DsRNA (double-stranded ribonucleic acid) of locusta migratoria ribosome large subunit protein genes RPL7 and RPL44 and application of dsRNA

Abstract

The invention relates to dsRNA of miscellaneous migratory locust ribosome large subunit protein genes RPL7 and RPL44 and application of the dsRNA, the dsRNA for synthesizing the miscellaneous migratory locust ribosome large subunit protein genes RPL7 and RPL44 is injected into miscellaneous migratory locust, the RPL7 and RPL44 genes of the miscellaneous migratory locust can be specifically silenced, and the miscellaneous migratory locust can be inhibited from feeding, so that the miscellaneous migratory locust loses nutrition supply and is abnormal in growth and development, and then individual death is caused; the method achieves the purpose of biological prevention and control, has the advantages of specificity, high efficiency and environmental protection on pest prevention and control, is a novel green and pollution-free locust prevention and control technology, and shows a huge application prospect on locust prevention and control.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology, and particularly relates to dsRNAs of ribosomal large subunit protein genes RPL7 and RPL44 of gregarious locusts and their applications. Background Art

[0002] Locust disasters are one of the three major natural disasters in human history, posing a serious threat to agriculture, animal husbandry, the environment and the economy. Long-term application of chemical pesticides for locust control has led to a series of problems such as pesticide residues, environmental pollution, drug resistance of locusts, and food safety. Many problems of chemical control technologies have forced people to seek the development of new pest control methods. Double-stranded RNA (dsRNA) stands out because it can specifically control target pests, has no killing effect on non-target organisms, is environmentally friendly, does not pollute the environment, and has a quick effect. After entering the organism, dsRNA will be decomposed into short double-stranded RNAs of about 21 bp, which can efficiently and specifically block the expression of target genes in the species, thereby achieving the purpose of silencing target genes. Therefore, RNAi is an ideal pest species-specific control system.

[0003] Gregarious locusts have abundant 60S large subunits and polyribosomes. RPL7 and RPL44 are components of the ribosomal large subunit, mainly participating in the stability and function of ribosome structure. The high translation efficiency of the cytoplasmic ribosomal protein gene RPL7 in gregarious locusts promotes the accumulation of ribosomal 60S large subunits and shows typical gregarious behaviors. Summary of the Invention

[0004] The purpose of the present invention is to provide dsRNAs of ribosomal large subunit protein genes RPL7 and RPL44 of gregarious locusts and their applications. These genes can be used to inhibit locust feeding, cause them to lose nutritional supply, have abnormal growth and development, weakened mobility, and then lead to individual death, providing new ideas for solving the problem of locust control;

[0005] To achieve the above purpose, the technical solution adopted by the present invention is:

[0006] The present invention provides a ribosomal large subunit RPL7 protein gene fragment of gregarious locusts, and the nucleotide sequence of the ribosomal large subunit RPL7 protein gene fragment of gregarious locusts is SEQ ID NO: 1.

[0007] The present invention provides a ribosomal large subunit RPL44 protein gene fragment of gregarious locusts, and the nucleotide sequence of the ribosomal large subunit RPL44 protein gene fragment of gregarious locusts is SEQ ID NO: 2.

[0008] The present invention also provides a method for synthesizing the gene fragment of the large ribosomal subunit RPL7 protein of gregarious locusts, comprising the following steps: Using the cDNA reverse-transcribed from the total RNA extracted from gregarious locusts as a template, and performing PCR amplification with the upstream primer with the sequence of SEQ ID NO: 3 and the downstream primer with the sequence of SEQ ID NO: 4 to obtain the RPL7 gene fragment of gregarious locusts.

[0009] The present invention also provides a method for synthesizing the gene fragment of the large ribosomal subunit RPL44 protein of gregarious locusts, comprising the following steps: Using the cDNA reverse-transcribed from the total RNA extracted from gregarious locusts as a template, and performing PCR amplification with the upstream primer with the sequence of SEQ ID NO: 5 and the downstream primer with the sequence of SEQ ID NO: 6 to obtain the RPL44 gene fragment of gregarious locusts.

[0010] The present invention also provides the dsRNA synthesized from the gene fragment of the large ribosomal subunit RPL7 protein of gregarious locusts. Among them, the template for synthesizing the sense strand of dsRNA is synthesized with an upstream primer containing the T7 promoter and a downstream primer without the T7 promoter, and the template for synthesizing the antisense strand of dsRNA is synthesized with an upstream primer without the T7 promoter and a downstream primer containing the T7 promoter. Subsequently, the templates of the sense strand and the antisense strand are respectively added to the T7 in vitro transcription reaction system to synthesize dsRNA.

[0011] The present invention also provides the dsRNA synthesized from the gene fragment of the large ribosomal subunit RPL44 protein of gregarious locusts. Among them, the template for synthesizing the sense strand of dsRNA is synthesized with an upstream primer containing the T7 promoter and a downstream primer without the T7 promoter, and the template for synthesizing the antisense strand of dsRNA is synthesized with an upstream primer without the T7 promoter and a downstream primer containing the T7 promoter. Subsequently, the templates of the sense strand and the antisense strand are respectively added to the T7 in vitro transcription reaction system to synthesize dsRNA.

[0012] The present invention also provides the application of the dsRNA synthesized from the gene fragment of the large ribosomal subunit RPL7 protein of gregarious locusts in the control of locusts.

[0013] The present invention also provides the application of the dsRNA synthesized from the gene fragment of the large ribosomal subunit RPL7 protein of gregarious locusts in the preparation of a reagent for inhibiting locust feeding.

[0014] The present invention also provides the application of the dsRNA synthesized from the gene fragment of the large ribosomal subunit RPL44 protein of gregarious locusts in the control of locusts.

[0015] The present invention also provides the application of dsRNA synthesized from the ribosomal large subunit RPL44 protein gene fragment of gregarious locusts as described above in the preparation of a reagent for inhibiting locust feeding.

[0016] The dsRNA of locust RPL7 and RPL44 genes provided by the present invention can inhibit locust feeding, cut off their nutrient supply, cause abnormal growth and development, and then lead to individual death. It has the advantages of specificity, high efficiency and environmental protection in pest control, and is a new type of green and pollution-free locust prevention and control technology, showing great application prospects for locust prevention and control.

[0017] After the silencing of RPL7 and RPL44 genes, the feeding amount of gregarious locusts will be significantly reduced. Therefore, the present invention uses RNA interference technology, and the dsRNA molecular targets for RPL7 and RPL44 genes are relatively safe and play an important role in pest control. Description of the Drawings

[0018] Figure 1 : Real-time fluorescence quantitative detection of the interference efficiency of dsRPL7. The P value was calculated using t-test, **P < 0.01.

[0019] Figure 2 : Real-time fluorescence quantitative detection of the interference efficiency of dsRPL44. The P value was calculated using t-test, **P < 0.01.

[0020] Figure 3 : Feeding situation of locusts after interfering with the expression of RPL7 gene. The left figure shows the comparison of the remaining amount of wheat seedlings after 10 hours of free feeding. The right figure shows the comparison of the feeding amount after 1 minute of free feeding after 16 hours of starvation treatment. *P < 0.05 (t-test).

[0021] Figure 4 : Feeding situation of locusts after interfering with the expression of RPL44 gene. The left figure shows the comparison of the remaining amount of wheat seedlings after 12 hours and 36 hours of free feeding. The right figure shows the comparison of the feeding amount after 1 minute of free feeding after 8 hours and 16 hours of starvation treatment. *P < 0.05 (t-test).

[0022] Figure 5 : Effects of RPL44 gene interference on the survival rate and instar development of fourth-instar locusts. (A) Survival rate statistics of the control group (dsGFP) and the experimental group (dsRPL44). (B) Statistics of the proportion of locusts that successfully developed to the fifth instar in the control group (dsGFP) and the experimental group (dsRPL44). Three biological replicates were counted, and each biological replicate included 20 fourth-instar nymphs, *P < 0.05 (t-test).

[0023] Figure 6: Statistical analysis of the death status of locusts with RPL44 gene interference. The left side of the picture is the control group, and the right side is the experimental group. The first row is female insects (above, ♀), and the second row is male insects (below, ♂). Detailed implementation manner

[0024] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0025] Example 1: Obtaining the gene sequences of RPL7 and RPL44 in locusts

[0026] Based on the locust transcriptome database, the RPL7 and RPL44 genes in locusts were searched by bioinformatics methods. After sequence analysis and alignment, the RPL7 and RPL44 gene sequences were obtained.

[0027] Specific primers were designed using Primer Premier 5.0 software. The upstream and downstream primer sequences of the RPL7 gene are RPL7-T7F and RPL7-T7R respectively. RPL7-T7F and RPL7-T7R are SEQ ID NO: 3 and SEQ ID NO: 4 respectively. The upstream and downstream primer sequences of the RPL44 gene are RPL44-T7F and RPL44-T7R respectively. RPL44-T7F and RPL44-T7R are SEQ ID NO: 5 and SEQ ID NO: 6 respectively. All primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0028] Primer Name Primer Sequence 5’-3’ RPL7-T7F TAATACGACTCACTATAGGAAACTGAGAAGCCAGCTGCA RPL7-T7R TAATACGACTCACTATAGGTCCCACGGTTTCTTGCTTGC RPL44-T7F TAATACGACTCACTATAGGATGGTTAACGTTCCGAAACA RPL44-T7R TAATACGACTCACTATAGGCGTTTCAAAGGAACTTGTTT

[0029] All locusts used in this example are in the fourth instar stage. When sampling, the complete digestive tract tissue needs to be removed, frozen in liquid nitrogen, and stored in a -80°C refrigerator for later use. The digestive tract of locusts includes: esophagus, crop, proventriculus, gastric caeca, stomach, ileum, colon.

[0030] Total RNA extraction: Clean the tabletop for the RNA extraction experiment, wipe it with 75% alcohol, and the extraction personnel wear masks. Pre-cool a clean and anhydrous mortar and pestle with liquid nitrogen until frost forms on the outer wall of the mortar and the liquid nitrogen in the mortar no longer evaporates violently. Take out the sample to be extracted from the -80°C low-temperature refrigerator and quickly transfer it into liquid nitrogen to avoid RNA degradation caused by the increase in sample temperature.

[0031] Use a pestle to crush the locust sample, and then grind it finely into a powder state without large particle tissues during grinding. Take about 0.2 g of the powder and put it into 1 mL of TRIzol (Invitrogen) reagent pre-cooled on ice. Shake it quickly and mix well, and then place it on ice again to stand for lysis. Complete the total RNA extraction of the locust sample according to the standard extraction steps provided by the reagent.

[0032] Take 1 μL of the extracted RNA solution and detect the RNA integrity by 1.5% agarose gel electrophoresis. During electrophoresis, the concentration can be measured by a micro-ultraviolet spectrophotometer, recorded, and stored in a -80 °C low-temperature refrigerator.

[0033] Reverse transcription: Take 2 μg of the total RNA sample and perform reverse transcription of the RNA sample according to the standard steps of the in vitro reverse transcription kit M-MLV reverse transcriptase (Promega, Madison, USA) to obtain cDNA.

[0034] Using this cDNA as a template, use primers RPL7-T7F, RPL7-T7R and primers RPL44-T7F and RPL44-T7R respectively to perform PCR amplification to obtain the Locusta migratoria RPL7 and RPL44 genes. After the PCR products are determined to have the correct size by agarose gel electrophoresis, they are ligated to the Blunt Zero vector and transformed into Trans1-T1 competent cells. After the colony PCR detects the correct size, they are sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results are compared with the transcriptome search results to verify and obtain the nucleotide sequences of these genes. The nucleotide sequence of its RPL7 gene is SEQ ID NO: 1, and the nucleotide sequence of the RPL44 gene is SEQ ID NO: 2.

[0035] Example 2: In vitro synthesis of dsRNA of Locusta migratoria RPL7 and RPL44 genes

[0036] In this example, the T7 RiboMAX Express RNAi system (Promega, USA) kit is mainly used for in vitro synthesis of double-stranded RNA. The steps are briefly described as follows:

[0037] First, select fragments of appropriate length (about 400 - 1000 bp) according to the length of the candidate gene to design primers for synthesizing double-stranded RNA. After correct sequencing, the T7 promoter sequence (TAATACGACTCACTATAGG) needs to be added to the 5' ends of the upstream and downstream primers respectively. Then use the upstream primer containing the T7 promoter and the downstream primer without the T7 promoter to synthesize the template for the sense strand of dsRNA; use the upstream primer without the T7 promoter and the downstream primer containing the T7 promoter to synthesize the template for the antisense strand of dsRNA.

[0038] That is, during the process of synthesizing the template of the sense strand of dsRNA of the RPL7 gene, the upstream primer is RPL7-T7F, and the downstream primer is RPL7-T7R without the T7 promoter. During the process of synthesizing the template of the antisense strand of dsRNA of the RPL7 gene, the upstream primer is RPL7-T7F without the T7 promoter, and the downstream primer is RPL7-T7R;

[0039] During the process of synthesizing the template of the sense strand of dsRNA of the RPL44 gene, the upstream primer is RPL44-T7F, and the downstream primer is RPL44-T7R without the T7 promoter. During the process of synthesizing the template of the antisense strand of dsRNA of the RPL44 gene, the upstream primer is RPL44-T7F without the T7 promoter, and the downstream primer is RPL44-T7R.

[0040] Subsequently, the templates of the sense strand and the antisense strand were respectively added to the T7 in vitro transcription reaction system and reacted at 37 °C for 30 min (the time can be extended). After the reaction, the sense strand and the antisense strand were mixed for a total of 40 μL. The mixed solution was placed in a metal bath at 70 °C and reacted for 10 min, then the power supply was turned off and slowly cooled to room temperature. At this time, the solution contained renatured dsRNA.

[0041] 160 μL of nuclear-free water was added to 40 μL of the dsRNA solution, and then 200 μL of acidic phenol-chloroform was added for extraction and purification. The dsRNA in the aqueous phase was precipitated by the ethanol method, and finally 80 μL of nuclear-free water was added to dissolve the dsRNA precipitate. After diluting 1 μL of the purified dsRNA solution by 10 times, the concentration was measured on an ultraviolet spectrophotometer for subsequent RNA interference experiments.

[0042] Example 3: Effects of dsRNAs of Locusta migratoria RPL7 and RPL44 genes on the feeding behavior of Locusta migratoria

[0043] 3.1 Injection of dsRNAs of Locusta migratoria RPL7 and RPL44 genes

[0044] The synthesized dsRNA was diluted to the required concentration with nuclear-free water, and a fixed volume of dsRNA was aspirated with a micro syringe for RNA interference. In this example, dsRNA at 0.625 ng / μL was used for the interference experiment and injected into the intersegmental fold between the second and third abdominal segments, with 2 μL injected into each fourth-instar Locusta migratoria. Sampling or behavioral detection was carried out 48 h after the injection was completed.

[0045] 3.2 Detection of the silencing effect of Locusta migratoria RPL7 and RPL44 genes

[0046] Collect the fourth-instar nymphs injected with dsGFP, dsRPL7, and dsRPL44. Extract the total RNA using the Trizol method, and reverse transcribe to obtain the first-strand cDNA using the reverse transcription kit M-MLV reverse transcriptase (Promega, Madison, USA). Use the Real-time PCR method to detect the relative expression levels of the target genes RPL7 and RPL44 and the housekeeping gene RP49, and calculate their silencing efficiency. The results show that compared with the control group, after injecting dsRPL7 ( Figure 1 ) and dsRPL44 ( Figure 2 ), the expression of RPL7 and RPL44 genes in the treatment group was significantly reduced, and the silencing efficiency reached 99%.

[0047] 3.3 Observation of the phenotypes of fourth-instar nymphs after injecting dsRPL7 and dsRPL44

[0048] (1) After interfering with the expression of RPL7 in gregarious locusts with different amounts of dsRNA, the food intake will be significantly reduced at the interference concentrations of 1.25 and 2.5 ng / μL. Figure 3 On the left is the comparison of the remaining amount of wheat between the control group and the treatment group after 20 fourth-instar gregarious locusts were interfered and freely fed for 10 hours. The food intake of the control group was much higher than that of the experimental group, and within 10 hours after interference, almost no feeding behavior occurred in the experimental group ( Figure 3 , left). After starving the locusts for 16 hours and then allowing them to freely feed for 1 hour, the average food intake per locust was calculated by weighing the weight of the wheat seedlings before and after feeding ( Figure 3 , right). Analysis found that the food intake of the locusts in the experimental group was significantly lower than that of the control group, proving that interfering with the expression of RPL7 does cause the antifeedant behavior of fourth-instar gregarious locusts.

[0049] Subsequently, the survival rate and the proportion of successfully molting to the fifth instar after 72 hours of RPL7 interference were tracked and recorded. The results showed that the control group had already started to appear fifth-instar nymphs, and the remaining nymphs were also in a normal growth state about to molt. However, all the nymphs in the experimental group had died, and all died at the fourth-instar stage, and there were no individuals that successfully developed to the fifth instar (Table 1). It is speculated that the deletion of RPL7 affects the translation process of gregarious nymphs, resulting in antifeedant behavior. And the antifeedant behavior causes the fourth-instar nymphs to lose nutrient supply, thus leading to individual death.

[0050] Table 1 Survival rate and molting rate of fourth-instar locusts after RPL7 interference

[0051]

[0052]

[0053] (2) The change in the expression level of RPL44 significantly affects the feeding behavior of gregarious locusts. After rearing the disturbed gregarious fourth-instar locust individuals in a transparent acrylic cage and feeding them the same amount of wheat seedlings, it was found that after 12 hours of feeding, the individuals in the experimental group hardly had any feeding behavior; after 36 hours of feeding, the individuals in the control group had finished eating the wheat seedlings, while the individuals in the experimental group had only a small amount of feeding ( Figure 4 , left). After quantifying and calculating the data, after RNA interference treatment, the locusts were starved for 8 hours and 16 hours, and then the average food intake of each locust within 1 hour was recorded. The experimental results showed that regardless of the 8-hour or 16-hour starvation treatment, the food intake of the locust individuals with RPL44 interference was significantly lower than that of the control group ( Figure 4 , right).

[0054] In addition to the significant decrease in food intake, the decrease in the expression level of RPL44 will induce the growth and development of gregarious locusts to slow down or even die. After interfering with the expression of RPL44, the growth, development and survival of the locust individuals in the experimental group (dsRPL44) and the control group (dsGFP) were continuously observed. Data statistics showed (Table 2) that when 46.7% of the locusts in the control group entered the fifth instar stage, only 3.3% of the locusts in the experimental group developed to the same state. At this time, 86.7% of the individuals in the control group survived, while the survival rate of the experimental group was less than half (46.7%).

[0055] Table 2 Survival rate and molting rate of fourth-instar locusts after RPL44 interference

[0056]

[0057] Biological statistical analysis of the survival rate and the proportion of successfully developing into fifth-instar locusts found that compared with the control group, the decrease in the expression level of RPL44 led to a significant decrease in the survival rate and normal development rate of fourth-instar locusts. Among them, the survival rate decreased by about 50%, and the normal development rate decreased by about 90% ( Figure 5 ).

[0058] During the process of counting the survival rate and growth and development, it was found that most of the locust individuals with a decreased expression level of RPL44 died during the molting behavior at the age change. The image information of the dead individuals in the control group and the experimental group was collected. After comparison, it was found that most of the locust individuals in the control group did not enter the molting state when they died, and the female individuals in the experimental group also did not enter the molting state when they died, and their body size was significantly smaller than that of the control group individuals; but most of the male individuals in the experimental group were in the molting state when they died, and the tergum and wings had shown separation from the new exoskeleton ( Figure 6 ). Therefore, the RPL44 gene may mainly regulate the feeding behavior in gregarious locusts, resulting in abnormal growth and development and weakened locomotor ability.

Claims

1. A gene fragment of the ribosomal large subunit RPL7 protein of gregarious locusts, characterized in that, The nucleotide sequence of the large ribosomal subunit RPL7 protein gene fragment of gregarious Locusta migratoria is SEQ ID NO:

1.

2. A gene fragment of the large ribosomal subunit RPL44 protein of gregarious locusts, characterized in that, The nucleotide sequence of the large ribosomal subunit RPL44 protein gene fragment of gregarious Locusta migratoria is SEQ ID NO:

2.

3. The synthesis method of the ribosomal large subunit RPL7 protein gene fragment of gregarious locusts as described in claim 1, characterized in that, It includes the following steps: Using the cDNA reverse transcribed from the total RNA extracted from gregarious Locusta migratoria as a template, performing PCR amplification with the upstream primer with the sequence of SEQ ID NO: 3 and the downstream primer with the sequence of SEQ ID NO: 4 to obtain the RPL7 gene fragment of gregarious Locusta migratoria.

4. The method for synthesizing the gene fragment of the large ribosomal subunit RPL44 protein of gregarious locusts as described in claim 2, characterized in that, It includes the following steps: Using the cDNA reverse transcribed from the total RNA extracted from gregarious Locusta migratoria as a template, performing PCR amplification with the upstream primer with the sequence of SEQ ID NO: 5 and the downstream primer with the sequence of SEQ ID NO: 6 to obtain the RPL44 gene fragment of gregarious Locusta migratoria.

5. dsRNA synthesized from the large ribosomal subunit RPL7 protein gene fragment of gregarious Locusta migratoria as described in claim 1 or 3.

6. dsRNA synthesized from the large ribosomal subunit RPL44 protein gene fragment of gregarious Locusta migratoria as described in claim 2 or 4.

7. The application of the dsRNA as described in claim 5 in the control of Locusta migratoria.

8. The application of the dsRNA as described in claim 5 in the preparation of a reagent for inhibiting the feeding of Locusta migratoria.

9. The application of the dsRNA as described in claim 6 in the control of Locusta migratoria.

10. The application of the dsRNA as described in claim 6 in the preparation of a reagent for inhibiting the feeding of Locusta migratoria.

Images