Recombinant silk fibroin fusion protein as well as preparation method and application thereof

Abstract

The invention discloses a recombinant silk fibroin fusion protein as well as a preparation method and application thereof. The amino acid sequence of the recombinant silk fibroin is as shown in SEQ ID NO: 3. According to the invention, the silk fibroin is efficiently expressed through a genetic engineering method, and the recombinant silk fibroin or the recombinant silk fibroin which is high in expression and purity and can retain the efficacy and the activity of natural protein is finally obtained, so that the recombinant silk fibroin or the recombinant silk fibroin has relatively high industrial application potential.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a recombinant silk fibroin fusion protein, a preparation method and an application thereof, such as for the development of cosmetic raw materials. Background Art

[0002] Silk fibroin (SF) is a natural polymeric fibrous protein extracted from silk, accounting for about 70%-80% of silk. Silk fibroin is the most important component of silk and belongs to the fibrous protein type. As a natural material, it has excellent biodegradability and oxygen permeability, and is non-toxic and non-allergenic in the human body, with good biocompatibility and low immunogenicity. Therefore, silk fibroin has a wide range of applications in biomaterials and medical devices. Natural silk fibroin can also inhibit LPS-induced inflammatory responses by regulating the TLR4 signaling pathway, and at the same time has functions such as moisturizing and supporting the proliferation of various cells. Therefore, it also has a wide range of applications in the cosmetic field.

[0003] The acquisition of silk fibroin is mainly by natural extraction, and the main processes include degumming, hydrolysis, dialysis and filtration. To convert silk into a silk fibroin medical material, degumming treatment is required first. Degumming can remove sericin by enzymatic methods or chemical treatments. The degummed natural silk fibroin is hydrolyzed, dialyzed and filtered to remove salts to obtain a mixed regenerated silk fibroin. However, the silk fibroin produced by this method may damage its natural structure, and at the same time, the quality and function of natural extracted silk fibroin are easily affected by different batches, which leads to problems such as high purification cost and difficult control of the product quality of each batch.

[0004] With the development of genetic engineering and synthetic biology technologies, obtaining proteins by heterologous protein methods has become increasingly popular. Heterologous expression has the advantages of single product composition, safety, controllable production process, and small differences between batches. Obtaining silk fibroin or silk fibroin-like proteins by heterologous expression through genetic engineering is an effective strategy. In the basic unit of silk fibroin, the heavy chain protein is the main component, accounting for 92%. Its amino acids are mainly G-X, and the X structure is mainly Ala (64%), Ser (22%) and Tyr (10%), which form the high repeatability of its sequence and a large number of hydrophobic regions, resulting in difficulty in obtaining highly expressed recombinant silk fibroin. Wang Jiannan et al. repeated the basic unit of the silk fibroin heavy chain crystallization region 16 times and then fused it with different multiples of the non-crystallization region and the fusion protein GST to obtain silk fibroin-like proteins, and the final highest yield was 53.2 mg / L.

[0005] Heterologous expression systems include Escherichia coli, Pichia pastoris, mammalian expression systems, etc. The Pichia pastoris expression system is an ideal expression system for recombinant silk fibroin because it has the advantages of simple operation, easy cultivation, high expression level like prokaryotic expression systems, and post-translational modification functions such as glycosylation and phosphorylation. At the same time, its powerful secretion function reduces the post-treatment steps. The low yield of silk fibroin is one of the factors limiting its industrial production. Whether recombinant silk fibroin has similar activities and functions to naturally extracted proteins is another limiting factor. The recombinant silk fibroin-like protein produced by the Escherichia coli expression system in CN118480553A has functions such as whitening, anti-ultraviolet, antioxidant, and moisturizing after renaturation.

[0006] Currently, silk fibroin is basically extracted naturally, and the extraction process is complex, resulting in low stability of each batch of extraction and differences in product quality. In addition, due to its high sequence repeatability, it is difficult to recombinantly express silk fibroin or silk fibroin-like proteins with high yield, high purity, efficacy, and activity, leading to difficulties in its industrialization. Summary of the Invention

[0007] To solve the problem that there is a lack of silk fibroin or silk fibroin-like proteins with high purity, efficacy, and activity in the prior art, the present invention provides a recombinant silk fibroin fusion protein, its preparation method, and application. The recombinant silk fibroin of the present invention has high expression, high purity, and can retain the efficacy and activity of natural proteins, and has high potential for industrial application.

[0008] Specifically, the inventors analyzed the silk fibroin sequence, fused the collagen fragment with the silk fibroin sequence, and finally optimized the recombinant silk fibroin fusion protein sequence. The sequence was expressed through the Pichia pastoris expression system, protein purified, and the efficacy, function, and activity were detected, and finally the recombinant silk fibroin fusion protein with adhesion, cell proliferation, and collagen metabolism activities was obtained.

[0009] The present invention solves the above technical problems through the following technical solutions.

[0010] The first aspect of the present invention provides a recombinant silk fibroin, and the amino acid sequence of the recombinant silk fibroin is as shown in SEQ ID NO: 3.

[0011] The second aspect of the present invention provides a polynucleotide, and the polynucleotide encodes the recombinant silk fibroin as described in the first aspect.

[0012] In some embodiments of the present invention, the polynucleotide contains the sequence as shown in SEQ ID NO: 4 or is the sequence as shown in SEQ ID NO: 4.

[0013] The third aspect of the present invention provides a recombinant expression vector, and the recombinant expression vector contains the polynucleotide as described in the second aspect.

[0014] The fourth aspect of the present invention provides a transformant that expresses the recombinant fibroin protein as described in the first aspect, or contains the polynucleotide as described in the second aspect, or contains the recombinant expression vector as described in the third aspect; the transformant is not an animal variety or a plant variety.

[0015] In some embodiments of the present invention, the transformant is a eukaryotic cell or a prokaryotic cell.

[0016] In some embodiments of the present invention, the eukaryotic cells are selected from Pichia pastoris and Saccharomyces cerevisiae; the prokaryotic cells are selected from Bacillus subtilis and Escherichia coli.

[0017] In some embodiments of the present invention, the Pichia pastoris is GS115 cells.

[0018] The fifth aspect of the present invention provides a genetically engineered bacterium that expresses recombinant fibroin protein. The starting strain of the genetically engineered bacterium is Pichia pastoris, and the genetically engineered bacterium contains the polynucleotide as described in the second aspect.

[0019] The sixth aspect of the present invention provides an application of the recombinant fibroin protein as described in the first aspect, the polynucleotide as described in the second aspect, the recombinant expression vector as described in the third aspect, the transformant as described in the fourth aspect, or the genetically engineered bacterium as described in the fifth aspect in the preparation of a reagent for promoting keratinocyte adhesion and proliferation, promoting fibroblast proliferation or collagen metabolism, promoting skin repair, or promoting skin firming and anti-wrinkle.

[0020] As is known in the art, fibroblasts, as cells present in the dermis of the skin, have the ability to synthesize and secrete collagen, elastic fibers, hyaluronic acid, etc., and participate in wound healing, tissue remodeling, and the synthesis of the extracellular matrix. Fibroblasts participate in maintaining skin elasticity, skin firmness, and skin moisture through the dermis of the skin.

[0021] The seventh aspect of the present invention provides a composition that contains the recombinant fibroin protein as described in the first aspect, the polynucleotide as described in the second aspect, the recombinant expression vector as described in the third aspect, the transformant as described in the fourth aspect, or the genetically engineered bacterium as described in the fifth aspect, as well as a carrier and / or excipient.

[0022] In some embodiments of the present invention, the composition is a cosmetic composition, a wound dressing composition, or a wound repair composition.

[0023] The eighth aspect of the present invention provides a method for preparing recombinant fibroin protein, the method comprising:

[0024] Inducing expression and inducing culture of the genetically engineered bacterium as described in the fifth aspect in sequence.

[0025] In some embodiments of the present invention, the induced expression is achieved by culturing in YPD medium and then inoculating into BMGY medium, with the culture conditions being 30 °C and 220 rpm.

[0026] The induced culture is carried out in BMMY medium with the addition of methanol. The culture conditions are 30 °C and 220 rpm, and the final concentration of methanol is 1% (by volume).

[0027] Based on common general knowledge in the art, the above preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0028] The reagents and raw materials used in the present invention are all commercially available.

[0029] The positive and progressive effects of the present invention are as follows:

[0030] The recombinant silk fibroin protein of the present invention has a high expression level and high purity, and can retain the adhesion, cell proliferation, and collagen metabolism activities of the natural protein, showing high potential for industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 It shows the SDS-PAGE detection results of SF-22 induced in a shake flask.

[0032] Lane 1 shows SF-22 at 72 h of induction. The molecular weight detected by SDS-PAGE is higher than the theoretical molecular weight, which may be caused by hydrophobicity and post-translational modification.

[0033] Figure 2 It shows the SDS-PAGE detection results of SF-22 induced in a fermenter.

[0034] Lane 1: Induction for 24 h; Lane 2: Induction for 48 h; Lane 3: Induction for 72 h. The molecular weight detected by SDS-PAGE is higher than the theoretical molecular weight, which may be caused by the strong hydrophobicity of amino acids and post-translational modification.

[0035] Figure 3 It shows the detection results of SEC-HPLC after purification.

[0036] Figure 4 It shows the results of the adhesion experiment of human immortalized keratinocytes.

[0037] Figure 5 It shows the results of the proliferation experiment of fibroblasts.

[0038] Figure 6 It shows the results of the proliferation experiment of immortalized keratinocytes.

[0039] Figure 7 It shows the results of the collagen metabolism experiment of fibroblasts. DETAILED DESCRIPTION OF THE INVENTION

[0040] The present invention will be further described below by way of examples, but the present invention is not limited to the scope of the described examples. For the experimental methods without specific conditions indicated in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0041] Specifically, due to the high repeat sequence and sequence hydrophobicity of silk fibroin, it is difficult to recombinantly express. The inventors screened out hydrophilic collagen peptide segments through sequence research and analysis, fused them at the N-terminus of the "GX" repeat sequence of silk fibroin, and repeated this sequence (SEQ ID NO: 6) six times to obtain a recombinant silk fibroin-like protein, named SF-22. Subsequently, a recombinant vector of SF-22 was constructed, linearized and transformed into the GS115 host respectively, and the corresponding engineering bacteria were screened through MD plates. The engineering bacteria containing the SF-22 recombinant vector were induced to express, the expression levels were compared, and the engineering bacteria with high expression levels were selected for fermentation in a fermenter. The fermentation supernatant was collected, and a high-purity recombinant silk fibroin fusion protein sponge was prepared by membrane filtration, column chromatography, and freeze-vacuum drying methods. Finally, the prepared recombinant silk fibroin fusion protein sponge was diluted to different concentrations for efficacy experiments on immortalized human keratinocytes and fibroblasts, and the efficacy results of the samples and the control products were compared in terms of cell adhesion, cell proliferation, collagen metabolism, etc.

[0042] Example

[0043] Example 1: Construction of a Pichia pastoris genetic engineering bacterium expressing recombinant silk fibroin fusion protein

[0044] 1.1 Screening of recombinant silk fibroin fusion protein sequences

[0045] Since the silk fibroin sequence is basically a "GX" repeat sequence and the amino acid hydrophobicity is high, it is difficult to recombinantly express. The collagen sequence has high hydrophilicity, low immunogenicity, and a large number of studies have shown that recombinant collagen can achieve a high expression level. Fusing the collagen fragment with silk fibroin may result in a highly expressed recombinant silk fibroin-like protein. Therefore, the inventors screened out hydrophilic collagen peptide segments through sequence research and analysis and bioinformatics methods. The amino acid sequence is as shown in SEQ ID NO: 1, and the "GX" repeat sequence of silk fibroin, the amino acid sequence is as shown in SEQ ID NO: 2. The collagen peptide segment was fused at the N-terminus of the "GX" repeat sequence of silk fibroin to obtain a fusion sequence, and this sequence was repeated six times to obtain a recombinant silk fibroin-like protein, named SF-22, and the amino acid sequence is as shown in SEQ ID NO: 3. The nucleotide sequence corresponding to SF-22 is as shown in SEQ ID NO: 4.

[0046] The amino acid sequence of the hydrophilic collagen peptide segment is as follows:

[0047] GPRGDKGETGER (SEQ ID NO: 1)

[0048] The fibroin "GX" repeat sequence is as follows:

[0049] GAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGS (SEQ ID NO: 2)

[0050] The amino acid sequence of SF-22 is as follows:

[0051] GPRGDKGETGERGAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGSGPRGDKGETGERGAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGSGPRGDKGETGERGAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGSGPRGDKGETGERGAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGSGPRGDKGETGERGAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGSGPRGDKGETGERGAGAGSGAGSGSGAGAGSGAGSGSGAGAGSGAGSGS* (SEQ IDNO: 3)

[0052] The nucleotide sequence corresponding to SF-22 is as follows:

[0053] GGTCCAAGAGGTGACAAGGGTGAAACTGGTGAAAGAGGTGCTGGTGCTGGTTCTGGTGCTGGTTCCGGTTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTAGTGGTTCTGGTGCAGGTGCTGGTTCTGGAGCTGGTTCTGGTTCTGGTCCAAGAGGTGACAAGGGTGAAACTGGTGAAAGAGGTGCTGGTGCTGGTTCTGGTGCTGGTTCCGGTTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTAGTGGTTCTGGTGCAGGTGCTGGTTCTGGAGCTGGTTCTGGTTCTGGTCCAAGAGGTGACAAGGGTGAAACTGGTGAAAGAGGTGCTGGTGCTGGTTCTGGTGCTGGTTCCGGTTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTAGTGGTTCTGGTGCAGGTGCTGGTTCTGGAGCTGGTTCTGGTTCTGGTCCAAGAGGTGACAAGGGTGAAACTGGTGAAAGAGGTGCTGGTGCTGGTTCTGGTGCTGGTTCCGGTTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTAGTGGTTCTGGTGCAGGTGCTGGTTCTGGAGCTGGTTCTGGTTCTGGTCCAAGAGGTGACAAGGGTGAAACTGGTGAAAGAGGTGCTGGTGCTGGTTCTGGTGCTGGTTCCGGTTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTAGTGGTTCTGGTGCAGGTGCTGGTTCTGGAGCTGGTTCTGGTTCTGGTCCAAGAGGTGACAAGGGTGAAACTGGTGAAAGAGGTGCTGGTGCTGGTTCTGGTGCTGGTTCCGGTTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTAGTGGTTCTGGTGCAGGTGCTGGTTCTGGAGCTGGTTCTGGTTCTTAA (SEQ ID NO: 4)

[0054] 1.2 Construction of recombinant silk fibroin fusion protein expression host bacteria

[0055] Six nucleotides AAAAAG were added to the 5'-end of the nucleotide sequence of SF-22 and then sent to Jiangsu Saisuofei Biotechnology Co., Ltd. for synthesis, and cloned at the Xho I and Not I sites of plasmid pPIC9F to construct the pPIC9F recombinant vector containing SF-22. The sequence of pPIC9F is shown in SEQ ID NO: 5.

[0056] The recombinant vector was linearized by Sal I digestion and then transformed into the GS115 host, and the corresponding engineering bacteria were screened through the MD plate (the composition is shown in Table 1). The specific operation steps are as follows:

[0057] First, ice-bath the electroporation cuvette. Add 10 μL of the linearized plasmid into a 1.5 mL EP tube containing 80 μL of Pichia pastoris competent cells, mix well and transfer it to an electroporation cuvette with a diameter of 0.2 cm, and ice-bath for about 5 min. Perform electroporation according to the set program. After electroporation, add 300 μL of ice-cold 1 M sorbitol solution and 300 μL of YPD medium into the electroporation cuvette, and pipette evenly. Then transfer all the liquid in the electroporation cuvette to a new 1.5 mL EP tube, and shake-culture at 30 °C for 2 h. Centrifuge at 12000 rpm for 1 min to collect the cells, and spread all of them on the MD plate and incubate at 30 °C for 3 - 4 d.

[0058] Table 1 MD medium formula

[0059]

[0060] Example 2: Expression and preparation of recombinant silk fibroin fusion protein

[0061] 2.1 Small-scale expression identification of recombinant silk fibroin fusion protein

[0062] Induced expression: Respective single colonies picked for growth were inoculated into 10 mL of YPD (the composition is shown in Table 2) medium and cultured at 30 °C and 220 rpm for 20 h, and then transferred with an inoculation amount of 0.1% to a 250 mL sterile conical flask containing 25 mL of BMGY (the composition is shown in Table 3) and cultured overnight at 30 °C and 220 rpm until OD 600 = 2 - 6; Centrifuge at 3500 rpm for 5 min to collect the cells, discard the supernatant, resuspend the cells with BMMY medium (the composition is shown in Table 4) to OD 600 = 1, and induce culture at 30 °C and 220 rpm; Add methanol to a final concentration of 1% every 24 h for induced expression, and the total induction time is 72 h. The expression of SF-22 was detected by SDS-PAGE, and the results are as Figure 1 shown.

[0063] Table 2 YPD medium formula

[0064]

[0065] Table 3 Formulation of BMGY Medium

[0066]

[0067] Table 4 Formulation of BMMY Medium

[0068]

[0069] 2.2 Fermentation Tank Expression and Purification Preparation of Recombinant Silk Fibroin Fusion Protein

[0070] The strain containing SF-22 was induced for expression in a 2 L fermentation tank. After 72 h of induction, the fermentation was completed. After fermentation, it was centrifuged at 6500 rpm for 30 min, and the supernatant was collected. SDS-PAGE was used to detect the expression situation. The results showed successful expression, and the expression level increased with the prolongation of the induction experiment (SDS-PAGE is shown in Figure 2 ).

[0071] 2.3 Purification Preparation of Recombinant Silk Fibroin Fusion Protein

[0072] The supernatant from the fermentation tank was clarified with a 0.1 μm membrane package, then concentrated with a 3 kDa membrane package and replaced with ultrapure water until the conductivity reached 2 mS / cm, and the pH was adjusted to 4.0 to obtain the sample loading solution. The sample loading solution was purified multiple times through a cation exchange column lexcapSP 6FF to obtain the sample. Finally, it was replaced with ultrapure water using a 3 kDa membrane package and vacuum freeze-dried for 48 h. After freeze-drying, an SF-22 freeze-dried sponge was formed. The SF-22 sponge was dissolved to 5 mg / mL, and SEC-HPLC was used for detection. The results showed that the purity of SF-22 detected by SEC-HPLC was 92.77% (the SEC-HPLC detection results are shown in Figure 3 ).

[0073] Example 3: Cell Efficacy Experiment of Recombinant Silk Fibroin Fusion Protein

[0074] 3.1 Adhesion Experiment of Human Immortalized Keratinocytes (Hacat)

[0075] Dissolve SF-22 in PBS to 2 mg / mL, then dilute it to different concentration gradients with PBS and coat it in a 96-well plate overnight at 4°C. On Day 1, discard the protein solution, wash the wells twice with PBS, and discard the supernatant by flicking the plate. Add Hacat cells (Cell Bank of the Chinese Academy of Sciences) at 3×10⁴ cells / well and incubate in a 37°C incubator for 1 h. Observe the cell adhesion situation, discard the cells by flicking the plate, and wash twice with PBS. Add CCK8 solution prepared with DMEM basal medium, 100 μL / well. Incubate at 37°C for 1 h, read the values on an ELISA reader, and plot the graph using Graphpad after obtaining the OD values. The experimental results show that the control product has no cell adhesion effect, and SF-22 of the present invention has an obvious effect of promoting cell adhesion, which is better than the control product and the PBS control (the adhesion results are shown in Figure 4 ). The control products are soluble regenerated silk fibroin from Nanjing Siyuan Medical Technology Co., Ltd., production date: April 2, 2024, hereinafter referred to as Siyuan; and soluble silk fibroin from Zhejiang Xingyue Biotechnology Co., Ltd., production date May 8, 2024, hereinafter referred to as Xingyue.

[0076] 3.2 Proliferation experiment of fibroblasts (HDF-1)

[0077] Suspend fibroblasts in the logarithmic growth phase (Guangdong Boxi Biology) at 5×10³ cells / well with 10% FBS and add them to a 96-well plate. On Day 1, discard the supernatant of the well plate, add different concentrations of the sample diluted with 0.1% FBS, and incubate at 37°C for 48 h. After incubation, discard the supernatant, wash the cells 1-2 times with PBS, add CCK8 solution prepared with DMEM basal medium, incubate at 37°C for 1 h, read the values on an ELISA reader, and plot the graph using Graphpad after obtaining the OD values. The results show that both SF-22 of the present invention and the control product can promote the proliferation of HDF-1, and the effect of SF-22 is better than that of the Siyuan and Xingyue control products (the HDF-1 proliferation results are shown in Figure 5 ).

[0078] 3.3 Proliferation experiment of human immortalized keratinocytes

[0079] Hacat cells in the logarithmic growth phase (Cell Bank of the Chinese Academy of Sciences) were resuspended at a density of 1×10⁴ cells / well in 10% FBS and added to 96-well plates. On Day 1, the supernatant was removed, and different concentrations of the sample diluted with 0.1% FBS were added, followed by incubation at 37 °C for 48 h. After incubation, the supernatant was discarded, the cells were washed 1 - 2 times with PBS, CCK8 solution prepared with DMEM basal medium was added, and the mixture was incubated at 37 °C for 1 h. The absorbance was measured using a microplate reader. After obtaining the OD values, graphs were plotted using GraphPad. The experimental results showed that both SF-22 and the reference product could promote the proliferation of HDF-1, and the effect of SF-22 was similar to that of the reference product (the results of Hacat proliferation are shown in Figure 6 ).

[0080] 3.4 Fibroblast collagen metabolism experiment

[0081] HDF-1 cells were resuspended in DMEM medium containing 10% FBS and added to 96-well plates at a density of 3×10⁵ cells / well. After the cells adhered, different concentrations of the sample diluted with 0.1% FBS DMEM medium were added, and the mixture was thoroughly mixed and placed in an incubator at 37 °C. After 24 h, RNA was extracted and reverse transcribed to obtain cDNA for qPCR experiments. The results showed that both SF-22 and the competing product had a promoting effect on the metabolism of collagen Ⅰ / Ⅲ / Ⅶ (COL-1, COL-3, COL-7). Among them, in the metabolism of collagen Ⅶ, the promoting effect of SF-22 was better than that of the reference product Xingyue, and in the metabolism of collagen Ⅰ / Ⅲ, the promoting effect of the reference product Xingyue was slightly better than that of SF-22 (the results of collagen metabolism are shown in Figure 7 ).

Claims

1. A recombinant silk fibroin protein, characterized in that, The amino acid sequence of the recombinant silk fibroin is shown in SEQ ID NO:

3.

2. A polynucleotide, characterized in that, The polynucleotide encodes the recombinant silk fibroin as claimed in claim 1.

3. The polynucleotide according to claim 2, wherein The polynucleotide comprises the sequence shown in SEQ ID NO:

4.

4. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the polynucleotide as claimed in claim 2 or 3.

5. A transformant, characterized in that, The transformant expresses the recombinant silk fibroin as claimed in claim 1, or comprises the polynucleotide as claimed in claim 2 or 3, or comprises the recombinant expression vector as claimed in claim 4; the transformant is not an animal variety or a plant variety.

6. The transformant according to claim 5, characterized in that, The transformant is a eukaryotic cell or a prokaryotic cell.

7. The transformant according to claim 6, wherein The eukaryotic cell is selected from Pichia pastoris and Saccharomyces cerevisiae; the prokaryotic cell is selected from Bacillus subtilis and Escherichia coli.

8. The transformant according to claim 7, wherein, The Pichia pastoris is GS115 cell.

9. A genetically engineered bacterium expressing recombinant fibroin protein, characterized in that, The starting strain of the genetically engineered bacterium is Pichia pastoris, and the genetically engineered bacterium comprises the polynucleotide as claimed in claim 2 or 3.

10. Use of the recombinant silk fibroin as claimed in claim 1, the polynucleotide as claimed in claim 2 or 3, the recombinant expression vector as claimed in claim 4, the transformant as claimed in any one of claims 5-8, or the genetically engineered bacterium as claimed in claim 9 in the preparation of a reagent for promoting keratinocyte adhesion and proliferation, promoting fibroblast proliferation or collagen metabolism, promoting skin repair, or promoting skin firming and anti-wrinkle.

11. A composition, characterized in that, The composition comprises the recombinant silk fibroin as claimed in claim 1, the polynucleotide as claimed in claim 2 or 3, the recombinant expression vector as claimed in claim 4, the transformant as claimed in any one of claims 5-8, or the genetically engineered bacterium as claimed in claim 9, and a carrier and / or excipients.

12. The composition according to claim 11, wherein, The composition is a cosmetic composition, a wound dressing composition or a wound repair composition.

13. A method for preparing recombinant fibroin protein, characterized in that, The method comprises: Inducing expression and inducing culture of the genetically engineered bacterium as claimed in claim 9 in sequence.

14. The method according to claim 13, wherein The inducing expression is culturing in YPD medium and then inoculating into BMGY medium, and the culture conditions are 30 °C and 220 rpm; The inducing culture is culturing in BMMY medium and adding methanol, and the culture conditions are 30 °C and 220 rpm, and the final concentration of methanol is 1%, and the % is volume percentage.

Images