A rapid detection method of proteus mirabilis for non-disease diagnosis or non-treatment purpose
By placing the RPA and CRISPR/Cas12a reaction systems separately at the bottom and inside the cap of the PCR reaction tube, and combining them with optimized primers and crRNA, the problems of aerosol contamination and cross-reactivity in the detection of Proteus mirabilis in existing technologies are solved, achieving rapid, sensitive and specific detection results.
Patent Information
- Application Number
- CN202510522760.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-24
- Publication Date
- 2026-03-27
- Estimated Expiration
- 2045-04-24
AI Technical Summary
The existing RPA-CRISPR/Cas12a method for detecting Proteus mirabilis has problems such as high risk of aerosol contamination and high cross-reactivity, and its sensitivity and specificity need to be further improved.
The RPA reaction system and the CRISPR/Cas12a reaction system were placed at the bottom and inside the cap of the PCR reaction tube, respectively, to avoid competition. Specific amplification and recognition were performed using selected primers and crRNA, enabling rapid, sensitive, and specific detection.
It enables rapid, sensitive, and specific detection of Proteus mirabilis, reduces the risk of aerosol contamination, improves the reliability and accuracy of detection, and simplifies the operation process.
Smart Images

Figure CN120366434B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of rapid detection methods, and particularly relates to a rapid detection method of Proteus mirabilis for non-disease diagnosis or non-treatment purposes. BACKGROUND
[0002] Proteus mirabilis is a specific pathogen in the genus Escherichia and belongs to a kind of Escherichia coli. It is a gram-negative bacterium with multiple virulence factors and can cause urinary tract infections (UTIs) in humans. Proteus mirabilis is one of the most common pathogens causing lower urinary tract infections (such as cystitis) and upper urinary tract infections (such as pyelonephritis). Proteus mirabilis is an important urinary tract pathogen, and its infection pathways are diverse, and the adverse effects on the human body include directly causing UTIs and its complications, as well as causing tissue damage through its virulence factors and immunopathological reactions. Therefore, rapid detection of Proteus mirabilis infection has great clinical significance because it can significantly improve the accuracy of diagnosis, speed up the treatment process, reduce unnecessary antibiotic use, and reduce the risk of complications caused by Proteus mirabilis infection.
[0003] The conventional detection methods of Proteus mirabilis include various technologies, including microbial culture, molecular biology detection (such as polymerase chain reaction, PCR), and mass spectrometry. Microbial culture, as a traditional method for detecting Proteus mirabilis, is considered the gold standard for detection. This method involves inoculating a urine sample onto a specific culture medium and then culturing the bacteria under suitable conditions. Based on bacterial culture, the presence of Proteus mirabilis is confirmed by observing the biochemical characteristics of the bacteria; however, this method is time-consuming, usually taking 12-24 hours to complete, requires specialized laboratory equipment and personnel, and may not be able to detect some non-growing or slowly growing Proteus mirabilis strains through culture methods. Other methods include molecular biology methods, which typically include PCR and its derivatives, and immunological methods such as enzyme-linked immunosorbent assay. These detection methods such as PCR usually require expensive laboratory equipment and specialized technical personnel to operate, and immunological methods have a detection window period. Although molecular biology methods are highly sensitive, they do not always meet the requirements of rapidity, low cost, and simple operation. Mass spectrometry is used to identify Proteus mirabilis by analyzing the mass fingerprint of bacterial proteins or peptides, but it also has the problems of expensive mass spectrometers and the need for professional training for operation and maintenance.
[0004] To overcome these limitations, researchers are developing new detection techniques, such as the RPA-CRISPR / Cas12a method, which combines isothermal nucleic acid amplification and CRISPR gene editing technology, can complete the detection of Proteus mirabilis in a shorter time, and is simple to operate, does not depend on expensive laboratory equipment, and is expected to become an ideal on-site rapid detection method.
[0005] However, the RPA-CRISPR / Cas12a method for detecting Proteus mirabilis in the prior art still has some defects. For example, the existing detection operation process is to first perform RPA amplification reaction, and then transfer the PRA reaction product to the CRISPR / Cas12a reaction system, which needs to open the cover to transfer the amplification product, increasing the risk of aerosol pollution. And there is a problem of high cross-reactivity, sensitivity and specificity need to be further improved. SUMMARY
[0006] The purpose of the present application is to overcome the problems of aerosol pollution risk and high cross-reactivity, sensitivity and specificity need to be further improved in the prior art detection, and provide a rapid detection method for Proteus mirabilis for non-disease diagnosis or non-treatment purposes. The method places the RPA reaction system and the CRISPR / Cas12a reaction system in the bottom and the inside of the cap of the PCR reaction tube respectively, avoiding the competition between CRISPR / Cas12a and RPA, ensuring the reaction rate and sensitivity, and because there is no need to open the cover, it also avoids the risk of nucleic acid aerosol pollution. Secondly, the method provided by the present application can realize rapid, sensitive and specific detection of Proteus mirabilis.
[0007] To achieve the above purpose, the technical scheme adopted by the present application is:
[0008] A rapid detection method for Proteus mirabilis for non-disease diagnosis or non-treatment purposes, comprising the following steps:
[0009] Add RPA premix to the bottom of the reaction tube, and place CRISPR / Cas12a premix inside the cap of the reaction tube, and collect them in one tube;
[0010] Extract DNA from the sample to be tested;
[0011] Add the extracted DNA to the reaction tube and mix with the RPA premix, close the cap, and perform RPA amplification reaction; centrifugal treatment, mix CRISPR / Cas12a premix with RPA reaction product and react;
[0012] Perform fluorescence or lateral flow biosensor test paper strip detection to determine whether there is a signal of Proteus mirabilis;
[0013] The RPA premix liquid comprises RPA primers;
[0014] The RPA primer sequence is: RPA-F: 5'-GTCTGTCATCATCTCGATCCCTCTATTCCTG-3', RPA-R: 5'-ACGATTATTATCATTATCTGCGCTATCACCC-3';
[0015] The CRISPR / Cas12a premix liquid comprises crRNA and a ssDNA signal probe;
[0016] The sequence of the crRNA is: 5'-UAAUUUCUACUAAGUGUAGAUCCGCUGGUACCGGCAUCUGC-3';
[0017] The sequence of the ssDNA signal probe is: 5'-FAM-TTATT-BHQ-3'.
[0018] The application provides a rapid detection method based on RPA-CRISPR / Cas12a proteus mirabilis.
[0019] Further, the sample to be detected is a pretreated urine sample;
[0020] The pretreated urine sample is prepared by the following method:
[0021] The urine to be detected is taken and centrifuged;
[0022] The supernatant is discarded, the precipitate is resuspended with sterile water, and the pretreated urine sample is obtained.
[0023] Further, the specific method for extracting the DNA template is as follows:
[0024] The pretreated urine sample is heated at 95 DEG C to 100 DEG C, centrifuged, and the supernatant is taken to obtain the extracted DNA template.
[0025] Further, the metal bath or water bath is used for heating.
[0026] Further, the heating time is 5 min~8 min.
[0027] Further, the centrifugal speed is 4000 rpm~5000 rpm, and the centrifugal time is 30 s~60 s.
[0028] The DNA template extraction method provided by the application does not need to use a kit for extraction, has low cost, and short extraction time.
[0029] Further, the RPA amplification reaction temperature is 37 ℃~42 ℃, and the RPA amplification reaction time is 10 min~12 min.
[0030] Further, the CRISPR / Cas12a premix and RPA reaction product mixed reaction temperature is 37℃~42℃, and the reaction time is 7 min~10 min.
[0031] Further, the volume ratio of the extracted DNA and the RPA premix is 1~1.5:23.5~24.
[0032] Further, 23.8 μL of RPA premix includes 14.5 μL~15 μL of RPA Basic reaction buffer, 1 μL~1.5 μL of 280 mM MgOAc, 1.1 μL~1.3 μL of 10 μM RPA-F, 1.1 μL~1.3 μL of 10 μM RPA-R, and the rest is DEPC treated water.
[0033] Further, 10 μL of CRISPR / Cas12a premix includes 0.5 μL~1 μL of 1 μM Cas12a, 1.5 μL~2 μL of 1 μM crRNA, 0.5 μL~1 μL of 10 μM ssDNA probe, 3 μL~4 μL of buffer buffer, and the rest is DEPC treated water.
[0034] Further, the volume of the RPA premix and the CRISPR / Cas12a premix is 2~3:1.
[0035] Further, the fluorescence method or lateral flow biosensor test strip is used to detect whether there is a signal of proteus mirabilis: if the fluorescence is enhanced or the detection line is colored, it means that the sample contains proteus mirabilis.
[0036] The application provides a rapid detection method based on RPA-CRISPR / Cas12a proteus mirabilis.
[0037] The rapid detection method of proteus mirabilis provided by the application has a high amplification speed and does not need to be additionally opened, and the detection of proteus mirabilis can be completed in about 20 minutes.
[0038] The rapid detection method of proteus mirabilis provided by the application has high specificity, the RPA specifically amplifies target DNA through primers, the CRISPR / Cas12a specifically recognizes target DNA through crRNA, and the proteus mirabilis can be specifically detected through the double screening of RPA and CRISPR / Cas12a, and there is no cross reaction with common pathogenic bacteria.
[0039] The rapid detection method of proteus mirabilis provided by the application has high sensitivity, and the proteus mirabilis target of 2.8 copies / μL can be detected through the double amplification of RPA and CRISPR / Cas12a. BRIEF DESCRIPTION OF DRAWINGS
[0040] Figure 1 It is the analysis data graph of RPA primers in the examples.
[0041] Figure 2 It is the data graph of crRNA screening in the examples.
[0042] Figure 3 It is the data graph of the condition optimization process in the examples.
[0043] Figure 4 It is the data graph of the sensitivity test results in the examples.
[0044] Figure 5 It is the data graph of the specificity test results in the examples.
[0045] Figure 6 It is the position display graph of the RPA premix and the CRISPR / Cas12a premix in the reaction tube. DETAILED DESCRIPTION
[0046] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and should not be used to limit the present application. EMBODIMENT
[0047] The prior art has the risk of aerosol pollution during detection, and the cross-reactivity is high, and the sensitivity and specificity need to be further improved.
[0048] The present embodiment provides a rapid detection method of Proteus mirabilis for non-disease diagnosis or non-treatment purposes, comprising the following steps:
[0049] As shown in Figure 6 The RPA premix solution is added to the bottom of the reaction tube, and the CRISPR / Cas12a premix solution is placed inside the tube cover of the reaction tube, and is collected in one tube.
[0050] S1, extracting DNA from the sample to be tested;
[0051] The sample to be tested is a pretreated urine sample; the pretreated urine sample is prepared by the following method:
[0052] Take 1 mL of the urine sample to be tested in a 1.5 mL PCR tube, and centrifuge at 4000 rpm for 45 s;
[0053] Discard the supernatant, add 100 μL of sterile water to resuspend the precipitate, shake and mix well, and obtain the pretreated urine sample.
[0054] Heat the pretreated urine sample at 95 ℃ (metal bath or water bath) for 5 min, centrifuge at 4000 rpm for 45 s, and take the supernatant, which is the extracted DNA sample.
[0055] In some embodiments, the specific method for extracting the DNA template is as follows:
[0056] Heat the pretreated urine sample at 95 ℃ to 100 ℃, centrifuge, take the supernatant, and obtain the extracted DNA template.
[0057] In some embodiments, a metal bath or a water bath is used for heating.
[0058] In some embodiments, heating is performed for 5 min to 8 min.
[0059] In some embodiments, the centrifugation speed is 4000 rpm to 5000 rpm, and the centrifugation time is 30 s to 60 s.
[0060] S2, 1.2 μL of the extracted DNA was added into the reaction tube and mixed with 23.8 μL of the RPA premix solution, the tube cap was closed, and the RPA amplification reaction was performed at 39°C for 10 min;
[0061] RPA premix solution: 14.75 μL of RPA Basic reaction buffer, 1.25 μL of 280 mM MgOAc, 1.2 μL of 10 μM upstream primer (F), 1.2 μL of 10 μM downstream primer (R), and 5.4 μL of DEPC-treated water.
[0062] In some embodiments, the volume ratio of the extracted DNA to the RPA premix solution is 1-1.5:23.5-24.
[0063] In some embodiments, 23.8 μL of the RPA premix solution includes 14.5 μL-15 μL of the RPA Basic reaction buffer, 1 μL-1.5 μL of 280 mM MgOAc, 1.1 μL-1.3 μL of 10 μM RPA-F, 1.1 μL-1.3 μL of 10 μM RPA-R, and the rest is DEPC-treated water.
[0064] In some embodiments, the temperature of the RPA amplification reaction is 37°C-42°C, and the time of the RPA amplification reaction is 10 min-12 min.
[0065] S3, centrifugal treatment, 10 μL of the CRISPR / Cas12a premix solution was mixed with the RPA reaction product for reaction, the reaction temperature was 39°C, and the reaction time was 7-10 min; the composition of the CRISPR / Cas12a reaction system: 0.875 μL of 1 μM Cas12a, 1.75 μL of 1 μM crRNA, 0.875 μL of 10 μM ssDNA probe, 3.5 μL of buffer, 3 μL of DEPC-treated water, and a total of 10 μL.
[0066] In some embodiments, 10 μL of the CRISPR / Cas12a premix solution includes 0.5 μL-1 μL of 1 μM Cas12a, 1.5 μL-2 μL of 1 μM crRNA, 0.5 μL-1 μL of 10 μM ssDNA probe, 3 μL-4 μL of buffer buffer, and the rest is DEPC-treated water.
[0067] In some embodiments, the volume of the RPA premix solution and the CRISPR / Cas12a premix solution is 2-3:1.
[0068] In some embodiments, the temperature of the mixed reaction of the CRISPR / Cas12a premix and the RPA reaction product is 37-42 DEG C, and the reaction time is 7-10 minutes.
[0069] The fluorescence method or lateral flow biosensor test strip is used to detect whether the sample contains P. mirabilis; if the fluorescence is enhanced or the detection line is colored, it indicates that the sample contains P. mirabilis.
[0070] The RPA premix includes RPA primers.
[0071] The RPA primer sequence is: RPA-F: 5'-GTCTGTCATCATCTCGATCCCTCTATTCCTG-3', and RPA-R: 5'-ACGATTATTATCATTATCTGCGCTATCACCC-3'.
[0072] The CRISPR / Cas12a premix includes crRNA and ssDNA signal probes.
[0073] The sequence of the crRNA is: 5'-UAAUUUCUACUAAGUGUAGAUCCGCUGGUACCGGCAUCUGC-3'.
[0074] The sequence of the ssDNA signal probe is: 5'-FAM-TTATT-BHQ-3'.
[0075] Specifically, the embodiment provides a process of exploring the rapid detection method of the embodiment.
[0076] Step 1, preparation of plasmid and clinical sample
[0077] The P. mirabilis ureC gene (NC_010554.1) is selected as the detection target gene, and a plasmid with the ureC gene is synthesized by Sheng Wu Bioengineering (Shanghai) Co., Ltd. The clinical strain is cultured in Luria-Bertani (LB) broth at 37 DEG C under constant temperature (120 r / min) for 12 hours, and then boiled at 95 DEG C for 5 minutes. The supernatant is taken as the template after centrifugation.
[0078] Step 2, primer design
[0079] The P. mirabilis ureC gene is used as the detection target gene, and 3 pairs of RPA forward and reverse candidate primers are designed according to the RPA primer design principle and by using the primer design software Primer Premier 6. The specificity of the primers is verified online by NCBI-BLAST, and the primers and target fragments are shown in Table 1. All primers are synthesized by Sheng Wu Bioengineering (Shanghai) Co., Ltd.
[0080] Table 1 primer sequence
[0081] Name Sequence (5'→3') F1 GTCTGTCATCATCTCGATCCCTCTATTCCTG R1 ACGATTATTATCATTATCTGCGCTATCACCC F2 GTCTGTCATCATCTCGATCCCTCTATTCCTG R2 AGTGCGTAAGATAACTTCTCCGACTCGTCCC F3 CATTAATACCGTGGACGAGCATCTTGATATGTTGA R3 GCCAAGTGCGTAAGATAACTTCTCCGACTC
[0082] Step 3, RPA amplification reaction system
[0083] RPA Basic reaction buffer (recombinant enzyme polymerase amplification kit TwistAmp® Basic kit purchased from TwistDxTM Company in the United Kingdom) 14.75 μL, 280 mM MgOAc 1.25 μL, 10 μM upstream primer (F) 1.2 μL, 10 μM downstream primer (R) 1.2 μL, template 1.2 μL, DEPC treated water 5.4 μL, total 25 μL. The prepared reaction system is reacted at 39 ℃ for 15 minutes, and the result can be observed.
[0084] Step 4, reaction system of one-pot RPA-CRISPR / Cas12a reaction
[0085] The one-pot reaction is to integrate the RPA reaction and the CRISPR / Cas12a (EnGen® Lba Cas12a (Cpf1) nuclease purchased from NEB England Biolabs Company (Beijing)) reaction in one tube. The composition of the CRISPR / Cas12a reaction system: 1 μM Cas12a 0.875 μL; 1 μM crRNA 1.75 μL; 10 μM ssDNA probe 0.875 μL; DEPC water 3 μL; buffer 3.5 μL, total 10 μL. The RPA reaction system is placed at the bottom of the PCR reaction tube, and the CRISPR / Cas12a system is placed inside the PCR reaction tube cover. After the sample is added to the RPA reaction system and the 10 min RPA reaction is carried out at 39 ℃, centrifugation is carried out at 1200 rpm for 10 seconds, and the CRISPR / Cas12a system inside the tube cover is centrifuged into the RPA reaction, and the CRISPR / Cas12a cutting reaction is carried out. The fluorescence signal is collected by real-time fluorescence quantitative PCR instrument, and the detection can be completed in 7~10 min.
[0086] Step 5, condition optimization
[0087] (1) RPA primer screening: the concentration of 10 4copies / μL of plasmid with Proteus mirabilis ureC gene as template, DEPC treated water instead of plasmid as control, different RPA primer pairs were used for amplification according to the conditions in step 3, then equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) extraction solution was added to the reaction tube, mixed thoroughly, centrifuged at 12000 rpm for 5 min, and the supernatant was aspirated to extract the amplification product. The amplification product was added to 6x SuperStain Loading Buffer at a ratio of 5:1, mixed thoroughly, and then electrophoresed on a 1.5% agarose gel at 90 V constant voltage for 30 min. The results were observed using a gel imaging instrument.
[0088] The results are shown in A of Figure 1 According to the thickness of the band of the amplification product, primer 1 has the best effect. Sensitivity verification was performed on primer 1, which can reach 10 1 copies / μL, as shown in B of Figure 1 Proteus mirabilis RPA primer screening. Lane 1: 250 bp DNA Ladder; Lane 2: F1R1 (246 bp); Lane 3: F1R1 control; Lane 4: F2R2 (171 bp); Lane 5: F2R2 control; Lane 6: F3R3 (212 bp); Lane 7: F3R3 control.
[0089] F1R1 primer set RPA amplification sensitivity analysis. Lane 1: 250 bp DNA Ladder; Lane 2: plasmid concentration 10 2 copies / μL; Lane 3: plasmid concentration 10 1 copies / μL; Lane 4: plasmid concentration 10 0 copies / μL; Lane 5: negative control.
[0090] crRNA design and screening: crRNA was designed according to the optimal RPA primer amplification sequence, and the specific sequence is shown in Table 2; different crRNAs were used in the system described in step 4, and the best crRNA was selected according to the intensity of the fluorescence signal and the time to reach the plateau, as shown in Figure 2 The crRNA1 reached the plateau time more quickly and had a higher end fluorescence value, so crRNA1 was selected for the following experiments.
[0091] Table 2 crRNA and ssDNA probe sequences
[0092] Name Sequence (5'→3') crRNA1 UAAUUUCUACUAAGUGUAGAUCCGCUGGUACCGGCAUCUGC crRNA2 UAAUUUCUACUAAGUGUAGAUAACGGGAGACGCCCAAUGGG ssDNA probe FAM-TTATT-BHQ
[0093] CRISPR / Cas12a system optimization: 2.82x10 4copies / μL) as template, the Cas12a concentration (25 nM, 50 nM, 75 nM, 100 nM), Cas12a / crRNA ratio (1:1, 1:1.5, 1:2), ssDNA probe concentration (150 nM, 250 nM, 350 nM) and other reaction conditions were optimized, and the fluorescence value at 10 min was plotted, and the results are as follows Figure 3 A in FIG. 1, Figure 3 B in FIG. 2, and Figure 3 C in FIG. 3, the fluorescence values at different Cas12a concentrations are small, considering the cost and economic benefits, the lowest concentration of 25 nM is selected as the final concentration; with the increase of the ratio of crRNA:Cas12a, the fluorescence value gradually increases, and finally the ratio of Cas12a:crRNA=1:2 is selected as the final ratio; with the increase of the ssDNA probe concentration, the fluorescence value increases, but there is no significant difference between 250 nM and 300 nM ssDNA probe fluorescence values, so 250 nM ssDNA probe is selected as the final concentration.
[0094] A. Cas12a concentration optimization; B. Cas12a / crRNA ratio optimization; C. ssDNA probe concentration optimization; the plasmid template concentration used is 10 4 copies / μL; error bars represent standard deviation of three replicates.
[0095] Step 6, sample pretreatment
[0096] The nucleic acid of Proteus mirabilis was extracted by water boiling method. The Proteus mirabilis suspension was directly heat lysed at 95℃ for 5 min, centrifuged, and the supernatant was used as the template for RPA-CRISPR / Cas12a reaction.
[0097] Step 7, sensitivity test of one-tube RPA-CRISPR / Cas12a detection method
[0098] The sensitivity test with plasmid as template, the plasmid standard containing the target fragment of Proteus mirabilis ureC gene was gradient diluted to 2.8×10 4 copies / μL, 2.8×10 3 copies / μL, 2.8×10 2 copies / μL, 2.8×10 1 copies / μL and 2.8×10 0copies / μL, while DEPC-treated water was used as a negative control. According to the optimized reaction system of step 4, 1.2 μL of plasmid dilution was added to the RPA reaction system, and after 10 min of RPA reaction at 39 ℃, the CRISPR / Cas12a system inside the tube cap was centrifuged into the RPA reaction for CRISPR / Cas12a cleavage reaction, and the fluorescence signal was collected by real-time fluorescence quantitative PCR instrument, and the detection was completed in 7~10 min, and the fluorescence value at 10 min of reaction was plotted (Fig. 4B). Figure 4 ), and the results showed that the method could detect as low as 1×10 0 copies / μL of plasmid standard.
[0099] Step 8, specificity test of one-tube RPA-CRISPR / Cas12a
[0100] Water extraction method was used to extract pathogenic bacteria DNA of Staphylococcus aureus, Klebsiella pneumoniae, etc. as a template for one-tube RPA-CRISPR / Cas12a detection, and the fluorescence value at 10 min of reaction was plotted (Fig. 4B). Figure 5 The results showed that the method had high specificity for Proteus mirabilis, and there was no cross reaction in the detection process.
[0101] From the results of the above embodiments, it can be seen that the present application can rapidly, sensitively, specifically and accurately detect Proteus mirabilis. Cross contamination of samples or environment is avoided. The method has strong anti-interference ability, and does not need complex nucleic acid extraction steps, but only needs simple heat cracking to complete the sample pretreatment link. The method realizes one-tube RPA-CRISPR / Cas12a detection, without liquid transfer link, simplifies the experimental steps, and reduces the possibility of aerosol pollution. In summary, the method can realize rapid and accurate on-site detection of Proteus mirabilis.
[0102] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement and improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A rapid detection method of Proteus mirabilis for non-disease diagnosis or non-therapeutic purposes, characterized by, Comprising The following steps: RPA premix is added to the bottom of the reaction tube, CRISPR / Cas12a premix is placed inside the tube cover of the reaction tube, and they are collected in a tube; DNA is extracted from the sample to be tested; The extracted DNA is added to the reaction tube and mixed with the RPA premix, the tube cover is closed, and the RPA amplification reaction is performed; Centrifugal treatment, mix CRISPR / Cas12a premix with RPA reaction product for reaction; Fluorescence method is used to detect whether there is a signal of Proteus mirabilis; The RPA premix includes RPA primers. The sequence of the RPA primers is: RPA-F: 5'-GTCTGTCATCATCTCGATCCCTCTATTCCTG-3', RPA-R: 5'-ACGATTATTATCATTATCTGCGCTATCACCC-3'; The CRISPR / Cas12a premix includes crRNA and ssDNA signal probe. The sequence of the crRNA is: 5'-UAAUUUCUACUAAGUGUAGAUCCGCUGGUACCGGCAUCUGC-3'; The sequence of the ssDNA signal probe is: 5'-FAM-TTATT-BHQ-3'.
2. The rapid detection method according to claim 1, characterized in that, The temperature of the RPA amplification reaction is 37 ℃-42 ℃, and the time of the RPA amplification reaction is 10 min-12 min.
3. The rapid detection method according to claim 1, characterized in that, The temperature of the CRISPR / Cas12a premix mixed with the RPA reaction product for reaction is 37 ℃-42 ℃, and the reaction time is 7 min-10 min.
4. The rapid detection method of claim 1, wherein, The volume ratio of the extracted DNA to the RPA premix is 1-1.5:23.5-24.
5. The rapid detection method according to claim 4, characterized in that, Each 23.8 μL of RPA premix includes 14.5 μL-15 μL of RPA Basic reaction buffer, 1 μL-1.5 μL of 280 mM MgOAc, 1.1 μL-1.3 μL of 10 μM RPA-F, 1.1 μL-1.3 μL of 10 μM RPA-R, and the rest is DEPC treated water.
6. The rapid detection method according to claim 5, characterized in that, Each 10 μL of CRISPR / Cas12a premix includes 0.5 μL-1 μL of 1 μM Cas12a, 1.5 μL-2 μL of 1 μM crRNA, 0.5 μL-1 μL of 10 μM ssDNA signal probe, 3 μL-4 μL of buffer buffer, and the rest is DEPC treated water.
7. The rapid detection method according to claim 6, characterized in that, The volume of RPA premix and CRISPR / Cas12a premix added is 2-3:
1.
8. The rapid test method according to any one of claims 1 to 7, characterized in that, Fluorescence method or lateral flow biosensor test strip is used to detect whether there is a signal of Proteus mirabilis: if the fluorescence is enhanced or the detection line is colored, it means that the sample to be tested contains Proteus mirabilis.
Citation Information
Patent Citations
Recombinase polymerase amplification (RPA) primer for distinguishing proteus mirabilis from salmonella and detection method
CN112592989A
RPA (recombinase polymerase amplification) primer for simultaneously detecting pathogenic proteus mirabilis and enteropathogenic escherichia coli and application of RPA primer
CN118497385A