Application of MCT2 protein as marker in preparation of products for ovarian cancer stem cell identification and treatment effect evaluation

Abstract

The invention provides application of MCT2 protein as a marker in preparation of products for ovarian cancer stem cell identification and treatment effect evaluation, and belongs to the technical field of biomedicine. According to the invention, primary ovarian cancer cells are obtained, an OCSC model is established by screening and culturing, an inhibitor with MCT2Ki specificity is adopted for intervention, an OCSC marker is identified by adopting flow cytometry and qRT-PCR, and the expression level and cell localization of MCT2 are detected by adopting a qRT-PCR method and an immunofluorescence staining method. A stem cell balling experiment and a matrigel migration chamber experiment are adopted to verify the influence of the MCT2 inhibitor on the dryness and invasiveness of the OCSC, and verify that the MCT2 is in a high expression state in the primary OCSC, and the dryness and invasiveness of ovarian cancer cells can be reduced by inhibiting the MCT2, so that the MCT2 can become a new target for treating high-grade ovarian cancer.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and specifically to the application of MCT2 protein as a biomarker in the preparation of products for the identification of ovarian cancer stem cells and the evaluation of treatment effects. Background Art

[0002] Ovarian cancer is a gynecological tumor that is difficult to diagnose early. Most patients are found in the advanced stage, and its characteristics include easy metastasis and strong drug resistance. The treatment of ovarian cancer has always faced major challenges. Tumor stem cells are a unique subset of cancer cells with the ability of self-renewal and can drive tumor diversity and disease progression. Ovarian cancer stem cells (OCSCs) are closely related to various poor clinical outcomes such as the metastasis and chemotherapy resistance of ovarian cancer. Therefore, exploring the molecular biological mechanism of OCSCs can provide new insights for the early diagnosis, formulation of treatment strategies and prognosis judgment of ovarian cancer. In the field of tumor molecular biology research, primary cell culture is gradually favored by researchers. In the research field of ovarian cancer, the research in the above direction is still relatively scarce.

[0003] Using lactate in the microenvironment for oxidative phosphorylation is one of the important metabolic characteristics of tumor stem cells. Monocarboxylate transporter 2 (MCT2), which can mediate monocarboxylate transport, is one of the important proteins mediating lactate transmembrane transport. Research shows that in glioblastoma stem cell lines, the expression level of MCT2 is significantly higher than that of adherent cell lines, and the principle has not been fully elucidated. In primary OCSCs, the expression level and function of MCT2 lack research. Summary of the Invention

[0004] In view of the problems existing in the prior art, the present invention provides the application of MCT2 protein as a biomarker in the preparation of products for the identification of ovarian cancer stem cells and the evaluation of treatment effects.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] The first aspect of the present invention provides the application of MCT2 protein as a biomarker in the preparation of products for the identification of ovarian cancer stem cells. The second aspect of the present invention provides the application of MCT2 protein as a biomarker in the preparation of products for the evaluation of treatment effects against ovarian cancer stem cells.

[0007] As a preferred embodiment of the above solution, if the MCT2 protein level after ovarian cancer treatment is lower than the MCT2 protein level before treatment, the treatment targeting ovarian cancer stem cells is evaluated as effective; if the MCT2 protein level after ovarian cancer treatment is higher than the MCT2 protein level before treatment, the treatment effect targeting ovarian cancer stem cells is evaluated as poor.

[0008] The third aspect of the present invention provides a product for identifying ovarian cancer stem cells and / or a product for evaluating the treatment effect targeting ovarian cancer stem cells, and the product contains substances for detecting the MCT2 protein level.

[0009] As a preferred embodiment of the above solution, the product includes a reagent, a kit or a chip.

[0010] As a preferred embodiment of the above solution, the content of the product includes at least one of the following: a detection probe for MCT2, an aptamer for MCT2.

[0011] Compared with the prior art, the beneficial effects of the present invention are:

[0012] The present invention has established a series of patient-derived OCSC models, and verified that MCT2 is highly expressed in primary OCSC. Inhibiting MCT2 can reduce the stemness and invasiveness of ovarian cancer stem cells. Therefore, MCT2 can become a new target for treating high-grade ovarian cancer. Specifically:

[0013] 1) The present invention has established a small-scale OCSC model library, in which stem cell-related markers are highly expressed. After 14 days of culture and screening, the proportion of CD133 + ALDH + cells reached 21.0%, which is higher than 7.64% without screening and culture.

[0014] 2) The high expression of MCT2 in OCSC suggests that it may play a key role in regulating stemness maintenance and metabolic reprogramming. This discovery deepens the understanding of the molecular mechanism of OCSC and provides a potential direction for clinical translational research targeting MCT2, and may lay a theoretical foundation for improving the prognosis of ovarian cancer patients.

[0015] 3) Inhibition of MCT2 can not only significantly inhibit the stemness characteristics of OCSC, but also significantly reduce the invasiveness of OCSC. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the flow chart of the isolation and identification of OCSC in Example 1 of the present invention;

[0017] Figure 2A It is the morphological change diagram of the OCSC group after screening and culture in Example 1 of the present invention;

[0018] Figure 2B Schematic diagram of the formation of cell spheroids in the OCSC group in Example 1 of the present invention;

[0019] Figure 2C Expression of key surface markers identified by flow cytometry in the OCSC model in Example 1 of the present invention;

[0020] Figure 3 Expression of SOX2, MCT2, and CD44 in OCSCs and ovarian cancer cells in Control Group 1 in Example 2 of the present invention (scale bar length is 50 μm);

[0021] Figure 4A Morphology of OCSCs after treatment with the MCT2 inhibitor CHC and AR-C155858 in Example 3 of the present invention;

[0022] Figure 4B Matrigel invasion assay of OCSCs after treatment with the MCT2 inhibitor in Example 3 of the present invention (scale bar length is 100 μm). Detailed implementation manners

[0023] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0024] I. Description of cell source and material usage

[0025] 1. Cell source and situation

[0026] Primary ovarian cancer cells from ovarian cancer patients who visited the Department of Obstetrics and Gynecology, West China Second University Hospital, Sichuan University from January 2023 to January 2025 were selected as the research carrier. The inclusion criteria were: women aged 18 years ≤ age ≤ 75 years; expected survival period ≥ 3 months; imaging examination showed tumors in the ovarian region and metastases in parts such as the mesentery; the participants were naïve, and during the operation, it was diagnosed by gynecological oncology experts in West China Second University Hospital that the patients had both in-situ tumors and tumor metastases, and the tissues removed during the operation were evaluated as high-grade serous ovarian cancer by pathologists in the Pathology Department of West China Second University Hospital; the clinical data were complete. Exclusion criteria: pregnant women; those suffering from other malignant diseases, acute inflammatory diseases, autoimmune diseases; those suffering from teratomas; those who had received any hormone therapy 3 months before sampling; those using intrauterine contraceptives; research participants who had undergone platinum-based chemotherapy, immunotherapy, or radiotherapy before the operation.

[0027] The research protocol was approved by the Medical Research Ethics Committee of West China Second University Hospital, Sichuan University.

[0028] A total of 23 patient-derived OCSC models were established in this study, and the average age of the patients was 56.96 years. In terms of disease stage, there were 2 cases (8.70%) in stage I, 1 case (4.35%) in stage II, 10 cases (43.48%) in stage III, and 10 cases (43.48%) in stage IV. The pathological type of all patients was high-grade serous adenocarcinoma (23 cases, 100%). The immunohistochemical results of the patients showed: ER(+) in 22 cases (95.65%), PR(+) in 7 cases (30.43%), P53(+) in 22 cases (95.65%), CA 125 (+) in 21 cases (91.30%), WT-1(+) in 22 cases (95.65%), PAX8(+) in 23 cases (100%), P16(+) in 23 cases (100%), and HER-2(+) in 13 cases (56.52%). The average CA 125 level was 718.06 ± 1257.23 U / ml, and the CA 199 level was 34.63 ± 89.46 U / ml.

[0029] 2 Experimental materials and instruments

[0030] DMEM F12 medium, DMEM F12 KO medium, Antianti, MCT2 rabbit monoclonal antibody, leukemia inhibitory factor (LIF), insulin-transferrin-selenium-pyruvate supplement (ITS-A), and B27 were purchased from Thermo Fisher Scientific Co., Ltd. in China; bovine serum albumin (BSA) and α-cyano-4-hydroxycinnamic acid (CHC) were purchased from Merck KGaA in Germany; Y-27632, A-38-01, and ARC-155858 were purchased from Selleck Chemicals LLC in the United States; collagenase I and collagenase IV were purchased from Yeasen Biotech Co., Ltd. in Shanghai; CD133 flow antibody was purchased from United BioSource Corporation in Shanghai; ALDEFLUOR TM aldehyde dehydrogenase detection kit was purchased from STEMCELL Technologies in the United States; CD44 mouse monoclonal antibody was purchased from Cell Signaling Technology; SOX2 mouse monoclonal antibody was purchased from Shanghai Abpromab Trading Co., Ltd.; fibroblast growth factor (FGF) and epidermal growth factor (EGF) were purchased from Novoprotein Scientific Inc. in Suzhou, and the laser confocal microscope was purchased from Olympus in Japan.

[0031] 3 Statistical methods

[0032] Statistical analysis was performed using SPSS 25.0 software. Quantitative data were used It is shown that the independent sample t-test was used for the comparison between the two groups, and when P < 0.05, it indicated that the difference was statistically significant.

[0033] Second, the present invention will be further described below in conjunction with embodiments.

[0034] Example 1 Establishment of primary OCSC model

[0035] 1.1 Obtaining primary ovarian cancer cells

[0036] ① Source of ovarian cancer tissue: Derived from surgical specimens, after washing with PBS buffer, cut into pieces about 2 mm 2 in size. Digest with collagenase I and collagenase IV at 37 °C for 1 h, filter through a 100 mm filter, and centrifuge at 1500 rmp for 3 min;

[0037] ② Source of ascites: Take the precipitate after centrifuging the patient's ascites at 1500 rmp for 3 min. After treating the above cells with red blood cell lysate, the patient-derived primary cells were obtained.

[0038] 1.2 Establishment of OCSC model and differentiated cell model

[0039] In this example, the screened OCSCs were set as the OCSC group, and the adherent primary cells were used as the control group 1, and their characteristics were systematically compared.

[0040] The separation and identification process of OCSCs is shown in Figure 1 . After obtaining primary ovarian cancer cells, tumor cells were induced to become OCSCs with cytokines such as LIF, ITS, FGF, and EGF, and the primary OCSCs were screened using the characteristic that OCSCs can grow without adhering to the wall environment. The primary ovarian cancer cells were inoculated into different plates and established with two different culture media. The OCSC model group was inoculated into a low-attachment plate and added with OCSC medium. The differentiated cell model group (control group 1) was inoculated into a normal plate with DMEM medium containing 10% serum. Incubate in an incubator at 37 °C and 5% carbon dioxide, and change the medium once every 3 - 4 days.

[0041] After screening and culturing for 14 days, the cells in the OCSC group formed stem cell spheres with a diameter exceeding 100 μm, as shown in Figure 2A . The cell spheres showed a spherical or ellipsoidal shape, with regular shape and clear boundaries, as shown in Figure 2B .

[0042] 1.3 Identification of OCSC markers by flow cytometry

[0043] ① Surface marker CD133: Incubate 5 × 10 5 cells with CD133 antibody (diluted 1:50), incubate at 4 °C for 10 min, and detect by flow cytometry.

[0044] ② Activity of aldehyde dehydrogenase (ALDH): After treating cells according to the instructions of the ALDEFLUOR TM kit, perform flow cytometry analysis.

[0045] Flow cytometry results showed that after 7 days of culture and screening, the proportion of ALDH + cells in the OCSC group was increased compared with that in Control Group 1 (30.0% vs. 1.2%). After 14 days of culture and screening, the proportion of CD133 + ALDH + cells in the OCSC group reached 21.0%, which was higher than 7.64% in Control Group 1, as Figure 2C shown.

[0046] 1.4 Identification of CD133 expression level by reverse transcription quantitative polymerase chain reaction (qRT-PCR)

[0047] 1.4.1 Expression of CD133 in OCSC

[0048] After extracting the total RNA of the cell model, use a reverse transcription kit to perform reverse transcription to synthesize cDNA, and then configure a qRT-PCR reaction system using cDNA as a template, and perform PCR amplification according to the instructions of the kit.

[0049] Forward primer for CD133: GCCACCGCTCTAGATACTGC, reverse primer for CD133: TGTTGTGATGGGCTTGTCAT.

[0050] qRT-PCR showed that the expression level of CD133 in the OCSC group was significantly higher than that in Control Group 1 (P < 0.01), as shown in Table 1. The establishment of the OCSC model was successful.

[0051] Table 1 Expression of key surface marker CD133 in the OCSC model identified by qRT-PCR

[0052]

[0053] In the research of this example, a small-scale OCSC model library was established. Among them, stem cell-related markers showed a high-expression state. After 14 days of culture and screening, the proportion of CD133 + ALDH + cells reached 21.0%, which was higher than 7.64% without screening culture, indicating the effectiveness of the model in this example. This research filled the data gap in the study of OCSC in the southwestern region of China and expanded the understanding of the characteristics of OCSC.

[0054] Example 2 Expression of MCT2 in OCSC

[0055] 2.1 Identification of MCT2 expression level by reverse transcription quantitative polymerase chain reaction (qRT-PCR)

[0056] After extracting the total RNA of the cell model, reverse transcription was performed using a reverse transcription kit to synthesize cDNA. Then, a qRT-PCR reaction system was prepared with cDNA as the template, and PCR amplification was carried out according to the instructions of the kit.

[0057] Forward primer for MCT2: GCTGGGTCGTAGTCTGTGC, Reverse primer for MCT2: ATCCAAGCGATCTGACTGGAG.

[0058] Forward primer for internal reference β-Actin: AAGTGTGACGTTGACATCCG, Reverse primer for internal reference β-Actin: GATCCACATCTGCTGGAAGG. The relative expression levels of the corresponding molecules were calculated using the 2 -ΔΔCT method.

[0059] The expression levels of MCT2 in OCSC and differentiated cells were analyzed by qRT-PCR. The results showed that the expression levels of MCT2 in the OCSC group (5.78 ± 3.55 and 122.89 ± 19.90 in two samples respectively) were significantly higher than those in control group 1 (1.01 ± 0.10 and 1.55 ± 1.45 in two samples respectively) (P < 0.05), as shown in Table 2. The results indicated that the expression level of MCT2 could be used as a marker for the identification of ovarian cancer stem cells (OCSC).

[0060] 2.2 Identification of the correlation between MCT2 and CD44 / SOX2 expression by immunofluorescence staining

[0061] Samples were prepared using the cover slip method. After fixing the samples with paraformaldehyde, they were operated according to the standard procedure of immunofluorescence staining. They were incubated overnight at 4°C with primary antibodies (1:100 diluted anti-MCT2 rabbit monoclonal antibody + 1:500 diluted anti-CD44 mouse monoclonal antibody or 1:1000 diluted anti-SOX2 mouse monoclonal antibody), and then incubated with the corresponding secondary antibodies for 1 h. The cover slips were placed on the slides and observed under a confocal microscope.

[0062] Fluorescence quantitative analysis of immunofluorescence staining showed a high expression level of MCT2 in the OCSC group. The average gray values of the OCSC group and control group 1 were 6.79 ± 0.67 AU and 2.49 ± 1.78 AU respectively, and the difference was statistically significant (P = 0.03), as shown in Table 2, Figure 3The expression of SOX2, MCT2, and CD44 in OCSC and ovarian cancer cells in Control Group 1 is shown (scale bar length is 50 μm), and the expression characteristics of the three marker proteins, SOX2, MCT2, and CD44, in ovarian cancer stem cells (OCSC) and ordinary ovarian cancer cells in Control Group 1 were systematically compared. Quantitative analysis showed that the fluorescence intensity of MCT2 in OCSC was significantly enhanced (6.79 ± 0.67 VS 2.49 ± 1.78), and the positive signal was mainly continuously distributed along the cell membrane surface. In the three-channel fluorescence fusion analysis, spatial co-localization of MCT2 with the stemness markers CD44 and SOX2 was observed.

[0063] Table 2 Identification of the expression of MCT2 in the OCSC model

[0064]

[0065] Note: ① Analyzed by qRT-PCR; ② Fluorescence quantitative analysis by immunofluorescence staining

[0066] Example 3 Effects of inhibiting MCT2 on the stemness and invasive functions of OCSC

[0067] In this example, OCSC was treated with an MCT2 Ki-specific inhibitor and a spheroid formation assay was performed to explore the effects of the MCT2 inhibitor on OCSC. Two MCT2 Ki-specific inhibitors (CHC, AR-C155858) were used for intervention, which were set as the CHC inhibition group and the ARC155858 inhibition group, while only adding the solvent DMSO was set as Control Group 2.

[0068] 3.1 Detection of the stemness of OCSC by the stem cell spheroid formation assay

[0069] The MCT inhibitor was added to the OCSC medium at the Ki of MCT2 (including 24 nM CHC or 10 nM AR-C155858) or an equal amount of DMSO, and the dissociated OCSC single cells were incubated for 7 days. The average diameter of the cell spheres and the number of cell spheres in each well were counted. Each group had no less than 10 fields of view, and the spheroid formation rate per 1000 cells was calculated.

[0070] Figure 4AThe morphology of OCSC after treatment with MCT2 inhibitors CHC and AR-C155858 is shown. It can be seen that after treatment with the two inhibitors, the number of stem cell spheres in the CHC inhibition group and the ARC155858 inhibition group decreased. In the control group 2, a larger number of stem cell spheres were formed. Specifically, compared with the number of stem cell spheres in the control group 2 (14.62 ± 3.07 per 1000 cells), the number of stem cell spheres of OCSC in the CHC inhibitor group (6.00 ± 2.17 per 1000 cells) decreased significantly (P < 0.01). In another cell line, compared with the control group 2 (23.90 ± 4.72 per 1000 cells), the number of stem cell spheres in the AR-C155858 group (11.00 ± 4.42 per 1000 cells) decreased significantly (P < 0.01). There was no significant difference in the diameter of stem cell spheres between the CHC inhibitor group and the control group 2 (86.921 ± 20.31 μm vs 101.87 ± 37.36 μm, P = 0.30). Compared with the AR-C155858 group (243.93 ± 84.41 μm), the cell diameter of the control group 2 was smaller (172.76 ± 55.60 μm) (P = 0.04).

[0071] 3.2 Detection of the invasiveness of OCSC by Matrigel migration chamber (Transwell) assay

[0072] OCSC diluted with serum-free DMEM medium was inoculated onto the upper chamber of the chamber containing Matrigel, and the working concentration of the intervention drug (CHC 24 nM, AR-C155858 10 nM) or an equal amount of DMSO was added. At the same time, DMEM containing 10% serum was added to the lower chamber. After incubation for 48 h, the cells were fixed, stained with crystal violet, and 5 random fields were counted under the microscope.

[0073] When the cells were treated with AR-C155858, there was a significant difference in the number of invasive cells between the AR-C155858 inhibitor group and the control group 2 (10.20 ± 5.98 vs. 67.20 ± 28.96, P = 0.01).

[0074] When the cells were treated with CHC, there was no significant difference in the number of invasive cells between the CHC inhibitor group and the control group 2 (112 ± 18.53 vs. 167 ± 51.83, P = 0.08).

[0075] Generally speaking, as Figure 4B shown, more cells in the control group 2 passed through the Matrigel membrane and pores, showing stronger invasiveness. The invasiveness of cells not treated with CHC and AR-C155858 was 1.49 times and 6.7 times that of the treated cells, respectively.

[0076] The test results show that inhibiting MCT2 can significantly reduce the stemness and invasiveness of OCSC.

[0077] In the present invention, primary ovarian cancer cells were obtained, an OCSC model was established by screening and culturing, and the MCT2 Ki-specific inhibitors (CHC, ARC155858) were used for intervention. Flow cytometry and qRT-PCR were used to identify OCSC markers, and qRT-PCR and immunofluorescence staining were used to detect the expression level and cellular localization of MCT2. The stem cell spheroid formation assay and the Matrigel migration chamber assay were used to verify the effects of MCT2 inhibitors on the stemness and invasiveness of OCSC.

[0078] The qRT-PCR results showed that the expression levels of MCT2 in the two samples of the OCSC group (5.78 ± 3.55 and 122.89 ± 19.90) were significantly higher than those in the control group 1 (1.01 ± 0.10 and 1.55 ± 1.45) (P < 0.05). Fluorescence quantitative analysis confirmed that the expression of MCT2 in the OCSC group was higher than that in the control group 1 (6.79 ± 0.67 AU vs 2.49 ± 1.78 AU, P = 0.03). The spheroid formation assay showed that the number of stem cell spheroids of OCSC in the α-cyano-4-hydroxycinnamic acid (CHC) inhibitor group was significantly lower than that in the control group 2 (6.00 ± 2.17 per 1000 cells vs 14.62 ± 3.07 per 1000 cells, P < 0.01), and the number of stem cell spheroids of OCSC in the AR-C155858 inhibitor group was significantly lower than that in the control group 2 (11.00 ± 4.42 per 1000 cells vs 23.90 ± 4.72 per 1000 cells, P < 0.01). There was a statistically significant difference in the number of invasive cells between the ARC155858 inhibitor group and the control group 2 (10.20 ± 5.98 vs. 67.20 ± 28.96, P = 0.01).

[0079] Therefore, MCT2 is highly expressed in OCSC, and inhibiting MCT2 can significantly reduce the stemness and invasiveness of OCSC. This finding provides a potential research direction for the targeted therapy of ovarian cancer.

[0080] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. The above embodiments and the descriptions in the specification are only preferred examples of the present invention and are not used to limit the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed. The scope of protection claimed by the present invention is defined by the appended claims and their equivalents.

Claims

1. Use of MCT2 protein as a biomarker in the preparation of products for identifying ovarian cancer stem cell products.

2. Use of MCT2 protein as a biomarker in the preparation of products for evaluating the therapeutic effect against ovarian cancer stem cells.

3. The application according to claim 2, wherein If the level of MCT2 protein after ovarian cancer treatment is lower than that before treatment, it is evaluated that the treatment against ovarian cancer stem cells is effective; If the level of MCT2 protein after ovarian cancer treatment is higher than that before treatment, it is evaluated that the therapeutic effect against ovarian cancer stem cells is poor.

4. Products for identifying ovarian cancer stem cells and / or products for evaluating the therapeutic effect against ovarian cancer stem cells, characterized in that, The product contains substances for detecting the level of MCT2 protein.

5. The product according to claim 4, wherein The product includes reagents, kits or chips.

6. The product according to claim 4, characterized in that, The content of the product includes at least one of the following: detection probes for MCT2, aptamers for MCT2.

Images