Plutella xylostella fibroin light chain gene and application thereof

CRISPR/Cas9 technology induces mutation in the light chain gene of rhodopsia scattered protein synthesis, solves the drug resistance problem of rhodopsia scattered, and realizes high-efficiency pest control and the development of new insecticides.

CN120366318APending Publication Date: 2025-07-25NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510350836.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-24
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The chemical pesticides of diamondback moth in the prior art have led to increased drug resistance and lack effective green control technology. In particular, the functional study of the FibL gene of diamondback moth and the application of CRISPR/Cas9 gene editing technology in pest control have not been reported.

Method used

CRISPR/Cas9 gene editing technology was used to induce mutations in the light chain gene of rhodops, block the synthesis of rhodops, so that they do not form cocoons and turn into naked pupas. The rhodops in the light chain gene is used as the target gene for pest control, and a new insecticide target gene was developed.

Benefits of technology

CRISPR/Cas9 technology induces mutation of the light chain gene of rhodopsia syringe protein synthesis, leading to an increase in larval mortality, achieving green and efficient pest control, and providing a target gene for the research and development of new insecticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366318A_ABST
    Figure CN120366318A_ABST
Patent Text Reader

Abstract

The invention provides a plutella xylostella fibroin light chain gene, which has a nucleotide sequence as shown in SEQ ID NO: 1 and an amino acid sequence as shown in SEQ ID NO: 2. The invention further provides application, and the plutella xylostella fibroin light chain gene is used for preventing and treating plutella xylostella mediated by a CRISPR / Cas9 gene editing system and is used for developing a pesticide target gene. After the plutella xylostella fibroin light chain gene is used for inducing the mutation of a plutella xylostella target gene by using a CRISPR / Cas9 technology, the plutella xylostella is not cocooned into naked pupa, which indicates that the fibroin light chain gene plays a key role in the synthesis of fibroin of the plutella xylostella. The plutella xylostella silk fibroin light chain gene mutation is induced based on the CRISPR / Cas9 technology, the synthesis of the plutella xylostella silk protein is blocked, and meanwhile, the death rate of larvae is increased. The gene not only can be used for pest control mediated by a CRISPR / Cas9 gene editing system, but also can be used for research and development of a novel insecticide target gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of agricultural biotechnology, and particularly relates to a silk fibroin light chain gene of Plutella xylostella and its application. Background Art

[0002] Plutella xylostella belongs to the family Plutellidae of the order Lepidoptera, also known as the small green worm and the diamondback moth, and is the main pest of cruciferous vegetables in the world. Due to its small size, high reproductive capacity and strong adaptability, it seriously endangers the safety of cruciferous vegetables, causing economic losses of 4-5 billion US dollars worldwide every year. At the same time, the widespread use of chemical insecticides has led to a significant increase in the insecticide resistance of this pest. Therefore, it is particularly important to develop new green control technologies to fundamentally solve the damage caused by the pest Plutella xylostella.

[0003] CRISPR-Cas9 (Clustered regularly interspaced short palindromic repeats and the CRISPR-associated gene Cas9) is collectively called the clustered regularly interspaced short palindromic sequence and the CRISPR-associated gene Cas9, and is a revolutionary gene editing technology. It originates from the natural immune systems of bacteria and archaea and is used to resist the invasion of foreign viruses and plasmids. The CRISPR / Cas9 gene editing technology forms a sgRNA (single guide RNA) with precise guiding function after the combination of crRNA (CRISPR-derived RNA) and tracrRNA (trans-activating crRNA). Under the guidance of the sgRNA, the Cas9 nuclease is guided to a specific target gene position to cut the target DNA double strand, forming a DNA double-strand break (DSB). During repair, the broken DNA ends may be directly ligated, but this process is often accompanied by the insertion, deletion or substitution of bases, resulting in changes in the gene sequence and achieving the purpose of site-directed knockout of a certain gene.

[0004] Silk plays a crucial role in the growth and development processes of many insects, such as cocoon spinning, migration, nest building, sheltering, predation, and egg fixation. When encountering danger, the diamondback moth can not only use silk to hang down and escape, but also has developed a life history strategy in the long-term evolution process that adult moths use the silk spun by larvae to overcome the wax barrier of host plants to complete egg laying. Silk fibroin is composed of FibH (silk fibroin heavy chain), FibL (silk fibroin light chain), and P25 (fibrohexamerin), and is an important component of the silk of the diamondback moth. FibL plays an important role in the diamondback moth and is closely related to physiological processes such as silk synthesis and growth and development. However, the current research on the function of the FibL gene in the diamondback moth is still blank, especially the FibL mutant strain constructed based on the CRISPR / Cas9 gene editing technology and its application in pest control have not been reported. Elucidating the regulatory mechanism of FibL in silk spinning behavior and its application value will provide new ideas for green and efficient pest control technologies, contribute to the precise control of the diamondback moth, and have important scientific significance and application prospects. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a diamondback moth silk fibroin light chain gene and its application in view of the deficiencies of the above-mentioned prior art. After the diamondback moth silk fibroin light chain gene is used to induce target gene mutation in the diamondback moth by CRISPR / Cas9, the diamondback moth does not spin cocoons and turns into naked pupae, indicating that the silk fibroin light chain gene plays a key role in the silk protein synthesis of the diamondback moth. The present invention induces mutations in the silk fibroin light chain gene of the diamondback moth based on CRISPR / Cas, blocking the silk protein synthesis of the diamondback moth, and at the same time increasing the larval mortality rate. This gene can not only be used for pest control mediated by the CRISPR / Cas9 gene editing system, but also for the research and development of new insecticide target genes.

[0006] To solve the above technical problems, the technical solution adopted by the present invention is: a diamondback moth silk fibroin light chain gene, the nucleotide sequence of the diamondback moth silk fibroin light chain gene is as shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the diamondback moth silk fibroin light chain gene is as shown in SEQ ID NO: 2.

[0007] The present invention also provides the application of the above-mentioned diamondback moth silk fibroin light chain gene. The diamondback moth silk fibroin light chain gene is used for the control of the diamondback moth mediated by the CRISPR / Cas9 gene editing system and for the development of insecticide target genes.

[0008] Preferably, the diamondback moth silk fibroin light chain gene is used to regulate the silk protein synthesis of the diamondback moth and to regulate the silk spinning behavior of the diamondback moth.

[0009] Preferably, the Plutella xylostella fibroin light chain gene is used as a target for controlling Plutella xylostella. The gene mutation of the Plutella xylostella fibroin light chain gene is used to block the growth and development of Plutella xylostella, and Plutella xylostella forms a naked pupa phenotype.

[0010] Preferably, the CRISPR / Cas9 gene editing system of the Plutella xylostella fibroin light chain gene is used in the application of obtaining the mutant type of the Plutella xylostella fibroin light chain gene.

[0011] The synthetic primers for the sgRNA target site of the Plutella xylostella fibroin light chain gene are as follows:

[0012] The nucleotide sequence of sgRNA-F is as shown in SEQ ID NO: 3;

[0013] The nucleotide sequence of sgRNA-R is as shown in SEQ ID NO: 4;

[0014] In the above CRISPR / Cas9 gene editing system of the Plutella xylostella fibroin light chain gene, the mutant detection primers for the Plutella xylostella fibroin light chain gene are as follows:

[0015] The nucleotide sequence of FibL-F is as shown in SEQ ID NO: 5;

[0016] The nucleotide sequence of FibL-R is as shown in SEQ ID NO: 6.

[0017] Preferably, the method for obtaining the mutant type of the Plutella xylostella fibroin light chain gene is as follows:

[0018] S1. Synthesis of sgRNA deoxynucleotide template:

[0019] Use Es Taq MasterMix polymerase to perform a template-free PCR reaction on the PCR reaction system. After purification, the sgRNA deoxynucleotide template is obtained;

[0020] The system of the PCR reaction is as follows: 2 μL of sgRNA-F with a concentration of 10 μM, 2 μL of sgRNA-R with a concentration of 10 μM, 24 μL of 2×Es Taq MasterMix, and ddH2O is added to make up to 50 μL;

[0021] The conditions of the PCR reaction are as follows: 94°C for 2 min; 94°C for 30 s, 60°C for 30 s, 72°C for 10 s, 34 cycles; 72°C for 10 min; store at 4°C;

[0022] The nucleotide sequence of the sgRNA-F is as shown in SEQ ID NO: 3;

[0023] The nucleotide sequence of the sgRNA-R is as shown in SEQ ID NO: 4;

[0024] S2. In vitro reverse transcribe the sgRNA deoxynucleotide template obtained in S1 to synthesize sgRNA;

[0025] The reaction system for reverse transcription is: 0.5 μL of TranscriptAid Enzyme Mix, 1 μL of 5×TranscriptAid Reaction Buffer, 0.5 μL of 10 mM ATP, 0.5 μL of 10 mM CTP, 0.5 μL of 10 mM GTP, 0.5 μL of 10 mM UTP, 300 ng of the sgRNA deoxynucleotide template obtained in S1, and nuclease-free water is added to make up to 5 μL;

[0026] S3. Mix the sgRNA obtained in S2 and Cas9 protein to obtain an sgRNA / Cas9 mixture;

[0027] S4. Microinject the sgRNA / Cas9 mixture obtained in S3 into Plutella xylostella eggs. The injected eggs that successfully hatch and develop into adults are defined as the G0 generation;

[0028] After the G0 generation individuals obtained in S4 emerge, take the hind wings of the adults to extract gDNA, perform PCR amplification with the forward primer FibL-F and the reverse primer FibL-R to obtain a PCR reaction product, and perform sequencing detection. The results show that there are expected random base deletions in the target region, and gene mutations are successfully detected to obtain G0 mutant adults;

[0029] The nucleotide sequence of the forward primer FibL-F is as shown in SEQ ID NO: 5;

[0030] The nucleotide sequence of the reverse primer FibL-R is as shown in SEQ ID NO: 6;

[0031] S6. Mate the G0 mutant adults obtained in S5 with wild-type adults one by one to obtain heterozygous G1 generation mutants. The heterozygous G1 generation mutants are mated with each other to obtain stably inherited and surviving homozygous G2 mutants. The homozygous G2 mutants are mated with each other to produce G3 homozygous mutants, which are the mutant types of the fibroin light chain gene of Plutella xylostella.

[0032] Preferably, the final concentrations of sgRNA and Cas9 protein in the sgRNA / Cas9 mixture in S3 are both 500 ng / μL.

[0033] For the mutation of the target gene of Plutella xylostella, the results showed that after the CRISPR / Cas9-induced mutation of the target gene, Plutella xylostella did not spin cocoons and turned into naked pupae, indicating that the fibroin light chain gene plays a key role in the silk protein synthesis of Plutella xylostella. Based on the CRISPR / Cas9 technology, the present invention induced the mutation of the fibroin light chain gene of Plutella xylostella, blocked the silk protein synthesis of Plutella xylostella, and at the same time increased the larval mortality rate. This gene can not only be used for pest control mediated by the CRISPR / Cas9 gene editing system, but also for the research and development of target genes of new insecticides.

[0034] The present invention has the following advantages compared with the prior art:

[0035] After the fibroin light chain gene of Plutella xylostella of the present invention is used for CRISPR / Cas9-induced mutation of the target gene of Plutella xylostella, Plutella xylostella does not spin cocoons and turns into naked pupae, indicating that the fibroin light chain gene plays a key role in the silk protein synthesis of Plutella xylostella. Based on the CRISPR / Cas9 technology, the present invention induced the mutation of the fibroin light chain gene of Plutella xylostella, blocked the silk protein synthesis of Plutella xylostella, and at the same time increased the larval mortality rate. This gene can not only be used for pest control mediated by the CRISPR / Cas9 gene editing system, but also for the research and development of target genes of new insecticides.

[0036] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Description of the Drawings

[0037] Figure 1 It is the design diagram of sgRNA and the mutation type of the fibroin light chain gene of Plutella xylostella in Example 1 of the present invention.

[0038] Note: Figure 1 In A, the genomic structure of the FibL gene of Plutella xylostella is marked, and the sgRNA (sgRNA targaetsequence) is designed in the second exon (Extron) region of the FibL gene. The sequence within the dotted line represents the sgRNA target sequence;

[0039] Figure 1 In B, the black box is the genotype of the finally obtained homozygous mutant individual, the underlined sequence is the sgRNA target sequence, and the wavy line-marked sequence is the PAM sequence.

[0040] Figure 2 It is the naked pupa phenotype of the Plutella xylostella mutant in Example 1 of the present invention.

[0041] Figure 3 It is the larval mortality rate of the Plutella xylostella mutant in Example 1 of the present invention.

[0042] Figure 4 It is the pupation position of the Plutella xylostella mutant in Example 1 of the present invention. Detailed Embodiments

[0043] Example 1

[0044] The Plutella xylostella fibroin light chain gene (FibL) of this example, the nucleotide sequence of the Plutella xylostella fibroin light chain gene is shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the Plutella xylostella fibroin light chain gene is shown in SEQ ID NO: 2.

[0045] This example also provides the application of the above Plutella xylostella fibroin light chain gene. The Plutella xylostella fibroin light chain gene is used for the control of Plutella xylostella mediated by the CRISPR / Cas9 gene editing system and for the development of insecticide target genes.

[0046] The Plutella xylostella fibroin light chain gene is used to regulate the synthesis of silk protein in Plutella xylostella and to regulate the silk spinning behavior of Plutella xylostella.

[0047] The Plutella xylostella fibroin light chain gene serves as a target for controlling Plutella xylostella. The gene mutation of the Plutella xylostella fibroin light chain gene is used to block the growth and development of Plutella xylostella, and Plutella xylostella forms a naked pupa phenotype.

[0048] The application of the CRISPR / Cas9 gene editing system of the Plutella xylostella fibroin light chain gene in obtaining the mutant type of the Plutella xylostella fibroin light chain gene.

[0049] Effect of the Plutella xylostella fibroin light chain gene on silk protein synthesis

[0050] (1) sgRNA target design

[0051] Based on the 5'-NGG-3' principle, an sgRNA target sequence was manually designed in the second exon of the Plutella xylostella fibroin light chain gene (to facilitate the in vitro transcription of sgRNA under the T7 promoter, we changed the two "NN" at the 5' end of sgRNA to "GG") ( Figure 1 A); the T7 promoter sequence (underlined) was added before the F primer target sequence, and 22 bp (gttttagagctagaaatagcaa) complementary to the R primer was added after the target sequence; the R primer was the sgRNA scafold universal sequence (Table 1).

[0052] Table 1 Synthetic primers for the sgRNA target site of the Plutella xylostella fibroin light chain gene

[0053]

[0054] The primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd.

[0055] (2) Synthesis of sgRNA deoxynucleotide template

[0056] ① Synthesis of sgRNA deoxynucleotide template: Using the Es Taq MasterMix polymerase from ComWin Biotech Co., Ltd., perform a template-free PCR reaction in a 50 μL system, specifically (10 μM sgRNA-F 2 μL; 10 μM sgRNA-R 2 μL; Es Taq MasterMix (2×) 24 μL; ddH2O 22 μL), and the primers are shown in Table 1.

[0057] ② PCR reaction conditions are: 94 °C for 2 min; 34 cycles (94 °C for 30 s, 60 °C for 30 s, 72 °C for 10 s); 72 °C for 10 min; store at 4 °C.

[0058] ③ Use the gel extraction kit from Thermo Fisher Scientific Inc. in the United States to purify the above PCR product according to the instructions to obtain the sgRNA deoxynucleotide template, and store it at 4 °C.

[0059] (3) In vitro reverse transcription of the sgRNA deoxynucleotide strand (i.e., sgRNA deoxynucleotide template) obtained in step (2) to synthesize the sgRNA nucleotide sequence (i.e., sgRNA).

[0060] ① In vitro transcription of sgRNA: Use the TranscriptAid T7 High Yield Transcription kit from Thermo Fisher Scientific to perform in vitro reverse transcription on the sgRNA deoxynucleotide template, and add the corresponding reagents according to Table 2:

[0061] Table 2 Reaction system for reverse transcription

[0062] Reagent System TranscriptAid Enzyme Mix 0.5 μL 5× TranscriptAid Reaction Buffer 1 μL 10 mM ATP 0.5 μL 10 mM CTP 0.5 μL 10 mM GTP 0.5 μL 10 mM UTP 0.5 μL Template (sgRNA deoxynucleotide template) 300 ng Nuclease-free Water Make up to 5 μL

[0063] Gently mix the reaction reagents and incubate at 37 °C for 4 h.

[0064] ② Add 0.5 μL of Dnase I, mix well, and incubate at 37 °C for 30 min to remove the DNA template.

[0065] ③ Add 3 μL of sodium acetate and 25 μL of water, then add 100 μL of 95% ethanol (4 °C), and mix well.

[0066] ④ Incubate on ice for 5 min, centrifuge at 16000 g at 4 °C for 10 min, and discard the supernatant.

[0067] ⑤ Add 500 μL of 75% ethanol (-20 °C), mix well and place in a -20 °C refrigerator for 30 min.

[0068] ⑥ Centrifuge at 16000 g at 4 °C for 10 min and discard the supernatant.

[0069] ⑦ Centrifuge again for 1 min, aspirate the alcohol as much as possible, and air dry at room temperature for 3 min.

[0070] ⑧ Add 10 μL of enzyme-free and sterile water, pipette and mix well.

[0071] ⑨ Centrifuge again, remove the precipitate, retain the supernatant, and store at -80 °C.

[0072] (4) Microinjection of Plutella xylostella eggs

[0073] ① Collect the pupae of Plutella xylostella 3 days in advance and place them in a cage. After eclosion, allow them to mate freely to reach the peak of egg-laying. Create a dark environment during egg-laying, and maintain the temperature in the insect rearing room at 26 °C.

[0074] ② Before microinjection, mix the sgRNA obtained in step (3) with Cas9 protein to prepare an sgRNA / Cas9 mixture. The initial concentrations of sgRNA and Cas9 protein are 1000 ng / μL, so that the final concentrations of sgRNA and Cas9 are both 500 ng / μL.

[0075] ③ Place fresh leaves in the cage, collect the eggs of Plutella xylostella laid within 1 h in the dark environment, gently pick them off and stick them on a glass slide with double-sided tape, and use the PV820 injection system of World Precision Instrument Company, USA for microinjection. Try to make the wound as small as possible during injection to minimize the damage.

[0076] ④ Place the eggs in a petri dish for moisturizing culture, with a culture temperature of 26 °C and a photoperiod of 14L / 10D.

[0077] ⑤ After injection, wait for the larvae to hatch, and transfer the newly hatched larvae to fresh Chinese kale leaves to ensure sufficient food for the larvae.

[0078] ⑥ After pupation, place the pupae separately in a 1.5 mL centrifuge tube with small holes punched in the lid.

[0079] (5) Strain purification and phenotype observation

[0080] ① The injected eggs that successfully hatch and develop into adults are defined as the zero generation (G0). After the G0 individuals eclose, take the hind wings of the adults to extract gDNA, and use specific primers (forward primer FibL-F; reverse primer FibL-R) for PCR reaction amplification and sequencing detection. The gDNA extraction uses the Blood / Cell / Tissue Genomic DNA Extraction Kit (DP304) of Tiangen Biochemical Technology Co., Ltd.; the PCR amplification uses the 2×Es Taq MasterMix (Dye) premixed enzyme (CW0690H) of ComWin Biotech Co., Ltd. The gDNA extraction and PCR amplification are both operated according to the kit instructions.

[0081] Forward primer FibL-F: 5’TGACTAGATTGTGGGATGTTCGA3’ (SEQ ID NO: 5);

[0082] Reverse primer FibL-R: 5’AAGTCGTGTCCGATGTCCGT3’ (SEQ ID NO: 6);

[0083] In the G0 generation, the expected base deletions existed in the target region. These deletions were random and might include deletions of different lengths. When gene mutations were successfully detected, it was the G0 mutant adults.

[0084] The base deletions detected in the G0 individuals were random and might delete 3 bases, 11 bases or deletions of other lengths. This randomness was due to the random insertions or deletions (indels) introduced by the repair mechanism after the CRISPR / Cas9 system caused DNA double-strand breaks in the target region.

[0085] Therefore, the expected base deletions in this experiment were not of a specific length, but mutants that could be stably inherited and survived were finally obtained through generations of screening (and the base deletions of the finally screened homozygotes could not be multiples of 3).

[0086] The specific deletion in this example refers to the mutants (G2 and G3 generations) finally detected and screened, and the number of deleted bases is 10bp.

[0087] ② The G1 generation was produced by single-pair mating of G0 mutant adults and wild-type adults. Heterozygous G1 mutant adults mated with each other to produce homozygous G2 mutants (deleting 10bp) that could be stably inherited and survived. Homozygous G2 mutants mated with each other to produce G3 homozygous mutant offspring (deleting 10bp). As Figure 1 shown in B, the sequences in the black boxes are homozygous mutant sequences.

[0088] ③ After the mutants became homozygous, the cocoons after the 4th instar mature larvae pupated were observed, and their morphological differences from the wild type were compared. The results showed that compared with the control, after the fibroin light chain gene (FibL) of Plutella xylostella was mutated, the larvae could not spin cocoons and formed naked pupae ( Figure 2 ). The results showed that after the CRISPR / Cas9-induced target gene mutation, Plutella xylostella formed a naked pupa phenotype, indicating that the fibroin light chain gene played a key role in the silk protein synthesis of Plutella xylostella and was used to regulate the silk-spinning behavior of Plutella xylostella.

[0089] (6) Biological characteristics of Plutella xylostella mutants

[0090] ①Newly hatched first-instar mutant larvae were individually placed in 5-cm diameter petri dishes containing agar medium, with fresh leaves as food. Wild-type larvae were fed under the same conditions as a parallel control group, and the larval mortality was recorded daily until pupation. Each treatment group was replicated 4 times, with 50 larvae in each replication.

[0091] ②To simulate the adaptability of the Plutella xylostella mutant in the natural environment, 20 third-instar mutant larvae were placed on healthy Chinese kale plants about 8 weeks old. The Chinese kale plants were placed in plastic containers with a diameter of 15 cm and a height of 30 cm to prevent the larvae from escaping. The change in the pupation position of the mutants was observed, and each treatment group was replicated 4 times.

[0092] ③The results showed that compared with the wild-type population (15.0%), the larval mortality of the homozygous mutant population of the fibroin light chain gene was 73.5%, and there was a significant difference between the two ( Figure 3 ). In addition, compared with the control (2.9%), since the mutants could not spin cocoons on the living plants, they would fall to the ground after pupation, accounting for 78.3% of the total number of pupae ( Figure 4 ).

[0093] In summary, through the CRISPR / Cas9 technology, the present invention verified in Plutella xylostella that the fibroin light chain gene can be used as a target for controlling Plutella xylostella, and its gene mutation can cause serious impacts on the growth and development of Plutella xylostella.

[0094] The above are only the preferred embodiments of the present invention and do not impose any limitations on the present invention. Any simple modifications, changes, and equivalent variations made to the above embodiments according to the technical essence of the invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. A Plutella xylostella fibroin light chain gene, characterized in that, The nucleotide sequence of the diamondback moth fibroin light chain gene is shown as SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the diamondback moth fibroin light chain gene is shown as SEQ ID NO:

2.

2. Use of the diamondback moth fibroin light chain gene as described in claim 1, characterized in that, The diamondback moth fibroin light chain gene is used for the control of diamondback moths mediated by the CRISPR / Cas9 gene editing system and for the development of insecticide target genes.

3. The application according to claim 2, wherein The diamondback moth fibroin light chain gene is used to regulate the synthesis of diamondback moth silk protein and to regulate the silk-spinning behavior of diamondback moths.

4. The application according to claim 2, characterized in that, The diamondback moth fibroin light chain gene serves as a target for controlling diamondback moths. The gene mutation of the diamondback moth fibroin light chain gene is used to block the growth and development of diamondback moths, resulting in the formation of a naked pupa phenotype in diamondback moths.

5. The application according to claim 2, wherein Application of the CRISPR / Cas9 gene editing system of the diamondback moth fibroin light chain gene in obtaining a mutant of the diamondback moth fibroin light chain gene.

6. The application according to claim 5, characterized in that, The method for obtaining the mutant of the diamondback moth fibroin light chain gene is as follows: S1. Synthesis of the sgRNA deoxynucleotide template: Perform a template-free PCR reaction on the PCR reaction system using Es Taq MasterMix polymerase. After purification, obtain the sgRNA deoxynucleotide template; The system of the PCR reaction is: 2 μL of sgRNA-F with a concentration of 10 μM, 2 μL of sgRNA-R with a concentration of 10 μM, 24 μL of 2×EsTaq MasterMix, and ddH2O is added to make up to 50 μL; The conditions of the PCR reaction are: 94°C for 2 min; 94°C for 30 s, 60°C for 30 s, 72°C for 10 s, 34 cycles; 72°C for 10 min; store at 4°C; The nucleotide sequence of the sgRNA-F is shown as SEQ ID NO: 3; The nucleotide sequence of the sgRNA-R is shown as SEQ ID NO: 4; S2. In vitro reverse transcription of the sgRNA deoxynucleotide template obtained in S1 to synthesize sgRNA; The reaction system for reverse transcription is: 0.5 μL of TranscriptAid Enzyme Mix, 1 μL of 5×TranscriptAid Reaction Buffer, 0.5 μL of 10 mM ATP, 0.5 μL of 10 mM CTP, 0.5 μL of 10 mM GTP, 0.5 μL of 10 mM UTP, 300 ng of the sgRNA deoxynucleotide template obtained in S1, and nuclease-free water is added to make up to 5 μL; S3. Mix the sgRNA obtained in S2 and Cas9 protein to obtain the sgRNA / Cas9 mixture; S4. Microinject the sgRNA / Cas9 mixture obtained in S3 into diamondback moth eggs. The injected eggs that successfully hatch and develop into adults are defined as the G0 generation; After the G0 generation individuals obtained in S4 emerge, take the hind wings of the adults to extract gDNA, perform a PCR reaction amplification using the forward primer FibL-F and the reverse primer FibL-R to obtain the PCR reaction product, conduct sequencing detection. If there are expected random base deletions in the target region, the gene mutation is successfully detected, and G0 mutant adults are obtained. The nucleotide sequence of the forward primer FibL-F is shown in SEQ ID NO: 5; The nucleotide sequence of the reverse primer FibL-R is shown in SEQ ID NO: 6; S6. The G0 mutant adults obtained in S5 are mated with wild-type adults one by one to obtain heterozygous G1 mutant individuals. The heterozygous G1 mutant individuals are mated with each other to obtain homozygous G2 mutants. The homozygous G2 mutants are mated with each other to produce G3 homozygous mutants, which are the mutant types of the fibroin light chain gene of Plutella xylostella.

7. The application according to claim 6, characterized in that, In S3, the final concentrations of sgRNA and Cas9 protein in the sgRNA / Cas9 mixture are both 500 ng / μL.