Plant immune induced resistance protein EqBPIN1 and application thereof

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a plant immune induced resistance protein EqBPIN1 and application thereof, and the amino acid sequence of the protein EqBPIN1 is shown as SEQ ID No.1. The protein EqBPIN1 provided by the invention can be started from a plant, and the immune system of the plant is enhanced, so that the plant can cope with more diverse environmental changes and infection of various pathogenic bacteria; according to the present invention, the plant disease resistance can be significantly improved, the plant disease resistance can be significantly improved, and the bacterial inhibition effect can be produced when the concentration is 0.1-1 [mu] M, and the plant disease resistance can be significantly improved, such that the plant disease resistance can be significantly improved, and the plant disease resistance can be significantly improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a plant immune elicitor protein EqBPIE1 and its application. Background Art

[0002] Plants have a complex immune system that can recognize and resist the invasion of pathogens. Immune elicitor proteins are the key substances that can activate the plant's own immune response. By spraying immune elicitor proteins, plants can be induced to enter the immune response state in advance, enhancing the strength and toughness of the plant cell wall and enabling the plant to produce a series of resistance-related substances, such as phytoalexins and protease inhibitors. Thus, a strong defense barrier can be established before the invasion of pathogens, effectively inhibiting the infection and proliferation of pathogens. This prevention and control strategy based on the plant's own immune mechanism is green, environmentally friendly, and sustainable. It does not rely on chemical pesticides, does not cause drug resistance problems, and does not damage the ecological environment. At the same time, it can be widely applied to a variety of plants and has an inhibitory effect on a variety of viruses, providing a new, efficient, and environmentally friendly solution for the prevention and control of plant virus diseases. It is expected to play an important role in agricultural production, reducing the losses caused by diseases and ensuring the healthy growth of plants and the stable and high yield of agricultural products. Summary of the Invention

[0003] The purpose of the present invention is to provide a plant immune elicitor protein, starting from enhancing the disease resistance ability of plants themselves, to achieve resistance to the infection of a variety of pathogens on a variety of plants.

[0004] The present invention provides a plant immune elicitor protein EqBPIE1. The amino acid sequence of the protein EqBPIE1 is shown in SEQ ID No.1, specifically: MGSSHHHHHHSSGLVPRGSHMASMTGGQQMGRGSYHTNISTKSKNSSTLEGFGPSPVTDRVIVSRSFETTKEDRVKIPTALDPGVPVAKIAEQFGFTKRQIYYVRSYGLESGRKSCGRKPAVLASTAAADYKDDDDKGDYKDDDDKIDYKDDDDK. For the convenience of protein detection, the present invention fuses a 6×His tag at the N-terminus of the protein and a 3×Flag tag at the C-terminus.

[0005] The present invention also provides the CDS sequence of the protein EqBPIE1 described in the above technical solution. The CDS sequence is shown in SEQ ID No.2, specifically: 5'-ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCTACCACACGAATATTTCTACCAAATCAAAAAATAGCTCCACCCTAGAAGGATTTGGGCCTTCTCCAGTCACTGATCGAGTAATAGTAAGTCGTAGTTTTGAAACTACGAAAGAGGACCGAGTAAAAATCCCAACTGCTTTGGATCCAGGAGTGCCGGTGGCAAAGATTGCGGAGCAGTTTGGATTCACTAAGCGACAAATTTATTATGTCCGAAGTTATGGTTTGGAGTCTGGGAGGAAGAGCTGCGGGAGAAAACCAGCAGTATTAGCCAGTACTGCGGCCGCAGATTACAAGGATGACGACGATAAGGGAGATTACAAGGATGACGACGATAAGATCGATTACAAGGATGACGACGATAAG-3'.

[0006] The present invention also provides a primer pair for amplifying the CDS sequence described in the above technical solution. The primer pair includes EqBPIE1-For and EqBPIE1-Rev. The sequence of EqBPIE1-For is shown in SEQ ID No.3, specifically: 5'-GTGGACAGCAAATGGGTCGCGGATCCATGTACCACACGAATATTTCTACC-3'; the sequence of EqBPIE1-Rev is shown in SEQ ID No.4, specifically: 5'-TCGAGTGCGGCCGCAAGCTTGAATTCTCACTTATCGTCGTCATCCTTGTAATCGATCTTATCGTCGTCATCCTTGTAATCTCCCTTATCGTCGTCATCCTTGTAATCAGTACTGGCTAATACTGCTGGTTTTC-3'.

[0007] The present invention also provides the application of the protein EqBPIE1 described in the above technical solution in improving the resistance of plants to pathogenic bacteria.

[0008] Preferably, the pathogenic bacteria include Oidium heveae, Colletotrichum siamense, Botrytis cinerea, Pseudomonas syringae, Phytophthora capsici, and Phytophthora sojae.

[0009] Preferably, the plants include Hevea brasiliensis, Arabidopsis thaliana, Nicotiana benthamiana, and Glycine max.

[0010] The present invention also provides a method for preparing the protein EqBPIE1 described in the above technical solution. The method includes: amplifying the CDS sequence described in the above technical solution using the primer pair described in the above technical solution, then transforming the amplified CDS sequence into a recipient bacterium, inducing protein expression, collecting the bacterial cells, and purifying to obtain the protein EqBPIE1.

[0011] Preferably, the induction includes: when the OD of the recipient bacterium broth 600 = 0.6 - 0.8, adding IPTG to a final concentration of 0.2 - 0.5 mM, and then incubating the broth at 16 °C and 100 rpm for 18 - 24 h.

[0012] Preferably, the purification includes the following steps: resuspending the bacterial cells with PBS protein buffer, adding PMSF to a final concentration of 100 μM; sonicating the bacterial cells and centrifuging to collect the supernatant; passing the supernatant through His-Tag purification resin and incubating on a shaker for 1 h to fully bind the tagged protein; then passing the entire system through a gravity column, washing 3 times with 3 column volumes of PBS, and finally eluting the protein with a PBS buffer containing 200 mM imidazole.

[0013] The present invention also provides a method for improving the resistance of plants to pathogenic bacteria. The pathogenic bacteria include Oidium heveae, Colletotrichum siamense, Botrytis cinerea, Pseudomonas syringae, Phytophthora capsici, and Phytophthora sojae; the method includes: spraying the solution of the protein EqBPIE1 described in claim 1 onto the plant leaves; the concentration of the protein EqBPIE1 solution is 0.1 - 1 μM.

[0014] Advantages of the present invention: The protein EqBPIE1 provided by the present invention has an inhibitory effect on a variety of pathogenic bacteria, covering a variety of pathogenic bacteria such as Oidium heveae, Colletotrichum siamense, Botrytis cinerea, Pseudomonas syringae, Phytophthora capsici, and Phytophthora sojae, can significantly improve the disease resistance of plants, and can produce an antibacterial effect at a concentration of 0.1 - 1 μM; it is effective against a variety of plants, including Hevea brasiliensis, Arabidopsis thaliana, Nicotiana benthamiana, and Glycine max.

[0015] The present invention is a protein product. Compared with chemical pesticides, it has no pollution to the environment and will not cause pathogenic bacteria to develop drug resistance.

[0016] The effect of the protein EqBPIE1 provided by the present invention starts from the plant itself, enhancing the plant's own immune system, so that the plant can cope with more diverse environmental changes and infections by various pathogens.

[0017] The preparation process of the protein EqBPIE1 provided by the present invention is simple. The reagents, instruments and equipment used are all common and easy to obtain, and ordinary scientific research personnel can easily operate them. The required experimental strains and culture reagents are inexpensive, the protein extraction cost is low, and it is easy to obtain in large quantities. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments.

[0019] Figure 1 It is the SDS-PAGE identification result of the EqBPIE1 protein; Figure 2 It is the resistance result of EqBPIE1 to Oidium heveae after being applied to rubber trees; Figure 3 It is the resistance result of EqBPIE1 to Colletotrichum siamense after being applied to rubber trees; Figure 4 It is the resistance result of EqBPIE1 to Botrytis cinerea after being applied to Arabidopsis thaliana; Figure 5 It is the resistance result of EqBPIE1 to Pseudomonas syringae after being applied to Nicotiana benthamiana; Figure 6 It is the resistance result of EqBPIE1 to Phytophthora capsici after being applied to Nicotiana benthamiana; Figure 7 It is the resistance result of EqBPIE1 to Phytophthora sojae after being applied to soybeans. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0020] In order to further illustrate the present invention, a plant immune elicitor protein EqBPIE1 and its application provided by the present invention will be described in detail below with reference to the drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0021] The information of the plants and pathogens used in the embodiments of the present invention is shown in Table 1 below: Table 1 Information of test plants and strains

[0022] Example 1 (1) Design primers according to the target protein sequence, and the specific sequences are as follows: EqBPIE1-For: 5'-GTGGACAGCAAATGGGTCGCGGATCCATGTACCACACGAATATTTCTACC-3' (SEQ ID No.3); EqBPIE1-Rev: 5'-TCGAGTGCGGCCGCAAGCTTGAATTCTCACTTATCGTCGTCATCCTTGTAATCGATCTTATCGTCGTCATCCTTGTAATCTCCCTTATCGTCGTCATCCTTGTAATCAGTACTGGCTAATACTGCTGGTTTTC-3' (SEQ ID No.4).

[0023] (2) Construction of prokaryotic expression vector: RNA was extracted from the Oidium heveae HO-73 strain, and after reverse transcription, it was used as a template for PCR amplification with primers EqBPIE1-For / EqBPIE1-Rev to obtain a target fragment with a length of 421 bp. The pET28a plasmid was digested with BamH Ⅰ and EcoR Ⅰ double enzymes, and ligated with the target fragment by homologous recombination and transformed into Escherichia coli BL21 competent cells. The recombinant vector was sequenced and the transformants with correct sequences were preserved.

[0024] (3) The correctly sequenced BL21 transformants were first cultured overnight at 37°C and 150 rpm in 10 mL of LB liquid medium containing kanamycin antibiotic, and then added to the LB liquid medium containing kanamycin antibiotic at a ratio of 1:100 (v / v) and cultured at 37°C and 150 rpm. When OD 600 =0.6 - 0.8, IPTG was added to the system to make its final concentration 0.5 mM, and then the bacterial solution was cultured at 16°C and 100 rpm for 18 - 24 h to induce protein expression.

[0025] (4) After the induction was completed, the cells were collected by centrifugation at 5000 rpm for 10 min, and then resuspended in 4°C pre-cooled PBS protein buffer (2 mM KH2PO4, 8.0 mM Na2HPO4·12H2O, 136.0 mM NaCl, 2.6 mM KCl, pH = 7.4). To inhibit protein degradation, PMSF (phenylmethylsulfonyl fluoride) was added to make its final concentration 100 μM. Then, an ultrasonic crusher was used to break Escherichia coli until the bacterial solution became clear, and centrifuged at 12000 rpm for 15 min at 4°C to collect the supernatant.

[0026] (5) Add His-Tag purification resin equilibrated with PBS to the supernatant, incubate at 4 °C on a shaker for 1 h to allow sufficient binding of the tagged protein. Then pass the entire system through a gravity column, wash 3 times with 3 column volumes of PBS, and finally elute the protein with a PBS buffer containing 200 mM imidazole.

[0027] (6) Place the eluted protein solution in an ultrafiltration tube, centrifuge at 4000 rpm at 4 °C for 3 h to remove imidazole and PMSF in the solution, measure the protein concentration, and finally obtain a relatively pure protein solution. The protein size is 17.14 kDa, as Figure 1 shown.

[0028] Example 2 Spray a 1 μM EqBPIE1 protein solution onto the leaves of rubber trees at the bronze stage. The protein inoculation amount per leaf is about 500 ng. Use GST-Flag protein as a control. After the leaf surface is dry 4 h later, inoculate the spores of Oidium heveae (10 6 cells / mL) onto the leaf surface. The spore inoculation amount per leaf is about 2×10 5 cells. Observe the disease occurrence on the leaves every day. After 10 days, take pictures and count the lesion area. The results are as Figure 2 shown, Figure 2 where A in shows the leaf phenotype 10 days after inoculating the zoospores of Oidium heveae on the leaf surface after spraying the protein solution; Figure 2 where B in shows the statistical chart of the lesion area. Use t to test and analyze the significant difference between the two groups. "**" indicates P <0.01, and the number of repetitions of this experiment n = 9.

[0029] It can be seen from Figure 2 that compared with the control group, the lesion area of Oidium heveae on the leaves treated with EqBPIE1 decreased significantly, and the antibacterial effect reached more than 40%; the EqBPIE1 protein provided by the present invention enhanced the resistance of rubber trees to Oidium heveae.

[0030] Example 3 Spray a 1 μM EqBPIE1 protein solution onto the leaves of rubber trees at the bronze stage. The protein inoculation amount per leaf is about 500 ng. Use GST-Flag protein as a control. After the leaf surface is dry 4 h later, inoculate the zoospores of Colletotrichum siamense (10 6 cells / mL) onto the leaf surface. Inoculate at 4 positions on each leaf, and add 10 μL to each position. Observe the disease occurrence on the leaves every day. After 7 days, take pictures and count the lesion area. The results are as Figure 3 shown, Figure 3In A, it represents the leaf phenotype 7 days after inoculating the zoospores of *Colletotrichum siamense* on the leaf surface of rubber trees after spraying the protein solution; Figure 3 In B is the statistical chart of lesion area, using t to test and analyze the significant differences between the two groups. "**" indicates P < 0.01, and the number of replicates in this experiment is n = 31.

[0031] From Figure 3 it can be seen that compared with the control group, the anthracnose lesion area on the leaves after EqBPIE1 treatment was significantly reduced, and the antibacterial effect reached 80%; the EqBPIE1 protein provided by the present invention enhanced the resistance of rubber trees to *Colletotrichum siamense*.

[0032] Example 4 Spray the EqBPIE1 protein solution with a concentration of 1 μM onto the leaves of *Arabidopsis thaliana*, with an approximate protein inoculation amount of 100 ng per leaf. Using the GST-Flag protein as a control, after the leaf surface was dried 4 h later, inoculate the zoospores of *Botrytis cinerea* (10 6 cells / mL) onto the leaf surface, and inoculate 10 μL at the central position of each leaf. Observe the disease occurrence on the leaves every day, take pictures and count the lesion area after 3 days, and the results are as Figure 4 shown. Figure 4 In A, it represents the leaf phenotype 3 days after inoculating the zoospores of *Botrytis cinerea* on the leaves of *Arabidopsis thaliana* after spraying the protein solution; Figure 4 In B is the statistical chart of lesion area, using t to test and analyze the significant differences between the two groups. "**" indicates P < 0.01, and the number of replicates in this experiment is n = 18.

[0033] From Figure 4 it can be seen that compared with the control group, the gray mold lesion area on the leaves after EqBPIE1 treatment was significantly reduced, and the antibacterial effect reached more than 80%; the EqBPIE1 protein provided by the present invention enhanced the resistance of *Arabidopsis thaliana* to *Botrytis cinerea*.

[0034] Example 5 Spray the EqBPIE1 protein solution with a concentration of 1 μM onto the leaves of *Nicotiana benthamiana*, with an approximate protein inoculation amount of 2 μg per leaf. Using the GST-Flag protein as a control, after the leaf surface was dried 4 h later, inject the zoospores of *Pseudomonas syringae* DC3000 into the leaves with a syringe (adjust the OD with 10 mM MgCl2 600= 0.002) 100 µL, observe the disease occurrence on the leaves every day and take pictures after 2 days. To quantify the bacteria, after surface sterilizing each leaf with 75% ethanol, four leaf discs (8 mm in diameter) were taken as one biological replicate, and 3 - 4 replicates were taken for each treatment. The leaf discs were ground and diluted in sterile water, and then the bacterial suspension was inoculated on KB agar plates. After culturing at 30 °C for 24 h, the number of colonies was counted. The results are as Figure 5 shown, Figure 5 in which A represents the leaf phenotype 2 days after injecting Pseudomonas syringae into Nicotiana benthamiana leaves after spraying the protein solution on the leaf surface; Figure 5 in B is the statistical chart of colony counting, using t to test and analyze the significant differences between the two groups, and "**" indicates P < 0.01, and the number of repetitions of this experiment n = 5.

[0035] It can be Figure 5 seen that compared with the control group, the number of bacteria in the leaves after EqBPIE1 treatment was significantly reduced, and the antibacterial effect reached more than 30%; the EqBPIE1 protein provided by the present invention enhanced the resistance of Nicotiana benthamiana to Pseudomonas syringae.

[0036] Example 6 Spray the EqBPIE1 protein solution with a concentration of 1 µM onto Nicotiana benthamiana leaves, with an approximate protein inoculation amount of 2 µg per leaf. Using the GST-Flag protein as a control, after the leaf surface was dry 4 h later, inject 100 µL of zoospores of Phytophthora capsici (10 6 cells / mL) into the leaves. Observe the disease occurrence on the leaves every day, take pictures and count the lesion area after 3 days. The results are as Figure 6 shown, Figure 6 in which A represents the leaf phenotype 3 days after injecting zoospores of Phytophthora capsici into Nicotiana benthamiana leaves after spraying the protein solution on the leaf surface; B represents the disease grade; C is the statistical chart of the disease grade, using t to test and analyze the significant differences between the two groups, and "**" indicates P < 0.01, and the number of repetitions of this experiment n = 14.

[0037] It can be Figure 6 seen that compared with the control group, the severity of leaf disease after EqBPIE1 treatment was significantly reduced; the EqBPIE1 protein provided by the present invention enhanced the resistance of Nicotiana benthamiana to Phytophthora capsici.

[0038] Example 7 Spray the EqBPIE1 protein solution with a concentration of 1 µM onto soybean leaves, with an approximate protein inoculation amount of 2 µg per leaf. Using the GST-Flag protein as a control, after the leaf surface was dry 4 h later, inoculate the zoospores of Phytophthora sojae (106 10 μL (number / mL). Observe the disease incidence on the leaves every day, take pictures and count the lesion area after 7 days. The results are as Figure 7 shown. Figure 7 In [figure], A represents the leaf phenotype 7 days after inoculating zoospores of Phytophthora sojae after spraying the protein solution on the surface of soybean leaves; Figure 7 In [figure], B is the statistical chart of lesion area. Use t to test and analyze the significant differences between the two groups. "**" indicates P < 0.01. The number of repetitions of this experiment is n = 15.

[0039] It can be seen from Figure 7 that, compared with the control group, the lesion area of the leaves after EqBPIE1 treatment was significantly reduced, and the antibacterial effect reached 70%; the EqBPIE1 protein provided by the present invention enhanced the resistance of soybeans to Phytophthora sojae.

[0040] It can be seen from the above embodiments that the EqBPIE1 protein provided by the present invention can effectively improve the disease resistance of plants and has a certain effect on a variety of pathogenic bacteria.

[0041] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments without creative efforts based on these embodiments, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A plant immune elicitor protein EqBPIE1 for enhancing plant resistance to pathogenic bacteria, characterized in that, The amino acid sequence of the protein EqBPIE1 is shown in SEQ ID No.

1.

2. The CDS sequence of the protein EqBPIE1 according to claim 1, characterized in that, The CDS sequence is shown in SEQ ID No.

2.

3. A primer pair for amplifying the CDS sequence recited in claim 2, characterized in that, The primer pair includes EqBPIE1-For and EqBPIE1-Rev; the sequence of EqBPIE1-For is shown in SEQ ID No.3; the sequence of EqBPIE1-Rev is shown in SEQ ID No.

4.

4. The protein EqBPIE1 according to claim 1, wherein, The pathogenic bacteria include Oidium heveae, Colletotrichum siamense, Botrytis cinerea, Pseudomonas syringae, Phytophthora capsici and Phytophthora sojae.

5. The protein EqBPIE1 according to claim 1, wherein The plants include Hevea brasiliensis, Arabidopsis thaliana, Nicotiana benthamiana and Glycine max.

6. A method for preparing the protein EqBPIE1 according to claim 1, characterized in that, The method includes: amplifying the CDS sequence described in claim 2 using the primer pair described in claim 3, then transforming the amplified CDS sequence into a recipient bacterium, inducing protein expression, collecting the bacterial cells, and purifying to obtain the protein EqBPIE1.

7. The method according to claim 6, characterized in that, The induction includes: when the OD of the receptor bacteria broth 600 = 0.6 to 0.8, adding IPTG to a final concentration of 0.2 to 0.5 mM, and then culturing the broth at 16°C and 100 rpm for 18 to 24 h.

8. The method according to claim 6, characterized in that, The purification includes the following steps: resuspending the bacterial cells with PBS protein buffer, adding PMSF to a final concentration of 100 μM; sonicating the bacterial cells and centrifuging to collect the supernatant; passing the supernatant through His-Tag purification resin and incubating on a shaker for 1 h to allow sufficient binding of the tagged protein; then passing the entire system through a gravity column, washing 3 times with 3 column volumes of PBS, and finally eluting the protein with PBS buffer containing 200 mM imidazole.

9. A method for improving the resistance of plants to pathogenic bacteria, characterized in that, The pathogenic bacteria include Oidium heveae, Colletotrichum siamense, Botrytis cinerea, Pseudomonas syringae, Phytophthora capsici and Phytophthora sojae; the method includes: spraying the solution of the protein EqBPIE1 described in claim 1 onto the plant leaves; the concentration of the solution of the protein EqBPIE1 is 0.1 - 1 μM.

Images