Gene editing system and application

Through the srPE technology of Cas9-D10A cleavage of targeted strands and binding to circular petRNA, the problem that existing gene editing technology cannot edit the upstream sequence of non-targeted strand cleavage sites is solved, and the genome coverage and efficient editing is achieved. It is suitable for a variety of cell types and simplifies system construction and delivery.

CN120366268APending Publication Date: 2025-07-25ZHUHAI SHU TONG MEDICAL TECH CO LTD
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202510452832.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-11
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

Existing gene editing technology cannot edit upstream sequences of non-targeted strand cleavage sites, which has inherent limitations in editing direction, strong editing efficiency and cell type dependence, complex system construction and difficult delivery, high off-target risk, and limited expansion capabilities.

Method used

The combination of the Cas9 nickase D10A variant and circular petRNA is used to achieve targeted strand cleavage-mediated reverse pilot editing (srPE). The targeted strand is cleaved by Cas9-D10A, and reverse transcription is carried out in combination with circular petRNA, expand the editing range to the entire genome, optimize editing efficiency and specificity, and reduce off-target risk.

Benefits of technology

It breaks through the limitations of editing direction, achieves all-round coverage of the entire genome, improves editing efficiency and stability, reduces off-target risk, is suitable for a variety of cell types, and simplifies system construction and delivery.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366268A_ABST
    Figure CN120366268A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of gene editing, and discloses a gene editing system and application. The invention provides a gene editing system. The gene editing system comprises Cas9 nickase, sgRNA (small guide ribonucleic acid) and annular petRNA. According to the present invention, the target chain cutting mediated reverse pilot editing (Split Reverse Prime Editing, srPE) realizes the precise editing of the non-target chain cutting site upstream sequence, such that the gene editing coverage range is expanded from the specific region only limited to the non-target chain cutting site downstream to the whole genome range, the stable and efficient editing ability is maintained in different cell types, and the target chain cutting mediated reverse pilot editing can be provided for the target chain cutting site. And meanwhile, the off-target risk is reduced. The srPE gene editing technology breaks through the fundamental limitation of the prior art, and provides a more comprehensive and more efficient technical tool for precise medicine and gene therapy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and particularly relates to a gene editing system and its application. Background Art

[0002] Genome editing technology is a core tool in the modern biomedical field, and its development has undergone multiple generations of technological iterations. With the completion of genome sequencing projects and the in-depth development of functional genomics, the demand for precisely editing specific DNA sequences has become increasingly urgent. The development of genome editing technology has mainly gone through the following key stages:

[0003] The first generation of gene editing technology: Zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) are the earliest programmable genome editing tools. ZFNs utilize the DNA-specific binding ability of the zinc finger domain and fuse with the FokI nuclease domain to introduce double-strand breaks (DSBs) at specific DNA sequences. Similarly, TALENs utilize TALE proteins derived from plant pathogens and fuse with the FokI nuclease to provide more flexible DNA targeting functions. However, these technologies have obvious defects: (i) The design and construction are complex, and new protein domains need to be synthesized for each target; (ii) The length of the specific recognition sequence is limited, resulting in significant off-target effects; (iii) The editing efficiency is low, usually only 1-20%; (iv) It is difficult to achieve simultaneous multi-site editing.

[0004] Second-generation gene editing technology: The discovery and application of the CRISPR-Cas system have revolutionized the field of genome editing. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a prokaryotic adaptive immune system, and Cas9 is the most commonly used nuclease among them. Different from ZFNs and TALENs, the CRISPR-Cas9 system uses RNA guidance (single guide RNA, sgRNA) rather than protein domains to recognize target DNA sequences, greatly simplifying the target design process. The sgRNA contains a sequence of approximately 20 nucleotides for recognizing the target DNA and a backbone sequence for binding to the Cas9 protein. Although the CRISPR-Cas9 system has significant advantages in terms of flexibility, scalability, and ease of operation, it still faces the following challenges: (i) It relies on DSB, triggering the non-homologous end joining (NHEJ) repair pathway, resulting in a high frequency of insertion-deletion (indels) mutations; (ii) These indels mutations are usually random and difficult to accurately predict, limiting its application in precision gene therapy; (iii) DSB may also lead to chromosomal abnormalities such as chromosomal translocations, rearrangements, and large fragment deletions, increasing the risk of genomic instability; (iv) The dependence on the protospacer adjacent motif (PAM) sequence limits the selection of editable sites.

[0005] Third-generation gene editing technology: To overcome the limitations of DSB-mediated gene editing, researchers have developed base editors (BEs). BEs combine the CRISPR-Cas guidance system with cytosine or adenine deaminases to achieve precise single-base modification without DSB. Representative technologies include cytosine base editors (CBE, which can achieve C→T conversion) and adenine base editors (ABE, which can achieve A→G conversion). Compared with CRISPR-Cas9, BEs have significant advantages in precisely editing specific bases, greatly reducing the indel generation rate. However, BEs still have the following limitations: (i) The editing window is narrow, usually limited to a range of approximately 4-5 bases near the PAM; (ii) The editing types are limited, and only four types of conversion mutations (C→T, G→A, A→G, T→C) can be achieved, and transversion mutations (such as C→A) or structural variations (such as insertions and deletions) cannot be achieved; (iii) There is a sequence context-dependent preference, resulting in low editing efficiency at some sites; (iv) It may produce non-specific "bystander" editing within the targeted editing window.

[0006] Fourth-generation gene editing technology: In 2019, Anzalone et al. reported a revolutionary editing technology - Prime Editing (PE) in Nature. The PE system consists of a modified Cas9 nickase (H840A), a reverse transcriptase (RT), and a Prime Editing guide RNA (pegRNA). The pegRNA not only contains the sequence for recognizing the DNA target by the conventional sgRNA but also includes a reverse transcription template (RTT) and a primer binding site (PBS). During the PE process, the Cas9 nickase (H840A) cleaves the non-target strand of DNA to generate a 3'-hydroxyl terminus; the PBS base pairs with the DNA sequence near the cleavage site to provide the starting site for the reverse transcriptase; the reverse transcriptase uses the RTT as a template to directly write the desired edit into the DNA. By optimizing the PE system, the researchers developed versions such as PE2, PE3, and PE3b, further improving the editing efficiency and specificity.

[0007] During the technological iteration process, the researchers also developed the Split Prime Editing (sPE) system, which splits the Cas9 nickase and the reverse transcriptase (RT), and splits the pegRNA into sgRNA and petRNA (a circular RNA containing RTT and PBS), increasing the flexibility and manipulability of the system. sPE retains the advantages of PE and has potential advantages in terms of delivery ability and in vivo application. However, although Prime Editing (including sPE) has made significant breakthroughs compared to its previous-generation technologies, there are still the following key limitations:

[0008] (1) Intrinsic limitation in the editing direction

[0009] The most crucial limitation is that the traditional PE system (including sPE) can only edit the downstream sequence of the cleavage site on the non-target strand. This mechanistic limitation stems from the working principle of PE: the Cas9 nickase (H840A) specifically cleaves the non-target strand, and the 3'-end after cleavage binds to the PBS, while reverse transcription always proceeds in the 5'→3' direction, so it can only edit the downstream sequence of the cleavage site. This makes PE face a major defect in clinically relevant sites - it cannot edit the upstream sequence of the non-target strand cleavage site. A systematic analysis of the ClinVar database (data as of July 2024) found that approximately 180,000 pathogenic variants are located in the upstream region of the non-target strand cleavage site, and these sites cannot be covered by traditional PE technology at all. These include mutation sites of various severe genetic diseases, such as Marfan syndrome (FBN1 gene), hereditary non-polyposis colorectal cancer (MLH1 gene), etc., making PE face serious obstacles in treating these diseases.

[0010] (2) Site-dependence and cell type-dependence of editing efficiency

[0011] PE exhibits significant efficiency differences at different sites and in different cell types, and this inconsistency severely limits its widespread application: Site correlation: The efficiency of PE highly depends on the characteristics of the target sequence, such as GC content, sequence complexity, and secondary structure. At some sites, the PE efficiency is as low as below 1%, making it difficult to achieve the editing frequency required for treatment; Cell type dependence: PE usually performs well in dividing cells (such as HEK293T), but its efficiency is significantly reduced in primary cells, stem cells, and terminally differentiated cells (such as neurons), which does not match the actual needs of disease treatment; RTT-PBS length sensitivity: PE highly depends on the optimal length combination of RTT and PBS, and this combination has specific requirements for different sites and cell types, increasing the complexity of system design.

[0012] (3) Challenges in system construction and delivery

[0013] The complexity of the PE system brings the following practical application obstacles: Component volume: PE needs to express large-molecular-weight fusion proteins (Cas9-RT) and complex pegRNAs, exceeding the carrying capacity (≤4.7 kb) of common delivery vectors such as adeno-associated virus (AAV); pegRNA stability: pegRNA contains non-natural RNA structures and is easily degraded in cells, affecting editing persistence and efficiency; Delivery efficiency: The co-delivery efficiency of the multi-component system is low, limiting its application in difficult-to-transfect cells and in vivo environments.

[0014] (4) Balancing editing precision and off-target risk

[0015] Although PE has a lower off-target rate compared to CRISPR-Cas9, there are still challenges in the following aspects: Intrinsic error rate of reverse transcriptase: The reverse transcriptase may introduce additional mutations during template transcription, especially in longer RTT sequences; RTT-DNA homology interference: An overly long RTT may recognize unintended homologous sequences in the genome, resulting in off-target editing; Non-specific pairing of PBS: PBS may pair with non-target DNA sequences, especially in complex genomic regions such as regions rich in repetitive sequences.

[0016] (5) Limited technical expansion ability

[0017] The expansion strategies of existing PE technologies have obvious limitations: Dual pegRNA system: Although the dual pegRNA can expand the editing window, its design complexity is high, the interference between components is significant, and the editing efficiency is usually not high; Engineered reverse transcriptase: Although the RT fidelity or processing ability can be improved through mutations, the directional limitation problem cannot be fundamentally solved; pegRNA modification: The stability can be improved through chemical modification or secondary structure optimization, but it increases the synthesis complexity and cost, making it difficult to achieve clinical translation.

[0018] In view of the key limitations of the above-mentioned existing technologies, especially the fundamental constraint of being unable to edit the sequence upstream of the non-target strand cleavage site, there is an urgent need to develop a new gene editing technology to achieve full coverage of the entire genome and provide a technical basis for the treatment of related diseases. Summary of the Invention

[0019] The object of the present invention is to overcome the deficiencies of the existing technologies and provide a gene editing system and its application.

[0020] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0021] In a first aspect, the present invention provides a gene editing system, comprising a Cas9 nickase, an sgRNA, and a circular petRNA.

[0022] As a preferred embodiment of the gene editing system of the present invention, the Cas9 protein of the Cas9 nickase has a D10A mutation.

[0023] As a further preferred embodiment of the gene editing system of the present invention, gp41 and / or GCN4 is inserted into the Cas9 nickase.

[0024] As a further preferred embodiment of the gene editing system of the present invention, the insertion site is in at least one of the REC domain, RuvC domain, and PI domain of the Cas9 nickase.

[0025] As a still further preferred embodiment of the gene editing system of the present invention, the insertion site is any of the following sites:

[0026] i. behind at least one of the amino acids at positions 1, 203, 213, 308, and 584 in the REC domain;

[0027] ii. behind at least one of the amino acids at positions 1020, 1051, and 1055 in the RuvC domain;

[0028] iii. behind at least one of the amino acids at positions 1246, 1252, 1260, and 1368 in the PI domain.

[0029] As a preferred embodiment of the gene editing system of the present invention, the sgRNA comprises a target sequence recognition region of 20-25 nucleotides and a backbone region that binds to Cas9.

[0030] As a preferred embodiment of the gene editing system of the present invention, the circular petRNA comprises an MS2 domain, a primer binding site, a reverse transcription template, and a ribozyme domain.

[0031] As a further preferred embodiment of the gene editing system of the present invention, the length of the primer binding site is 9-17 bp; the length of the reverse transcription template is 10-18 bp.

[0032] Preferably, the length of the primer binding site is 11-13 bp; the length of the reverse transcription template is 12-14 bp.

[0033] In a second aspect, the present invention provides a Cas9 nickase, in which the Cas9 protein of the Cas9 nickase has a D10A mutation.

[0034] As a preferred embodiment of the Cas9 nickase of the present invention, gp41 and / or GCN4 is inserted into the Cas9 nickase.

[0035] As a further preferred embodiment of the Cas9 nickase of the present invention, it is characterized in that the inserted site is in at least one of the REC domain, RuvC domain, and PI domain of the Cas9 nickase.

[0036] As a further preferred embodiment of the Cas9 nickase of the present invention, the inserted site is any of the following sites:

[0037] i. behind at least one of the first, 203rd, 213th, 308th, and 584th amino acids of the REC domain;

[0038] ii. behind at least one of the 1020th, 1051st, and 1055th amino acids of the RuvC domain;

[0039] iii. behind at least one of the 1246th, 1252nd, 1260th, and 1368th amino acids of the PI domain.

[0040] In a third aspect, the present invention provides a nucleic acid encoding the above-mentioned Cas9 nickase.

[0041] In a fourth aspect, the present invention applies the gene editing system in combination with a gene editing system that specifically cleaves the non-target strand in any of the following fields:

[0042] i. gene editing;

[0043] ii. preparing a cell delivery vector;

[0044] iii. delivering a reagent into mitochondria;

[0045] v. constructing an animal model of a clinical disease;

[0046] vi. Preparing a drug for treating and / or preventing clinical genetic diseases.

[0047] As a preferred embodiment of the application described in the present invention, the gene editing system for specifically cleaving the non-target strand includes at least one of CRISPR-Cas9, BE, and PE.

[0048] In a fifth aspect, the present invention applies the gene editing system, the Cas9 nickase, and the nucleic acid in any of the following fields:

[0049] i. Gene editing;

[0050] ii. Preparing a cell delivery vector;

[0051] iii. Delivering a reagent into mitochondria;

[0052] v. Constructing an animal model of a clinical disease;

[0053] vi. Preparing a drug for treating and / or preventing clinical genetic diseases.

[0054] The cells in the above applications include but are not limited to HEK293T, HeLa, K562, HepG2, etc.; the diseases include but are not limited to brain development-related diseases, Hunter syndrome, leukemia, Fanconi anemia, fibrin-1, Marfan syndrome, familial thoracic aortic aneurysm, Niemann-Pick disease type C, cystic fibrosis, phenylketonuria, thalassemia, Duchenne muscular dystrophy, Tay-Sachs disease, fragile X syndrome, Williams syndrome, hereditary non-polyposis colorectal tumor, etc.

[0055] Compared with the prior art, the present invention solves the following key technical problems:

[0056] (1) Fundamental constraints on the editing direction

[0057] The present invention breaks through the fundamental constraints on the editing direction of the traditional Prime Editing system, develops a revolutionary gene editing technology - split reverse prime editing (srPE) mediated by target strand cleavage, and realizes precise editing of the sequence upstream of the non-target strand cleavage site. It expands the gene editing coverage from only a specific region downstream of the non-target strand cleavage site to the entire genome, providing solutions for many genetic diseases that cannot be treated by Prime Editing currently.

[0058] (2) Optimization and improvement of editing efficiency

[0059] In view of the problem of low editing efficiency of traditional PE systems at specific sites and in specific cell types, the present invention has developed a technical platform with higher editing efficiency and a wider scope of application. It can achieve efficient editing at sites where PE is difficult to effectively edit, maintain stable and efficient editing capabilities in different cell types (including difficult-to-transfect cell lines and primary cells), reduce the sensitivity of the system to the RTT-PBS length combination, and improve the robustness of the design.

[0060] (3) Optimization of system construction

[0061] The present invention solves the delivery and application obstacles brought by the complexity of the PE system, develops a more modular and flexible component design to simplify system construction, improves the intracellular stability and functional synergy of each component of the system, reduces the dependence of the system on the delivery method, and enhances the application effect in difficult-to-transfect cells.

[0062] (4) Improving system specificity and reducing off-target risks

[0063] While expanding the editing scope, the present invention maintains or improves editing specificity and reduces off-target risks, specifically including: reducing the error rate during reverse transcription, improving the specificity of PBS binding to target DNA, and reducing the impact of RTT length changes on editing accuracy.

[0064] (5) Deep optimization of system functions

[0065] For different application scenarios and clinical needs, the present invention has developed a series of system deep optimization strategies: improving the overall performance of the system through engineering modification of the Cas9 protein domain, establishing a quantitative relationship model for optimizing the RTT-PBS length to guide system design, and developing a site-specific parameter optimization framework to maximize editing efficiency.

[0066] In summary, the srPE gene editing technology of the present invention breaks through the fundamental limitations of the existing technology and provides a more comprehensive and efficient technical tool for precision medicine and gene therapy. Brief description of the drawings

[0067] Figure 1 It is an overview and working mechanism of the rPE system; in the figure, a: Schematic diagram of the composition of the traditional sPE system, showing the three-component structure of Cas9 nickase (H840A), RT, and petRNA; b: Schematic diagram of the composition of the srPE system, showing the specific composition of Cas9 nickase (D10A), RT, and petRNA; c: Flow chart of srPE editing, presenting in detail the whole process from targeted strand cleavage to the generation of edited DNA; d: DNA repair process after srPE editing, showing the mechanism of heteroduplex DNA formation and integration; e: DNA repair process after sPE editing, used for mechanism comparison with srPE.

[0068] Figure 2 Systematic evaluation of the editing performance of srPE in HEK293T cells; in the figure, a - f: editing efficiency of srPE at six gene loci (EMX1, IDS, RUNX1, FANCF, FBN1, NPC2); g: direct comparison of the editing ability of srPE and sPE at the NPC2 locus and the results of amplicon sequencing analysis.

[0069] Figure 3 Sanger sequencing analysis of srPE editing at different loci in HEK293T cells; detailed display of the Sanger sequencing peak maps of srPE at six loci of EMX1, FANCF, RUNX1, IDS, FBN1, and NPC2, highlighting the relative positional relationship between the edited region and the PAM site, and quantitatively analyzing the editing efficiency through peak map overlay analysis.

[0070] Figure 4 Comparison of the editing ability of sPE at the same loci in HEK293T cells; display of the Sanger sequencing peak maps of sPE at six identical gene loci, highlighting the editing effect differences at the same targets as srPE, and proving the phenomenon that sPE cannot produce editing at some loci at all.

[0071] Figure 5 Evaluation of the editing ability of srPE in different cell lines; in the figure, a - e: analysis of the editing efficiency of srPE at multiple gene loci in HeLa cells; f: editing performance of srPE at the FANCF locus in K562 cells; g: editing efficiency of srPE at the EMX1 locus in HepG2 cells.

[0072] Figure 6 Testing the editing ability of sPE in HeLa cells; presenting the sequencing results of sPE at the EMX1, FANCF, IDS, FBN1, and NPC2 loci in HeLa cells, intuitively showing that sPE does not produce obvious editing at these loci, forming a sharp contrast with the performance of srPE under the same conditions.

[0073] Figure 7 Cas9 - D10A structure optimization strategy and its impact on editing efficiency; in the figure, a: schematic diagram of the three - plasmid transfection system of D10A - gp41 / GCN4 variant, sgRNA, and petRNA - RT; b: precise positioning of the insertion sites of gp41 / GCN4 in different domains of the D10A protein; c - h: comparison of the editing efficiency of each D10A variant at different gene loci with the performance of the original D10A.

[0074] Figure 8Schematic diagram of the precise structure of gp41 inserted at different positions of the D10A protein; the functional domains of D10A (REC, RuvC, HNH, PI, etc.) are detailedly labeled, the molecular coordinates of eight gp41 insertion sites and the surrounding amino acid environment are precisely marked, and the surface exposure and steric hindrance of the insertion sites are shown through a three-dimensional structure model.

[0075] Figure 9 Comparison of the conformations of Cas9 and D10A-gp41 / GCN4 variants predicted by AlphaFold; the three-dimensional structure superposition of the original Cas9 (PDBID: 5f9r) and each D10A variant is shown, highlighting the gp41 / GCN4 insertion region (marked in red) and its impact on the overall conformation, and the structural integrity is evaluated through RMSD and local conformational change analysis.

[0076] Figure 10 Quantitative comparison of the editing efficiency of different D10A variants at key sites; the editing efficiency of each D10A variant at multiple gene sites is intuitively shown through a bar chart, highlighting the excellent performance of the best variants D10A-213gp41 and D10A-1gp41, and providing the performance differences of each variant under different editing types (substitution, insertion, deletion).

[0077] Figure 11 Optimization of RTT and PBS lengths and their impact on the editing efficiency of the srPE system; in the figure, a: the curve of the impact of different RTT lengths on the editing efficiency at a fixed PBS length; b: the impact pattern of different PBS lengths on the editing efficiency at a fixed RTT length; c-d: the two-dimensional impact diagram of the RTT-PBS length combination on the editing efficiency at the IDS site.

[0078] Figure 12 Analysis of the application potential of srPE in human diseases; in the figure, a: statistical classification of genetic variation diseases editable by rPE in the ClinVar database; b: comparative analysis of diseases editable only by rPE and those editable only by traditional PE; c: Sanger sequencing confirmation of the introduction of pathogenic mutations by srPE in the FBN1 and MLH1 genes; d: quantitative analysis of the efficiency of srPE in editing disease-related genes. Detailed implementation methods

[0079] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0080] Unless otherwise specified, the test methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can all be obtained from commercial channels.

[0081] The sgRNA sequences and PCR primer sequences used in the examples are shown in Table 1:

[0082] Table 1 sgRNA sequences and PCR primer sequences

[0083]

[0084] The design of the RTT and PBS sequences in petRNA in the examples is shown in Table 2:

[0085] Table 2 RTT and PBS sequences

[0086]

[0087]

[0088] Example 1: Design principle and molecular mechanism of the Split Reverse Prime Editing (srPE) system

[0089] 1. Basic composition of the srPE system

[0090] The Split Reverse Prime Editing (srPE) system proposed by the present invention consists of the following core components (see Figure 1 b):

[0091] (1) Cas9 nickase variant (D10A): Different from the H840A variant used in the traditional PE system, the D10A variant is adopted in the present invention. This variant specifically cleaves the target strand rather than the non-target strand. The D10A variant retains the DNA recognition ability of Cas9 but loses the cleavage activity of the RuvC domain, and introduces a single-strand break on the target strand only through the HNH domain.

[0092] (2) Single guide RNA (sgRNA): It contains a target sequence recognition region of 20 - 25 nucleotides and a backbone region for Cas9 binding. The sgRNA guides Cas9-D10A to specifically recognize and bind to the target DNA sequence, achieving precise cleavage of the target strand.

[0093] (3) Circular petRNA: It contains the following functional elements:

[0094] MS2 domain: Enhances RNA stability and mediates interactions with other components;

[0095] Primer-binding site (PBS): Complementary base pairs with the exposed 3'-end after cleavage of the target DNA;

[0096] Reverse Transcription Template (RTT): It contains the template sequence to be edited.

[0097] Ribozyme domain: It participates in RNA processing to ensure the correct conformation of petRNA.

[0098] (4) Reverse Transcriptase (RT): It can be expressed alone or linked to petRNA, and is responsible for synthesizing a new DNA strand containing editing information using RTT as a template. The RT used in this invention has been engineered according to the research of Liu et al., and the MS2 coat protein (MCP) is fused to the N-terminus of RT, which has high fidelity and processing ability.

[0099] 2. Working mechanism and molecular pathway of srPE

[0100] The molecular mechanism by which the srPE system achieves precise genome editing can be divided into the following key steps (see Figure 1 c - d):

[0101] (1) Target recognition and cleavage:

[0102] The sgRNA guides the Cas9 - D10A nickase to recognize and bind to the target DNA sequence; D10A specifically cleaves the target strand (in sharp contrast to the H840A in traditional PE that cleaves the non - target strand), generating a 3'-hydroxyl terminus on the target strand.

[0103] (2) PBS - mediated DNA - RNA hybridization:

[0104] The exposed 3'-end of the target strand after cleavage is complementary paired with the PBS sequence in petRNA; this hybridization process stabilizes the DNA - RNA complex and provides a platform for subsequent reverse transcription.

[0105] (3) RTT template - guided reverse transcription:

[0106] The reverse transcriptase uses the 3'-hydroxyl at the PBS - DNA hybridization site as a starting point; using the RTT in petRNA as a template, it synthesizes a new DNA sequence containing the expected edit in the 5'→3' direction; the reverse transcription product extends beyond the RTT region to form a DNA - RNA hybrid containing the editing information.

[0107] (4) Intermediate structure formation:

[0108] A special intermediate structure is formed on the target strand, which contains two single - stranded DNA regions: a) 5' Flap: the original DNA sequence (unedited part); b) 3' Flap: the newly synthesized DNA containing the edited sequence copied from the RTT template.

[0109] (5) 5' Flap Excision and DNA Repair:

[0110] In the nucleus, the unedited 5' Flap is preferentially excised by structure-specific endonucleases (such as FEN1) or 5' exonucleases; after excision, a single-stranded region containing the edited sequence is formed on the targeted strand, forming a heteroduplex DNA with the non-targeted strand; this heterostructure activates the cellular DNA repair mechanism (such as the mismatch repair system), and ultimately permanently integrates the edited sequence into the genome.

[0111] 3. Mechanistic Comparison and Complementarity between srPE and Traditional sPE

[0112] There are key differences in the molecular mechanisms between the srPE and traditional sPE of the present invention, and the two form a perfect complementarity (see Figure 1 d - e):

[0113] (1) Cleavage Strand Selection:

[0114] sPE: Cas9 - H840A cleaves the non-targeted strand; srPE: Cas9 - D10A cleaves the targeted strand.

[0115] (2) Editing Direction:

[0116] sPE: Can only edit the sequence downstream of the non-targeted strand cleavage site; srPE: Can edit the sequence upstream of the non-targeted strand cleavage site.

[0117] (3) DNA Repair Pathway:

[0118] Both technologies integrate the edited sequence into the genome by inducing the DNA repair mechanism; however, due to the different strands forming the heteroduplex DNA, different repair pathways may be preferentially activated.

[0119] This mechanistic complementarity enables the srPE and sPE to achieve precise editing at any position in the genome when used in combination, breaking through the directional limitations of existing technologies and providing a new technical platform for the field of gene editing.

[0120] Example 2: Systematic Evaluation of the Editing Performance of srPE in HEK293T Cells

[0121] 1. Experimental Design and Technical Parameters

[0122] To comprehensively evaluate the basic editing ability of the srPE system, six genomic loci were systematically tested in the human embryonic kidney cell line (HEK293T). These loci cover different chromosomal positions, expression levels, and functional characteristics, representing a variety of clinically relevant genes, as follows:

[0123] EMX1: Chromosome 2q14.3, encoding a cavity protein, related to brain development;

[0124] IDS: Chromosome Xq28, encoding iduronidase, the pathogenic gene of Hunter syndrome;

[0125] RUNX1: Chromosome 21q22.12, encoding a transcription factor, related to leukemia;

[0126] FANCF: Chromosome 11p14.3, a gene related to Fanconi anemia;

[0127] FBN1: Chromosome 15q21.1, encoding fibrillin-1, the pathogenic gene of Marfan syndrome;

[0128] NPC2: Chromosome 14q24.3, a gene related to Niemann-Pick disease type C.

[0129] The above tests cover three main types of editing:

[0130] Base substitution (including transition and transversion), base insertion (1 - 10 bases), base deletion (1 - 10 bases).

[0131] 2. Plasmid design and construction

[0132] The constructed expression plasmid system includes:

[0133] pCMV-Cas9-D10A: Expresses Cas9-D10A nickase under the control of the CMV promoter; its nucleotide sequence is as follows:

[0134]

CMV#207288; Cas9(D10A)#98974; BGH#181799

[0135]

[0136] pU6-sgRNA: Expresses sgRNA matching the target site under the control of the U6 promoter; its nucleotide sequence is as follows:

[0137] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGC

[0138] TGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTA

[0139] CAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTA

[0140] AAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTT

[0141] CGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC(SPACER)GT TTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGGACCGAGTCGGTCC。

[0142] petRNA-RT: Expresses petRNA containing RTT-PBS and RT fusion protein under the control of the U6 promoter. Its nucleotide sequence is as follows:

[0143]

U6#181802; ribozyme-arm-MS2#181802; arm-ribozyme#181802; CMV#207288; MCP#101160; RT#181799; puro#168805; BGH#181799

[0144]

[0145] All sgRNA sequences were bioinformatics-evaluated to ensure targeting specificity and minimize potential off-target sites. The RTT and PBS sequences were designed according to the target edits, taking into account the local sequence context and secondary structure prediction.

[0146] 3. Cell culture and transfection

[0147] HEK293T cells (ATCC CRL-3216) were cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin at 37 °C and 5% CO2; the cells were seeded in 24-well plates at a density of 5×10 5 cells / well and cultured for 16 - 24 hours until 60% confluence; three plasmids were co-transfected using Lipofectamine 3000 (Yeasen, NO.40802ES08): 500 ng pCMV-Cas9-D10A, 500 ng petRNA-RT, and 250 ng pU6-sgRNA; puromycin (1 μg / mL) was added 48 hours after transfection for screening for 5 days.

[0148] 4. Genomic DNA extraction and editing detection

[0149] Genomic DNA was extracted from cells using Genomic DNA Kit (Transgen, TEE101-01); the target region was PCR amplified using specific primers (2×Phanta Max Master Mix, Vazyme, P525-01); the editing effect was analyzed by Sanger sequencing (Hecegene, Wuhan); the TIDE (Tracking of Indels by Decomposition) algorithm (http: / / shinyapps.datacurators.nl / tide / ) was used to quantify the editing efficiency; some samples were subjected to high-throughput sequencing (Illumina platform) to analyze the editing precision and potential off-target effects.

[0150] 5. Results of editing efficiency detection

[0151] The comprehensive test results of the srPE system in HEK293T cells are as follows (see Figure 2 a - f):

[0152] (1) Editing coverage:

[0153] srPE achieved the expected editing at all six test sites; it was able to efficiently introduce various types of mutations, including insertions, deletions, and substitutions; the editing positions covered multiple regions upstream of the off-target strand cleavage site, verifying the directional breakthrough ability of srPE.

[0154] (2) Editing efficiency data:

[0155] The overall editing efficiency ranged from 9.36 - 40.31%.

[0156] Site-specific efficiency: EMX1: 12.30 ± 4.64% (deletion), 20.17 ± 3.42% (insertion); IDS: 26.03 ± 8.57% (insertion), 18.25 ± 1.01% (substitution); RUNX1: 14.28 ± 1.06% (deletion), 17.02 ± 2.79% (insertion); FANCF: 18.73 ± 3.80% (insertion), 20.67 ± 3.78% (deletion); FBN1: 12.04 ± 3.57% (substitution), 13.63 ± 2.71% (deletion); NPC2: 11.09 ± 4.89% (insertion), 14.98 ± 5.00% (deletion);

[0157] Editing type difference: The average efficiency of insertions (18.94 ± 6.42%) was slightly higher than that of mutations (17.26 ± 2.66%) and deletions (16.69 ± 4.87%).

[0158] (3) Editing precision analysis:

[0159] The ratio of expected editing to unexpected editing > 95:5, the occurrence rate of indels < 3%, and no significant off-target effect was detected around the editing sites (±50bp).

[0160] 6. Comparative analysis with traditional sPE

[0161] To directly evaluate the performance advantages of srPE over traditional sPE, the present invention conducted a parallel comparison of the same sites under the same experimental conditions (see Figure 2 g, Figure 3 and 4 ):

[0162] (1) Long-distance editing ability:

[0163] At three sites, EMX1, FANCF, and RUNX1, srPE successfully achieved editing upstream of the off-target strand cleavage site, while no obvious editing was observed for sPE at these sites. This demonstrated the key breakthrough of srPE in overcoming the directional limitation of traditional PE.

[0164] (2) Comparison of editing efficiency at the same distance:

[0165] At the IDS and FBN1 loci, although the editing distance is close to the cleavage site, sPE still does not produce obvious editing, while srPE shows efficient editing ability. This indicates that srPE not only expands the editing scope but also has an essential efficiency advantage at certain loci.

[0166] (3) Direct comparison under the same conditions:

[0167] Quantitative comparison at the NPC2 locus shows that for insertion and deletion editing, the efficiency of srPE is about 2 times that of sPE, and both Sanger sequencing peak maps and amplicon sequencing results confirm the significant advantage of srPE.

[0168] These results systematically demonstrate that srPE not only breaks through the direction limitation of traditional PE, enabling editing of the sequence upstream of the non-target strand cleavage site, but also shows significant efficiency advantages at multiple loci, providing an effective solution to the "blind spots" that are difficult to edit with traditional PE.

[0169] Example 3: Analysis of the universality and differences of srPE in multiple mammalian cell lines

[0170] To evaluate the broad applicability and cell type dependence of the srPE technology, systematic tests were conducted in three other human cell lines, which represent different tissue sources and biological characteristics:

[0171] 1. srPE editing performance in HeLa cells

[0172] (1) Experimental design and methods

[0173] HeLa cells (ATCC CCL-2): a human cervical cancer cell line representing epithelial-derived tumor cells; transfected using the same three-plasmid system as HEK293T; the editing efficiencies of loci such as EMX1, FANCF, FBN1, and NPC2 were tested; the performance of srPE was evaluated for different editing types (substitution, insertion, deletion); a parallel control group of sPE was set up for horizontal comparison.

[0174] (2) Analysis of editing efficiency and characteristics

[0175] The editing efficiency range of srPE in HeLa cells is 3.62 - 25.77%, and the average editing efficiency is 13.2% (see Figure 5 a - e).

[0176] Site-specific performance: EMX1 site: the average editing efficiency was 8.60 ± 3.70%; FANCF site: the average editing efficiency reached 8.92 ± 2.91%; IDS site: the average editing efficiency reached 18.35 ± 5.34%; FBN1 site: the average editing efficiency was 17.24 ± 3.95%; NPC2 site: the average editing efficiency was 8.59 ± 1.75%.

[0177] Comparison with traditional PE: The literature-reported average editing efficiency of traditional PE in HeLa cells was about 12%, indicating that srPE showed comparable or even better editing ability in cervical cancer cells.

[0178] Comparison with sPE: No obvious editing activity was observed for sPE at the five sites of EMX1, FANCF, IDS, FBN1, and NPC2 (see Figure 6 ), further confirming the advantages of srPE.

[0179] 2. srPE editing performance in K562 and HepG2 cells

[0180] (1) K562 cells (derived from the hematopoietic system)

[0181] Experimental materials: K562 cells (ATCC CCL-243), a human chronic myeloid leukemia cell line.

[0182] Transfection method: The nucleofection technique (Lonza Nucleofector 4D system, SF cell line kit) was used, with program FF-120.

[0183] Transfection combination: 500 ng of nCas9 (D10A) plasmid, 500 ng of petRNA-RT plasmid, and 250 ng of sgRNA plasmid.

[0184] Statistical analysis of editing efficiency:

[0185] The average editing efficiency was 5.9%, and the highest efficiency site (FANCF) reached 16.31% ( Figure 5 f) The editing position successfully covered the region upstream of the non-target strand cleavage site.

[0186] (2) HepG2 cells (derived from the liver)

[0187] Experimental materials: HepG2 cells (ATCC HB-8065), a human hepatocellular carcinoma cell line. The transfection and analysis methods were the same as those for HEK293T.

[0188] Statistical analysis of editing efficiency:

[0189] The editing efficiency ranged from 1.98 - 11.44%, and the average editing efficiency at the EMX1 locus was 5.99 ± 4.30%( Figure 5 g), although the overall efficiency was lower than that in HEK293T, it was still significantly higher than the traditional PE efficiency at the same locus reported in most literatures.

[0190] 3. Systematic analysis of cell type influence

[0191] Through systematic comparison of four cell lines from different sources, the present invention reveals the correlation between the srPE editing efficiency and cell characteristics:

[0192] Effect of cell doubling time: Cells with short doubling time (such as HEK293T, ~24 h) generally have higher srPE editing efficiency, while cells with long doubling time (such as HepG2, ~48 h) have relatively lower editing efficiency.

[0193] Difference in tissue origin: Epithelial-derived cells (HEK293T, HeLa) respond better to srPE than hematopoietic system (K562) and liver-derived (HepG2) cells.

[0194] Overall performance: Despite cell type dependence, srPE can achieve effective editing in all tested cell lines and maintain its breakthrough feature in editing direction.

[0195] Comparison with traditional PE: In multiple cell lines, srPE shows unique editing ability in the region upstream of the non-target strand cleavage site, filling the "editing blind spot" that cannot be covered by traditional PE.

[0196] These results indicate that srPE is a gene editing tool with wide applicability. Although affected by cell types, its unique advantage in editing direction is maintained in multiple cell lines, providing an important technological breakthrough in the field of gene therapy.

[0197] Example 4: Multi-dimensional engineering optimization and domain modification of the srPE system

[0198] For the basic srPE system, this example developed a series of engineering optimization strategies to systematically improve its editing performance, application range and operation convenience.

[0199] 1. Insertion design of the Cas9-D10A protein domain

[0200] Based on in-depth analysis of the protein structure-function relationship, an innovative Cas9 domain insertion strategy was designed:

[0201] The gp41-mediated membrane fusion mechanism: gp41 is the transmembrane component of the HIV-1 envelope glycoprotein, containing a fusion peptide (FP) region that promotes virus-cell membrane fusion, and its amino acid sequence is KNEQELLELDKWASL.

[0202] The GCN4-mediated dimerization: GCN4 is a yeast transcription factor containing a leucine zipper domain that promotes protein dimerization, and its amino acid sequence is EELLSKNYHLENEVARLKK.

[0203] Through AlphaFold structure prediction and molecular dynamics simulation, without affecting the core function of Cas9, the permissive sites ([ Figure 7 b, Figure 8 ) for inserting foreign domains were systematically identified:

[0204] The REC domain: Involved in DNA recognition but not directly in catalysis, including the amino acid sites 1, 203, 213, 308, 584 after the D10A mutation;

[0205] The RuvC domain: A key domain involved in DNA cleavage, including the amino acid sites after 1020, 1051, 1055;

[0206] The PI domain: The PAM recognition region, including the amino acid sites after 1246, 1252, 1260, 1368.

[0207] The above insertion sites are after the Xth amino acid of the Cas9(D10A) protein, where X is any one of 1, 203, 213, 308, 584, 1020, 1051, 1055, 1246, 1252, 1260, 1368.

[0208] The strategy of using a flexible polypeptide linker (GGGS)^n was adopted to connect the foreign domain with the Cas9 backbone, minimizing conformational interference, and the optimal linker length was screened by directed evolution.

[0209] 2. Construction and functional verification of structure-optimized variants

[0210] Structure prediction and stability analysis: Structure prediction of all D10A-gp41 / GCN4 variants was performed using AlphaFold, and the results showed that inserting the foreign domain did not significantly change the overall conformation of D10A (see Figure 9 ), and the prediction indicated that these variants might maintain normal functions.

[0211] Variant construction: 12 D10A variant plasmids were constructed, including 11 gp41 insertion sites and 1 GCN4 insertion site.

[0212] Taking the amino acid sequence of D10A inserted into GCN4 / gp41 (D10A-203gp41) as an example:

[0213] The RuvC domain is in bold, the REC domain is underlined, the BH domain is italicized, the HNH domain is boxed, the PI domain is bold and underlined, and gp41 is italicized and boxed:

[0214]

[0215]

[0216] Method for evaluating editing efficiency: Using a three-plasmid transfection system ( Figure 7 a), co-transfect each D10A mutant plasmid with sgRNA and petRNA-RT into HEK293T cells, and conduct a parallel comparison with the original nCas9 (D10A) to systematically evaluate the difference in editing efficiency.

[0217] 3. Editing performance of structure-optimized variants

[0218] The general situation of performance improvement is as follows (Table 3, Figure 7 c-h, Figure 10 ):

[0219] Table 3 Editing efficiency of optimized D10A variants in HEK293T cell line

[0220]

[0221]

[0222] D10A-203gp41: The editing efficiency is increased by 1.4 times at the IDS site and 1.5 times at the FBN1 site;

[0223] D10A-213gp41: It shows the best performance at the NPC2 site, with the editing efficiency increased by about 3 times, and an average increase of 1.3 times at other sites;

[0224] D10A-308gp41: The efficiency is increased by 1.3 times at the FBN1 site and 2.5 times at the NPC2 site;

[0225] D10A-1246gp41: The efficiency is increased by 1.4 times at the RUNX1 site;

[0226] D10A-1252gp41: The efficiency is increased by 1.3 times at the IDS site, and the overall performance is stable;

[0227] D10A-1368gp41: The most significant increase is at the NPC2 site, reaching 2.1 times;

[0228] D10A-1gp41: It performs excellently at three loci, RUNX1, FBN1, and NPC2, with an average improvement of 1.8 times.

[0229] Locus-specific response pattern: Different D10A variants exhibit differential editing enhancement effects at different gene loci. This locus correlation may be related to the following factors: chromatin openness of the target sequence, local DNA conformation and flexibility, transcriptional activity of the target region, GC content, and local sequence characteristics.

[0230] Optimal variant screening: Considering the performance at each locus, D10A-213gp41 and D10A-1gp41 show the best overall performance. Especially for loci that are difficult to edit with traditional PE, these variants provide a significant improvement in editing efficiency, offering an important tool for gene therapy of intractable genetic diseases.

[0231] 4. Systematic optimization of RTT and PBS lengths and modeling of quantitative relationships

[0232] RTT and PBS lengths are key parameters affecting the editing efficiency of srPE. Systematic optimization of these two key parameters has established a quantitative guidance model:

[0233] Experimental design for parameter optimization: Using the IDS locus as a model system, a series of combinations of RTT lengths (10 - 18 bp) and PBS lengths (9 - 17 bp) were designed to evaluate their effects on the editing efficiency of srPE (see Figure 11 a - d):

[0234] Fix the PBS length (13 bp) and vary the RTT length (10 - 18 bp)

[0235] Fix the RTT length (14 bp) and vary the PBS length (9 - 17 bp)

[0236] RTT - PBS length combination matrix to evaluate the synergistic effect.

[0237] Effect of RTT length (see Figure 11 a, c):

[0238] Optimal RTT length range: 12 - 14 bp. When RTT < 10 bp, the editing efficiency decreases significantly, possibly due to insufficient template information; when RTT > 18 bp, the editing efficiency also decreases significantly, possibly due to conformational obstacles in the reverse transcription complex; at the IDS locus, the peak efficiency (about 38%) is reached when RTT = 12 bp.

[0239] Effect of PBS length (see Figure 11 b, d):

[0240] Optimal PBS length range: 11 - 13 bp. When PBS < 9 bp, the editing efficiency drops sharply due to insufficient binding affinity; when PBS > 17 bp, the editing efficiency decreases significantly, possibly because the PBS - DNA hybrid is too stable, hindering subsequent steps; at the IDS site, the highest efficiency (about 35%) is achieved when PBS = 13 bp.

[0241] These optimization results not only reveal the key parameters affecting srPE efficiency and their mechanism of action, but also provide quantifiable guiding principles for the design of srPE systems at different sites, greatly improving the predictability and reliability of system applications.

[0242] Example 5: Verification of the application of srPE in clinically relevant disease models

[0243] To evaluate the potential of srPE in clinical applications, the present invention conducted systematic bioinformatics analysis and editing verification of key disease sites.

[0244] 1. Genome - wide pathogenic variant analysis based on ClinVar

[0245] Obtain the human pathogenic variant dataset from the NCBI ClinVar database (July 2024 version) and perform analysis using a bioinformatics pipeline:

[0246] Filter out pathogenic variants by allele ID and clinical significance, classify and count them by variant type (SNV, insertion, deletion, etc.), evaluate the theoretical editing feasibility for each variant site, predict the applicable ranges of traditional PE and srPE, and statistically analyze the results ( Figure 12 a - b):

[0247] The total number of clinically relevant variants potentially editable by srPE is approximately 2.17 million.

[0248] Variant type distribution: Transition mutations (C→T, G→A, A→G, T→C): 63.17%; Transversion mutations (C→A / G, G→C / T, A→C / T, T→A / G): 31.99%; Small insertions and deletions (≤10 bp): 4.84%.

[0249] Editing coverage comparison:

[0250] Variants that can only be edited by srPE are approximately 180,000 (7.11%), as shown in Table 4; variants that can only be edited by traditional PE are approximately 370,000 (14.73%); variants that can be edited by both techniques are approximately 1.99 million (78.16%).

[0251] Table 4 Distribution of clinically relevant mutation types uniquely editable by srPE in the ClinVar database

[0252]

[0253]

[0254] These data indicate that srPE not only significantly expands the coverage of gene editing, but more importantly, it provides the possibility of editing for approximately 180,000 pathogenic variants that could not be treated by PE technology before, which is of great significance in clinical translation.

[0255] 2. Editing verification of clinically critical pathogenic genes

[0256] To verify the editing feasibility of srPE at clinically relevant sites, the present invention selected two important disease-related genes for targeted editing:

[0257] (1) FBN1 gene (related to Marfan syndrome):

[0258] Background: FBN1 encodes fibrillin-1, and its mutations are associated with severe diseases such as Marfan syndrome, aortic dissection, and familial thoracic aortic aneurysm.

[0259] Editing strategy: Design an srPE system for the c.6030del mutation site of the FBN1 gene.

[0260] Result: Successfully introduced the target deletion ( Figure 12 c) in HEK293T cells, and the editing efficiency reached 1.2% ( Figure 12 d)

[0261] (2) MLH1 gene (related to hereditary non-polyposis colorectal cancer):

[0262] Background: MLH1 encodes a mismatch repair protein, and its mutations are associated with Lynch syndrome, hereditary non-polyposis colorectal cancer, etc.

[0263] Editing strategy: Design an srPE system for the c.2259del mutation site of the MLH1 gene.

[0264] Result: Successfully introduced a double-base deletion ( Figure 12 c) in HEK293T cells, and the editing efficiency was 5.3% ( Figure 12 d).

[0265] These results prove that srPE can efficiently introduce clinically relevant pathogenic mutations, providing a valuable cell model for the mechanism research and drug screening of related diseases. At the same time, this also lays a foundation for correcting these mutations and treating related genetic diseases using srPE technology in the future.

[0266] In summary, the Split Reverse Prime Editing (srPE) technology developed in this invention successfully breaks through the fundamental limitations of traditional Prime Editing by revolutionarily changing the editing direction. This breakthrough is achieved through the following core innovations:

[0267] Reverse selection of the cleavage strand: Using Cas9-D10A to cleave the targeted strand instead of the non-targeted strand cleavage in traditional PE, this simple yet crucial change fundamentally reshapes the editing accessibility;

[0268] Reconstruction of the DNA repair pathway: The special intermediate structure generated by srPE may activate a cell repair pathway different from traditional PE, improving the editing efficiency at certain sites;

[0269] Structural optimization for synergy: Through the strategic insertion of gp41 / GCN4, the stability of the Cas9-DNA complex and the cell delivery efficiency are enhanced, further improving the system performance;

[0270] Quantitative model with parameter optimization: A systematic method for optimizing the RTT-PBS length is established, providing predictable design principles and improving the applicability and reliability of the technology.

[0271] To further improve the performance and applicability of the srPE technology, the following future research directions are proposed in this invention: (1) Cell-specific optimization strategies: Develop optimized versions for different cell types, such as screening for more effective RT variants specific to certain cell types and combining epigenetic modification tools to improve the editing efficiency in difficult-to-transfect cells; (2) Innovation in delivery systems: Develop a co-delivery system based on non-viral vectors (such as lipid nanoparticles), explore direct delivery strategies for mRNA and proteins, reduce the integration risk, design a modular system for split delivery, and improve the delivery efficiency of large-capacity components; (3) Computational-aided design platform: Develop a machine learning-based RTT-PBS optimization algorithm to predict site-specific optimal parameters, establish an off-target prediction and evaluation system to improve editing specificity, and design an automated sgRNA screening process to maximize editing efficiency; (4) Expansion of clinical applications: Systematically verify genetic disease sites that are currently untreatable, develop tissue-specific expression systems to improve the targeting in in vivo applications, conduct animal model verification, and evaluate the in vivo editing efficiency and safety.

[0272] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A gene editing system, characterized in that, It includes a Cas9 nickase, an sgRNA, and a circular petRNA.

2. The gene editing system according to claim 1, wherein The Cas9 protein of the Cas9 nickase has a D10A mutation.

3. The gene editing system according to claim 2, wherein gp41 and / or GCN4 is inserted into the Cas9 nickase.

4. The gene editing system according to claim 3, wherein, The insertion site is in at least one of the REC domain, RuvC domain, and PI domain of the Cas9 nickase.

5. The gene editing system according to claim 4, wherein The insertion site is any of the following sites: i. Behind at least one of the amino acids at positions 1, 203, 213, 308, and 584 in the REC domain; ii. Behind at least one of the amino acids at positions 1020, 1051, and 1055 in the RuvC domain; iii. Behind at least one of the amino acids at positions 1246, 1252, 1260, and 1368 in the PI domain.

6. The gene editing system according to claim 1, wherein The sgRNA includes a target sequence recognition region of 20 - 25 nucleotides and a backbone region that binds to Cas9.

7. The gene editing system according to claim 1, wherein The circular petRNA includes an MS2 domain, a primer binding site, a reverse transcription template, and a ribozyme domain.

8. The gene editing system according to claim 7, wherein The length of the primer binding site is 9 - 17 bp; the length of the reverse transcription template is 10 - 18 bp. Preferably, the length of the primer binding site is 11 - 13 bp; the length of the reverse transcription template is 12 - 14 bp.

9. A Cas9 nickase, characterized in that, The Cas9 protein of the Cas9 nickase has a D10A mutation.

10. The Cas9 nickase according to claim 9, wherein gp41 and / or GCN4 is inserted into the Cas9 nickase.

11. The Cas9 nickase according to claim 10, wherein The insertion site is in at least one of the REC domain, RuvC domain, and PI domain of the Cas9 nickase.

12. The Cas9 nickase according to claim 11, wherein The insertion site is any of the following sites: i. Behind at least one of the amino acids at positions 1, 203, 213, 308, and 584 in the REC domain; ii. Behind at least one of the amino acids at positions 1020, 1051, and 1055 in the RuvC domain; iii. Behind at least one of the amino acids at positions 1246, 1252, 1260, and 1368 in the PI domain.

13. A nucleic acid encoding the Cas9 nickase according to any one of claims 9 - 13.

14. Use of the gene editing system according to any one of claims 1 - 8 in combination with a gene editing system that specifically cleaves the non - target strand in any of the following fields: i. Gene editing; ii. Preparation of cell delivery vectors; iii. Delivery of reagents into mitochondria; v. Construction of animal models for clinical diseases; vi. Preparation of drugs for the treatment and / or prevention of clinical genetic diseases.

15. The application according to claim 14, wherein The gene editing system that specifically cleaves the non - target strand includes at least one of CRISPR - Cas9, BE, and PE.

16. Use of the gene editing system according to any one of claims 1 - 8, the Cas9 nickase according to any one of claims 9 - 13, and the nucleic acid according to claim 13 in any of the following fields: i. Gene editing; ii. Preparation of cell delivery vectors; the cells include HEK293T, HeLa, K562, and HepG2; iii. Delivery of reagents into mitochondria; v. Construction of animal models of clinical diseases; vi. Preparation of drugs for treating and / or preventing clinical genetic diseases.

Citation Information

Cited By

  • Split-phase nicking enzyme mediated pilot editor and editing system and application of split-phase nicking enzyme mediated pilot editor

    CN122168603A

  • Phase-separating nicking enzyme-mediated prime editors and editing systems and applications thereof

    CN122168603B