions, myocardial enzyme spectrum, etc.:

[0113] Thirty-five tumor-bearing nude mice were randomly divided into 4 groups, with 5 mice in each group. The gastric cancer cells were diluted to the required number of cells for the experiment (0.1 mL cell suspension, i.e., 1×10 6 cells), and inoculated subcutaneously into the back of the nude mice. The recombinant fusion protein group was given peptide-Endo by tail vein injection at a dose of 5 mg / kg, the targeting peptide group was given peptide by tail vein injection at a dose of 5 mg / kg, the negative control group was given endostatin by tail vein injection at a dose of 5 mg / kg, and the blank control group was given an equal volume of normal saline by tail vein injection, once a day for a total of 2 weeks. After cell transplantation, the tumor volume could be calculated after a fixed mass formed at the inoculation site. Each group of nude mice was measured once a week, and the long diameter L and short diameter D of the tumor mass were measured with vernier calipers. The tumor volume was calculated according to the formula: V = L×D 2 / 2. The nude mice were killed 24 h after the last dose, the tumor bodies were taken, the volume and weight were measured, and the microvessel density of the tumor tissues was determined by CD31 staining.

[0114] The statistical charts of the tumor volumes of each group of tumor-bearing nude mice are shown in Figure 19 , and the detection results of the microvessel density of the tumor tissues are shown in Figure 20 . The results showed that the recombinant fusion protein could effectively slow down the growth of tumors.

[0115] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the spirit of the present invention's design, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A recombinant fusion protein with targeted anti-gastric cancer angiogenesis effect, characterized in that, The amino acid sequence is as shown in SEQ ID NO.

1.

2. The coding gene of a recombinant fusion protein as claimed in claim 1.

3. The coding gene according to claim 2, characterized in that, The nucleotide sequence of the coding gene is as shown in SEQ ID NO.

2.

4. A recombinant plasmid, characterized in that, Comprising the coding gene as claimed in claim 2 or 3.

5. A recombinant host cell, characterized in that, Comprising the recombinant plasmid as claimed in claim 4.

6. Use of the coding gene as claimed in claim 2 or 3, the recombinant plasmid as claimed in claim 4 or the recombinant host cell as claimed in claim 5 in the preparation of the recombinant fusion protein as claimed in claim 1.

7. A method for preparing a recombinant fusion protein as described in claim 1, characterized in that, Comprising the step of separating and purifying the recombinant fusion protein after fermentation culture of the recombinant host cell as claimed in claim 5.

8. Use of the recombinant fusion protein as claimed in claim 1 in the preparation of an anti-gastric cancer angiogenesis drug.

9. An anti-gastric cancer angiogenesis drug, characterized in that, The active ingredient comprises the recombinant fusion protein as claimed in claim 1.

10. The anti-gastric cancer angiogenesis drug according to claim 9, wherein The anti-gastric cancer angiogenesis drug further comprises a pharmaceutically acceptable excipient.

Images