Transmembrane delivery systems and uses thereof

Abstract

The present invention relates to oligonucleotide conjugates, pharmaceutical compositions including the same, and methods of use thereof, such as for treating and / or preventing genetic or viral diseases in a subject.

Description

[0001] Reference Electronic Sequence Listing

[0002] The content of the electronic sequence listing (APSN-P-012-PCT.xml; size: 125,321 bytes; and creation date: September 21, 2023) is incorporated herein by reference in its entirety.

[0003] Cross-Reference to Related Applications

[0004] This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 408,888, filed on September 22, 2022, entitled "Trans-Membrane Delivery Systems and Uses Thereof"; U.S. Provisional Patent Application No. 63 / 436,644, filed on January 02, 2023, entitled "Trans-Membrane Delivery Systems and Uses Thereof", and U.S. Provisional Patent Application No. 63 / 436,642, filed on January 02, 2023, entitled "Trans-Membrane Delivery Systems and Uses Thereof". The content of each of them is incorporated herein by reference in its entirety. Background Art

[0005] The main challenges in applying macromolecular compounds (including viral vectors, bacterial vectors, single-stranded or double-stranded oligonucleotides, natural or modified RNA or DNA molecules or combinations thereof, siRNA (small interfering RNA), siRNA substrates (dsiRNA) of Dicer enzyme, microRNA (miRNA), messenger RNA (mRNA) drugs, DNA sequences designed as antisense oligonucleotides (ASO) for clinical practice) mainly involve intracellular delivery and optimization of their binding to plasma proteins (especially albumin).

[0006] Although showing great potential to advance medicine, all of these potential breakthrough gene drugs have a major limitation: since these drugs are composed of natural or modified oligonucleotides and their site of action is intracellular (cytoplasm or nucleus), all of these therapeutic agents must cross the hydrophobic barrier of the cell membrane. In fact, so far, this powerful delivery barrier has limited the development of the entire gene therapy field and hindered its implementation as a future medical practice. In addition, oligonucleotide drugs are large molecules (for example, the molecular weight of siRNA is ≈15,000 daltons), and each molecule carries a large number of negative charges (phosphate groups). In summary, the delivery of siRNA across the cell membrane is accompanied by very large energy consumption.

[0007] Currently, there are two main strategies for gene delivery across biological barriers: viral vectors and non-viral vectors. Each strategy has its own substantial limitations: the viral vector strategy is limited by low transfection efficiency, limited biodistribution, and low safety / significant toxicity of viral particles. In non-viral methods, cationic lipids and related liposomes used for siRNA delivery are also significantly limited by toxicity. Therefore, there is a great unmet need for a new, effective, and safer mode of delivering genetic material across the cell membrane based on a novel mechanism of action that optimally binds to plasma proteins. Summary of the Invention

[0008] Accordingly, the present invention provides a conjugate having a structure of general formula (I):

[0009]

[0010] including its pharmaceutically acceptable salts, hydrates, solvates, and metal chelates, wherein:

[0011] D is a compound selected from: single-stranded or double-stranded DNA, RNA, siRNA, dsiRNA, DNA enzyme, ASO, viral vector, bacterial vector, and any combination thereof;

[0012] Each of y, z, and w is an integer independently selected from 0, 1, 2, 3, or 4, where at least one of y, z, or w is not 0;

[0013] E, E', or E'' may be the same or different and each independently has a structure of general formula (II)

[0014]

[0015] including its pharmaceutically acceptable salts, hydrates, solvates, and metal chelates, wherein: X represents The salt thereof, or both, or X is absent; each of a, b, c, d, e, f, g is independently an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10; R represents one or more substituents, each independently selected from H, F, Cl, Br, I, provided that at least one of the one or more substituents is F; R5 is H or a straight-chain or branched C1-C5 alkyl; R6 is selected from H, hydroxyalkyl, and -(CH2) n R'; wherein, n is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and wherein, R' is selected from a bond, H, and phosphate or its salt; L1 is a linker selected from -NH-C(=O)-, -C(=O)NH-, -S-S-, and -S-C(=O); L2 is a linker selected from -O-, -S-, -CH2-; and * is an interaction / conjugation with D; or wherein, E, E', or E'' may be the same or different and each independently has the structure of formula (III), including its pharmaceutically acceptable salts, hydrates, solvates, and metal chelates, wherein: each of h, i, j, k is independently an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10; R7 is selected from H, hydroxyalkyl, and -(CH2) n R'; wherein, n is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and wherein, R' is selected from a bond, H, and phosphate or its salt; L3 is a linker selected from -NH-C(=O)-, -C(=O)NH-, -S-S-, and -NH-C(=O); L4 is a linker selected from -O-, -S-, CH2-; * is an interaction / conjugation with D; and wherein, X represents its salt or both, or is absent

[0016]

[0017] In some embodiments, R1-R4 are F. In some embodiments, R1, R2, R3 are H and R4 is F. In some embodiments, R1, R2, R4 are H and R3 is F. In some embodiments, R1, R3, R4 are H and R2 is F. In some embodiments, R2, R3, R4 are H and R1 is F. In some embodiments, R1 and R2 are H and R3 and R4 are F. In some embodiments, R3 and R4 are H and R1 and R2 are F. In some embodiments, R1, R2, R3 are F and R4 is H. In some embodiments, R1, R2, R4 are F and R3 is H. In some embodiments, R1, R3, R4 are F and R2 is H. In some embodiments, R2, R3, R4 are F and R1 is H.

[0018] In some embodiments, R5 is Me.

[0019] In some embodiments, R6 is -CH2OH. In some embodiments, R6 is H.

[0020] In some embodiments, L1 is -S-S-. In some embodiments, L1 is -S-C(=O).

[0021] In some embodiments, L3 is -S-S-. In some embodiments, L3 is -NH-C(=O).

[0022] In some embodiments, R7 is -CH2OH. In some embodiments, R7 is H.

[0023] In some embodiments, y is 0. In some embodiments, z is 0. In some embodiments, w is 0. In some embodiments, y and z are 0.

[0024] In some embodiments, D is a macromolecular drug. In some embodiments, D is an oligonucleotide drug comprising a natural or modified oligonucleotide chain and selected from siRNA, dsiRNA, mRNA, microRNA, DNAzyme, and ASO and any combination thereof. In some embodiments, D is a viral vector. In some embodiments, D is a bacterial vector.

[0025] The present invention further provides a pharmaceutical composition comprising the conjugate disclosed hereinabove and hereinbelow.

[0026] The present invention further provides a conjugate disclosed hereinabove and hereinbelow for gene therapy.

[0027] The present invention further provides a conjugate disclosed hereinabove and hereinbelow for treating hearing loss. The present invention further provides a conjugate disclosed hereinabove and hereinbelow for treating CNS diseases and disorders. The present invention further provides a conjugate disclosed hereinabove and hereinbelow for cell and gene therapy. The present invention further provides a conjugate disclosed hereinabove and hereinbelow for treating cancer. The present invention further provides a conjugate disclosed hereinabove and hereinbelow for inflammatory bowel disease (IBD).

[0028] The present invention further provides a precursor of the conjugate of general formula (II) disclosed hereinabove and hereinbelow, wherein * is coupled to a protecting group.

[0029] The present invention further provides a precursor of the conjugate of general formula (II) disclosed hereinabove and hereinbelow, wherein OH is coupled to a protecting group.

[0030] In some embodiments, the precursors of the present invention (i.e., one or more functional groups linked to a protecting group) are compounds having the following structures:

[0031]

[0032] In some embodiments, the precursors of the present invention (i.e., one or more functional groups linked to a protecting group) are compounds having the following structures: Apo-Si-K170B, Apo-Si-K170C.

[0033] In some embodiments, the precursors of the present invention (i.e., one or more functional groups linked to a protecting group) are compounds having the following structures:

[0034]

[0035] In some embodiments, the precursors of the present invention (i.e., one or more functional groups linked to a protecting group) are compounds having the following structures:

[0036]

[0037] In some embodiments, the precursors of the present invention (i.e., one or more functional groups linked to a protecting group) are compounds having the following structures:

[0038]

[0039] In some embodiments, the precursors of the present invention (i.e., one or more functional groups linked to a protecting group) are compounds having the following structures:

[0040] BRIEF DESCRIPTION OF THE DRAWINGS

[0041] The subject matter regarded as the invention is particularly pointed out and distinctly claimed in the concluding portion of the specification. However, the structure and method of operation of the present invention, together with its purpose, features, and advantages, may best be understood by reference to the following detailed description when read in conjunction with the accompanying drawings, in which:

[0042] Figure 1 Shows the protein-free fractions of exemplary conjugates of the present invention and a structurally similar analog (Apo-Si-S1) after incubation with BSA.

[0043] Figure 2Showed that incubation of Apo-Si-K-170-A, Apo-Si-K-170-B, and Apo-Si-K-170-C conjugates with glutathione (GSH) (5 mM, 4 hours at 37 °C) resulted in robust cleavage of the conjugates in the following order: Apo-Si-K-170-C > Apo-Si-K-170-A > Apo-Si-K-170-B >> Apo-Si-K-93-A.

[0044] Figures 3A - 3D Showed the EGFP silencing activity of Apo-Si-K-170-A, Apo-Si-K-170-B, Apo-Si-K-170-C, and Apo-Si-K941 conjugates in the Hela-GFP cell line. Figure 3A : In the Hela-GFP cell line, in the presence of complete medium and 10% serum, 600 nM of Apo-Si-K-170-A, Apo-Si-K-170-B, and Apo-Si-K-170-C conjugates reduced EGFP expression to 49.9%, 83.1%, and 70.8% of the untreated control, respectively. Figures 3B - 3D : Dose-dependent EGFP silencing activity of Apo-Si-K-170-A, Apo-Si-K-170-B, Apo-Si-K-170-C, and Apo-Si-K 941 in different cell lines (serum-free).

[0045] Figure 4 Showed that after intratracheal (IT) administration to ICR mice, the Apo-Si-K170A conjugate significantly reduced the mRNA expression of the epithelial sodium channel (ENaC) gene in the lung in a dose-responsive manner (100 - 200 μg / mouse / dose).

[0046] Figure 5 Showed that after IT administration in mice, Apo-Si-K170A conjugated with ENaC dsiRNA reduced the expression of the ENaC gene in the mouse lung, especially compared to Apo-Si-K170A conjugated with a control sequence.

[0047] Figure 6 Showed that after IT administration to mice, Apo-Si-K170A conjugated with ENaC dsiRNA was local and did not affect ENaC expression in the kidney and liver.

[0048] Figures 7A - 7F Showed at T + 30 hours after intracochlear (IC) administration, the naked dsiRNA treatment group (group 2) ( Figure 7D -F) and the Apo-Si-K170A dsiRNA conjugate treatment group at the base of the cochlea (IC) at T + 30 hours (group 4) (Figure 7A Comparison of Cy3 staining between -C).

[0049] Figures 8A - 8C Is a bar graph showing the downregulation of the PMP-22 target gene by the Apo-Si-K1000 construct. Cells were transfected with the Apo-Si-K1000 construct. RNA was later extracted from the cells 48 and RT-qPCR analysis was performed 8A. 3T3-NIH cells (N = 5; n = 2-10) 8B. Schwann cells S16 (N = 2; n = 2-4) 8C. HeLa cells (N = 2; n = 2-4).

[0050] Figure 9 Shows the results of plaque assays in an RSV-infected mouse model after IT administration with the Apo-Si-K170A construct.

[0051] Figures 10A - 10B Shows the qRT-PCR results of oropharyngeal (10A) and BALF (10B) swabs in the AGM.

[0052] Figures 11A - 11C Shows SARS-CoV2 genome qRT-PCR in the AGM; results over time for nasal swabs (11A), oropharynx (11B), and BALF (11C).

[0053] Figures 12A - 12B Shows that Apo-Si-K170A STAT6 downregulates IL-4 (12A) & IL-13 (12B) cytokines in the BALF of an asthma mouse model.

[0054] Figure 13 Shows the effect of Apo-Si-K170A STAT6 on total lgE in the plasma of an asthma mouse model.

[0055] Figure 14 Shows the in vitro SPARC silencing efficiency of Apo-Si-K-170A-SPARC (lead conjugate) compared to an unrelated negative control (dsiDyn1i2#1).

[0056] Figure 15 Shows the downregulation of the ENaC target gene at different concentrations of Apo-Si-K-170A-SPARC compared to an unrelated negative control (K170A-Dyn1i2).

[0057] Figures 16A - 16D Shows the dose-dependent inhibition of influenza A virus in MDCK cells by the Apo-Si-K170A-dsiRNA construct. Figure 16A : K170A-MF03-PB1, Figure 16B: K170A-MF43-PB2, Figure 16C : K170A-MF13-PB1, Figure 16D : K170A-MF45-PB2.

[0058] It will be understood that, for simplicity and clarity of illustration, the elements shown in the figures are not necessarily drawn to scale. For example, for clarity, the dimensions of some elements may be exaggerated relative to other elements. Additionally, where considered appropriate, reference numerals may be repeated among the figures to indicate corresponding or similar elements. Detailed Description

[0059] In the following detailed description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. However, those skilled in the art will understand that the present invention may be practiced without these specific details. In other instances, well-known methods, procedures, and components have not been described in detail so as not to obscure the present invention.

[0060] In one aspect of the present invention, there is provided a conjugate having the structure of general formula (I):

[0061]

[0062] including its pharmaceutically acceptable salts, hydrates, solvates, and metal chelates, wherein D is a polynucleic acid; each of y, z, and w is an integer independently selected from 0, 1, 2, 3, or 4, provided that at least one of y, z, or w is not 0; E, E', or E'' may be the same or different and each independently has the structure of general formula (II):

[0063] including its pharmaceutically acceptable salts, hydrates, solvates, and metal chelates, wherein X represents its salt or both, or X is absent; each of a, b, c, d, e, f, g is independently selected from the integers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 1 - 10; R represents one or more substituents each independently selected from H, F, Cl, Br, and I, provided that at least one of the one or more substituents is F; R5 is H or a straight-chain or branched C1 - C5 alkyl; R6 is selected from H, -(CH2) n OH, hydroxyalkyl, -(CH2) n R' and -(CH2) nO*; wherein n is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 1 - 10; and wherein R' is selected from a bond, H, and a phosphate group and / or its salt; L1 is selected from (i) -X-C(=X)-, wherein each X independently represents N, NH, S or O; and (ii) linking groups of -NH-C(=O)-, -C(=O)NH-, S-C(=O)-, -S-S- and -S-C(=O); L2 is absent or is a linking group selected from -O-, -S-, -CH2-; and wherein * represents the point of attachment or conjugation to D. In some embodiments, R represents at least 2 substituents each independently selected from F, Cl, Br and I. In some embodiments, R represents 2 or 3 substituents each independently selected from F, Cl, Br and I. In some embodiments, R represents 2 or 3 fluoro substituents.

[0064] In some embodiments, any one of E, E' and E'' independently binds to: (i) an end site of the sequence of D (e.g., the 3' or 5' of one or more polynucleotides), or (ii) an internal site of the sequence of D. In some embodiments, the conjugate of the present invention has multiple E, E' or E'' moieties that bind to the end site of the sequence of D. In some embodiments, the conjugate of the present invention further includes at least one of E, E' or E'' that binds to an internal site of the sequence of D.

[0065] In some embodiments, the conjugate of the present invention is represented by formula (I), wherein D is a polynucleotide; wherein at least two of y, z or w are not 0; and wherein R6 of at least one of E, E' and E'' is -(CH2) n O* (i.e., having two points of attachment to D). In some embodiments, the conjugate of the present invention is as described herein; wherein D is a polynucleotide; and the conjugate includes two or more (e.g., 2, 3 or 4) of E, E' and E''; wherein R6 of at least one of E, E' and E'' is -(CH2) n O* (i.e., binding at the middle of the sequence of D), and wherein R6 of at least one additional E, E' and E'' is selected from H, -(CH2) n OH, hydroxyalkyl and -(CH2) nR' (i.e., binds to the 3' or 5' end of the sequence of D). In some embodiments, the conjugates of the present invention are as described herein; wherein D is a polynucleotide, and wherein the conjugates of the present invention include two of E, E', and E'' that bind to the 3' or 5' end of the sequence of D. In some embodiments, the conjugates of the present invention include 2 E, E', or E'' moieties that bind to D. In some embodiments, the conjugates of the present invention include 3 E, E', or E'' moieties that bind to D. In some embodiments, the conjugates of the present invention include 4 E, E', or E'' moieties that bind to D.

[0066] In some embodiments, each of E, E', or E'' is independently represented by formula (II1): including any of its salts; wherein a, b, c, d, e, f, g, R, R5, and R6 are as described above.

[0067] In some embodiments, each of E, E', or E'' is independently represented by formula (IIa):

[0068]

[0069] wherein each of R1 - R4 is independently selected from H, F, Cl, Br, I; wherein at least one of R1 - R4 is not H. In some embodiments, each of R1, R2, R3, and R4 is independently selected from H, F, Cl, Br, I; wherein at least one of R1, R2, R3, and R4 is F.

[0070] In some embodiments, each of E, E', or E'' is independently represented by formula (IIa1):

[0071] wherein each of R1 - R4 is independently selected from H, F, Cl, Br, and I; wherein at least one of R1 - R4 is not H, wherein R5 is an alkyl; wherein X is absent or represents its salt or both; wherein a is 3; wherein b is between 1 and 5; c is between 1 and 3; and each of d, e, f, and g is between 1 and 10; and wherein X, R6, and L1 are as described above.

[0072] In some embodiments, each of E, E', or E” is independently represented by any one of formulas (II)-(IIa1), where L1 is -X-C(=X)-, and where L2 is -O-, -S-, or absent. In some embodiments, each of E, E', or E” is independently represented by any one of formulas (II)-(IIa1), where L1 is -X-C(=X)-; where a is 3; where b is 1; c is 1; and each of d, e, f, and g is between 1 and 10; and where L2 is absent. In some embodiments, each of E, E', or E” is independently represented by any one of formulas (II)-(IIa1), where L1 is selected from -NH-C(=O)-, -C(=O)NH-, S-C(=O)-, and -S-C(=O); where a is 3; where b is 1; c is 1; and each of d, e, f, and g is between 1 and 10; and where L2 is absent.

[0073] In some embodiments, the conjugate of the present invention includes one or more E, E', or E” moieties, where each of E, E', and E” is independently represented by any one of formulas (II)-(IIa1), where L1 is selected from -NH-C(=O)-, -C(=O)NH-, S-C(=O)-, and -S-C(=O); where a is 3; where b is 1; c is 1; and each of d, e, f, and g is between 1 and 10; and where L2 is absent; and where the conjugate is for systemic administration (e.g., in the form of a pharmaceutical composition formulated for systemic administration). In some embodiments, the conjugate of the present invention includes at least 2 E, E', or E” moieties (e.g., 2 or 3), where each of E, E', and E” is independently represented by any one of formulas (II)-(IIa1), where L1 is selected from -NH-C(=O)-, -C(=O)NH-, S-C(=O)-, and -S-C(=O); where a is 3; where b is 1; c is 1; and each of d, e, f, and g is between 1 and 10; and where L2 is absent.

[0074] And where the conjugate is for systemic administration (e.g., in the form of a pharmaceutical composition formulated for systemic administration). In some embodiments, each of E, E', or E” is independently represented by formula (II), formula (II1), formula (IIa), or formula (IIa1), where L1 is -S-S-, and where L2 is -O- or -S-.

[0075] In some embodiments, each of E, E', or E” is independently represented by formula (IIb):

[0076]

[0077] wherein: a is between 1 and 5; b is between 1 and 3; c is between 1 and 3; and each of d, e, f, and g is between 1 and 10. In some embodiments, each of a, b, and c is between 1 and 3, and each of d, e, f, and g is between 1 and 10.

[0078] In some embodiments, each of E, E', or E'' is independently represented by formula (IIb), wherein a is 3; wherein b is 1; c is between 1 and 3; and each of d, e, f, and g is between 1 and 10. In some embodiments, the conjugate of the present invention comprises one or more E, E', or E'' moieties, wherein each of E, E', and E'' is independently represented by formula (IIb), wherein a is 3; wherein b is 1; c is 1; and each of d, e, f, and g is between 1 and 10; and wherein the conjugate is for topical administration (e.g., in the form of a pharmaceutical composition formulated for topical administration). In some embodiments, the conjugate of the present invention comprises at least 2 E, E', or E'' moieties (e.g., 2 or 3), wherein each of E, E', and E'' is independently represented by formula (IIb), wherein a is 3; wherein b is 1; c is 1; and each of d, e, f, and g is between 1 and 10; and wherein the conjugate is for topical administration (e.g., in the form of a pharmaceutical composition formulated for topical administration).

[0079] In some embodiments, R1 and R3 are F. In some embodiments, R1 and R3 are F. In some embodiments, R2 and R4 are F. In some embodiments, one of R1, R3, and one of R4 and R2 is F. In some embodiments, R1 and R4 are F. In some embodiments, R2 and R3 are F.

[0080] In some embodiments, each of E, E', or E'' is independently represented by formula (IIc):

[0081]

[0082] wherein a is between 1 and 5, and each of d, e, f, and g is between 1 and 10.

[0083] In some embodiments, each of E, E', or E'' is independently represented by formula (IId):

[0084]

[0085] wherein R1 - R4 are as described above, and wherein R5 is C1 - C5 alkyl.

[0086] In some embodiments, each of E, E', or E'' is independently represented by formula (IIIa):

[0087] including its pharmaceutically acceptable salts, hydrates, solvates, and metal chelates, wherein: each of i, j, k, and l is independently an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10; L3 is a linking group selected from (i) -X-C(=X)-, wherein each X independently represents N, NH, S, or O; and (ii) -NH-C(=O)-, -C(=O)NH-, S-C(=O)-, -S-S-, and -S-C(=O); L4 is a linking group selected from -O-, -S-, -CH2-, or is absent; wherein, a, R6, L1, and L2 are as described above; and wherein, * is the point of attachment or conjugation to D.

[0088] In some embodiments, each of E, E', or E'' is independently represented by formula IIIa1: including its pharmaceutically acceptable salts, hydrates, solvates, and metal chelates, wherein: each of i, j, k, and l is independently an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10; each L3 is independently a linking group selected from -O-, -S-, -CH2-, -NH-C(=O)-, -C(=O)NH-, -S-S-, S-C(=O)-, and -S-C(=O), optionally wherein one L3 is absent; wherein, a, R6, L1, and L2 are as described above; and wherein, * is the point of attachment or conjugation to D. The integers R6 and R7 are used interchangeably herein.

[0089] In some embodiments, each of E, E', or E'' is independently represented by formula (IIIb):

[0090]

[0091] wherein, i, j, k, l, a, R6, L3 are as described above. In some embodiments, each of E, E', or E'' is independently represented by formula (IIIa-c), wherein each of a, i, j, and k is independently between 1 and 5, or between 1 and 3.

[0092] In some embodiments, each of E, E', or E'' is independently represented by formula (IIIb), where i is 1, where j and k are independently between 1 and 5; and where L4 is absent. In some embodiments, the conjugate of the present invention comprises one or more E, E', or E'' moieties, where each of E, E', and E'' is independently represented by formula (IIIb), where i is 1, where j and k are independently between 1 and 5; and where L4 is absent; and where the conjugate is for topical administration (e.g., in the form of a pharmaceutical composition formulated for topical administration). In some embodiments, the conjugate of the present invention comprises at least 2 E, E', or E'' moieties (e.g., 2 or 3), where each of E, E', and E'' is independently represented by formula (IIIb), where i is 1, where j and k are independently between 1 and 5; and where L4 is absent; and where the conjugate is for topical administration (e.g., in the form of a pharmaceutical composition formulated for topical administration).

[0093] In some embodiments, each of E, E', or E'' is independently represented by formula (IIIc), where i is 1, where j and k are independently between 1 and 5; and where L3 is selected from -NH-C(=O)-, -C(=O)NH-, S-C(=O)-, and -S-C(=O). In some embodiments, the conjugate of the present invention comprises one or more E, E', or E'' moieties, where each of E, E', and E'' is independently represented by formula (IIIc), where i is 1, where j and k are independently between 1 and 5; and where L3 is selected from -NH-C(=O)-, -C(=O)NH-, S-C(=O)-, and -S-C(=O); and where the conjugate is for systemic administration (e.g., in the form of a pharmaceutical composition formulated for systemic administration). In some embodiments, the conjugate of the present invention comprises at least 2 E, E', or E'' moieties (e.g., 2 or 3), where each of E, E', and E'' is independently represented by formula (IIIc), where i is 1, where j and k are independently between 1 and 5; and where L3 is selected from -NH-C(=O)-, -C(=O)NH-, S-C(=O)-, and -S-C(=O); and where the conjugate is for systemic administration (e.g., in the form of a pharmaceutical composition formulated for systemic administration).

[0094] In some embodiments, each of E, E', or E'' is independently represented by formula (IIId):

[0095] as defined above, where L3, L4, X, and R6 are as defined above.

[0096] In some embodiments, each of E, E', or E'' is independently selected from:

[0097]

[0098]

[0099] wherein R6' is OH, a phosphate group, or O*, and wherein * is the point of attachment or conjugation of D.

[0100] In some embodiments, D is a polynucleic acid molecule (polynucleotide). In some embodiments, D is DNA. In some embodiments, D is RNA. In some embodiments, the polynucleic acid molecule is an oligonucleotide. In some embodiments, D is an aptamer. In some embodiments, D is a primer. In some embodiments, D is an antisense oligonucleotide. In some embodiments, D is a regulatory RNA. In some embodiments, D is a plasmid. In some embodiments, D is an expression vector. In some embodiments, the vector is configured to be expressed in a target cell. In some embodiments, D is gene therapy. In some embodiments, the polynucleic acid molecule includes an open reading frame. In some embodiments, the open reading frame encodes a therapeutic protein. Methods of conjugating polynucleic acid molecules with chemical and amino acid linkers are well known in the art and any such method can be employed. In some embodiments, the polynucleic acid molecule includes a nuclear localization signal (NLS).

[0101] The term "polynucleic acid" is well known in the art. As used herein, "polynucleic acid" generally refers to a molecule (i.e., a strand) of DNA, RNA, or a derivative or analog thereof that includes multiple (e.g., at least 2) nucleobases. Nucleobases include, for example, naturally occurring purine or pyrimidine bases found in DNA (e.g., adenine "A", guanine "G", thymine "T", or cytosine "C") or in RNA (e.g., A, G, uracil "U", or C), and also encompasses chemically modified nucleobases or nucleotides such as O-methylated nucleotides, N-methylated nucleotides, phosphorothioate nucleotides, backbone-modified nucleotides (LNA, morpholino).

[0102] The term "polynucleic acid molecule" includes, but is not limited to, single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), small RNAs such as miRNA, siRNA and other short interfering nucleic acids, snoRNA, snRNA, tRNA, piRNA, tnRNA, small rRNA, hnRNA, lncRNA, circular polynucleic acids, fragments of genomic DNA or RNA, degraded nucleic acids, ribozymes, viral RNA or DNA, polynucleic acids of infectious origin, amplification products, modified nucleic acids, plasmid nucleic acids or organelle nucleic acids and artificial nucleic acids such as oligonucleotides.

[0103] As used herein, the term "oligonucleotide" refers to short (e.g., no more than 100 bases), chemically synthesized single-stranded DNA or RNA molecules. In some embodiments, the oligonucleotide is linked to the 5' or 3' end of a nucleic acid molecule, such as by means of a ligation reaction.

[0104] In some embodiments, the polynucleotide comprises or consists of RNA. The polynucleotide comprises or consists of messenger RNA (mRNA). "Messenger RNA" (mRNA) refers to any polynucleotide that encodes a (at least one) polypeptide (a polymer of natural, non-natural or modified amino acids), and can be translated in vitro, in vivo, in situ or ex vivo to produce the encoded polypeptide. The basic components of an mRNA molecule typically include at least one coding region, a 5' untranslated region (UTR), a 3' UTR, a 5' cap and a poly-A tail. The polynucleotide can function as mRNA, but can differ from wild-type mRNA in their functional and / or structural design features, which are used to overcome existing problems in the efficient expression of polypeptides using nucleic acid-based therapeutic agents.

[0105] The mRNA provided herein comprises at least one (one or more) ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one polypeptide of interest.

[0106] In some embodiments, the polynucleotide is or comprises a therapeutic polynucleotide. As used herein, the term "therapeutic polynucleotide" refers to a polynucleotide sequence encoding a therapeutic protein, or a polynucleotide sequence complementary to a sequence of interest (mutant gene). A therapeutic polynucleotide having a complementary sequence to a mutant gene is also referred to herein as an "inhibitory nucleic acid".

[0107] Therapeutic proteins mediate a variety of effects in host cells or subjects to treat diseases or improve disease signs and symptoms. For example, therapeutic proteins can replace defective or abnormal proteins, enhance the function of endogenous proteins, provide new functions to cells (e.g., inhibit or activate endogenous cell activities, or act as a delivery agent for another therapeutic compound (e.g., an antibody-drug conjugate)). Therapeutic polynucleotides can be used to treat the following diseases and disorders: bacterial infections, viral infections, parasitic infections, cell proliferation disorders, genetic disorders, and autoimmune disorders.

[0108] Accordingly, the polynucleotides of the present invention can be used as therapeutic or prophylactic agents. They are provided for medical use. For example, the polynucleotides described herein can be administered to a subject, wherein the polynucleotide is translated in vivo to produce a therapeutic peptide.

[0109] In some embodiments, the therapeutic polynucleotide includes an inhibitory nucleic acid. In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide.

[0110] As used herein, "antisense oligonucleotide" refers to a nucleic acid sequence that is reverse and complementary to a DNA or RNA sequence.

[0111] As described herein, a "reverse and complementary nucleic acid sequence" is a nucleic acid sequence capable of hybridizing to another nucleic acid sequence composed of complementary nucleobases. "Hybridization" means the pairing of complementary nucleobases to form a double-stranded molecule under suitable stringent conditions (e.g., adenine (A) pairs with thymine (T) (or uracil (U) in the case of RNA), and guanine (G) pairs with cytosine (C)). (See, e.g., Wahl, G.M. and S.L.Berger (1987) Methods Enzymol. 152:399; Kimmel, A.R. (1987) Methods Enzymol. 152:507). For the purposes of the present methods, the inhibitory nucleic acid need not be complementary to the entire sequence, as long as it is sufficient to provide specific inhibition; for example, in some embodiments, the sequence is at least 100% complementary to nucleotides (nts) 2-7 or 2-8 (e.g., the "seed sequence") of the 5' end of the microRNA itself, such as nts 2-7 or 20.

[0112] In some embodiments, the inhibitory nucleic acid has one or more chemical modifications to the backbone or side chain. In some embodiments, the inhibitory nucleic acid has at least one locked nucleic acid, and / or has a phosphorothioate backbone.

[0113] Non-limiting examples of inhibitory nucleic acids useful in the invention disclosed herein include, but are not limited to: antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single-stranded or double-stranded RNA interference (RNAi) compounds such as siRNA compounds, modified bases / locked nucleic acids (LNA), antagomir, peptide nucleic acids (PNA), ribozymes (catalytic RNA molecules capable of cleaving other specific sequences of RNA molecules), and other oligomeric compounds or oligonucleotide mimetics that hybridize to at least a portion of a target nucleic acid and modulate its function. In some embodiments, the inhibitory nucleic acid includes antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides comprising modified linkages, interfering RNA (RNAi), short interfering RNA (siRNA); microRNA (miRNA); small temporal RNA (stRNA); or short hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small activating RNA (saRNA), or combinations thereof.

[0114] In some embodiments, the inhibitory nucleic acid is an RNA interference molecule (RNAi). In some embodiments, the RNAi is or comprises double-stranded RNA (dsRNA).

[0115] As used herein, "interfering RNA" refers to any double-stranded or single-stranded RNA sequence capable of directly or indirectly (i.e., through transfection) inhibiting or downregulating gene expression by mediating RNA interference. Interfering RNA includes, but is not limited to, small interfering RNA ("siRNA") and small hairpin RNA ("shRNA"). "RNA interference" refers to the selective degradation of messenger RNA transcripts that are sequence-compatible.

[0116] In some embodiments, the polynucleotide is chemically modified. In some embodiments, the chemical modification is a modification of the backbone of the polynucleotide. In some embodiments, the chemical modification is a modification of the sugar of the polynucleotide. In some embodiments, the chemical modification is a modification of the nucleobase of the polynucleotide. In some embodiments, the chemical modification increases the stability of the polynucleotide in cells. In some embodiments, the chemical modification increases the stability of the polynucleotide in vivo. In some embodiments, the chemical modification increases the stability of the polynucleotide in vitro (such as outdoors, in the wild, on surfaces exposed to air, etc.). In some embodiments, the chemical modification increases the ability of the polynucleotide to induce target gene or sequence silencing, including but not limited to RNA molecules derived from pathogens or RNA derived from plant cells, as described herein. In some embodiments, the chemical modification is selected from: phospho-ribose backbone, phospho-deoxyribose backbone, phosphorothioate-deoxyribose backbone, 2'-O-methyl phosphorothioate backbone, phosphorodiamidate morpholino backbone, peptide nucleic acid backbone, 2-methoxyethyl phosphorothioate backbone, constrained ethyl backbone, alternating locked nucleic acid backbone, phosphorothioate backbone, N3'-P5' phosphoramidate, 2'-deoxy-2'-fluoro-β-D-arabinonucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclic DNA (tcDNA) nucleic acid backbone, ligand-conjugated antisense nucleic acid, and combinations thereof.

[0117] As used herein, the terms "oligonucleotide" and "polynucleotide" refer to polymers / oligomers containing nucleotides as repeating units. Generally, oligonucleotides contain 2 - 100 bases. Generally, polynucleotides contain 2 - 1000 bases. In another embodiment, the term "polynucleotide" refers to a molecule comprising 5 - 1000, 5 - 200, 5 - 300, 5 - 500, 5 - 700, 5 - 5000, 5 - 1000, 20 - 100, 20 - 1000, 50 - 200, 50 - 500, 50 - 1000, 50 - 100 (including any range therebetween) bases. In another embodiment, the term "oligonucleotide" refers to a molecule comprising 5 - 100 bases. In another embodiment, the term "oligonucleotide" refers to a molecule comprising 5 - 80 bases. In another embodiment, the term "oligonucleotide" refers to a molecule comprising 5 - 40 bases. In another embodiment, the term "oligonucleotide" refers to a molecule comprising 50 - 100 bases. In another embodiment, the term "oligonucleotide" refers to a molecule comprising 20 - 70 bases. In another embodiment, the term "oligonucleotide" refers to a molecule comprising 5 - 30 bases. In another embodiment, the term "oligonucleotide" refers to a molecule comprising 5 - 25 bases. In another embodiment, the term "oligonucleotide" refers to a molecule comprising 10 - 50, 20 - 50, 5 - 50, 10 - 100 bases (including any range therebetween).

[0118] As used herein, the term "expression" refers to the biosynthesis of a gene product, including transcription and / or translation of the gene product. Thus, expression of a nucleic acid molecule can refer to transcription of a polynucleotide fragment (e.g., transcription that produces mRNA or other functional RNA) and / or translation of the RNA into a precursor or mature protein (polypeptide).

[0119] Expression of a gene in a cell is well known to those skilled in the art, and its delivery herein can be carried out by the methods of the present invention or using the compositions of the present invention. In some embodiments, the gene is in an expression vector, such as a plasmid or viral vector. The vector can be a viral vector. The viral vector can be a retroviral vector, a herpesvirus vector, an adenovirus vector, an adeno-associated virus vector, or a poxvirus vector. The promoter can be active in mammalian cells. The promoter can be a viral promoter.

[0120] In some embodiments, the gene or open reading frame is operably linked to a promoter or other regulatory element. The term "operably linked" means that a nucleotide sequence of interest is linked to one or more regulatory elements in a manner that permits expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell when a vector is introduced into the host cell by the methods of the present invention). In some embodiments, the regulatory element or promoter is active in the target cell.

[0121] As used herein, the term "promoter" refers to a set of transcriptional control modules that cluster around the start site of RNA polymerase (i.e., RNA polymerase II). The promoter consists of discrete functional modules, each of which consists of approximately 7-20 bp of DNA and contains one or more recognition sites for transcriptional activator or repressor proteins.

[0122] In some embodiments, the nucleic acid sequence is transcribed by RNA polymerase II (RNAP II and Pol II). RNAP II is an enzyme found in eukaryotic cells. It catalyzes the transcription of DNA to synthesize mRNA and precursors of most snRNA and microRNA.

[0123] In some embodiments, mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(±), pGL3, pZeoSV2(±), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81 (which are available from Invitrogen), pCI (which is available from Promega), pMbac, pPbac, pBK-RSV and pBK-CMV (which are available from Strategene), pTRES (which is available from Clontech), and derivatives thereof.

[0124] In some embodiments, the present invention uses expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses. SV40 vectors include pSVT7 and pMT2. In some embodiments, vectors derived from bovine papillomavirus include pBV-1MTHA, and vectors derived from Epstein Bar virus include pHEBO and p2O5. Other exemplary vectors include pMSG, pAV009 / A+, pMTO10 / A+, pMAMneo-5, baculovirus pDSVE, and any other vector that allows expression of a protein under the direction of an SV-40 early promoter, SV-40 late promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedron protein promoter, or any other promoter that exhibits efficient expression in eukaryotic cells.

[0125] In some embodiments, recombinant viral vectors are used for in vivo expression, which provides advantages such as lateral infection and target specificity. In one embodiment, lateral infection is, for example, inherent in the life cycle of retroviruses and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. In one embodiment, the result is that a large area is rapidly infected, most of which were initially not infected by the original viral particles. In one embodiment, viral vectors that cannot spread laterally are produced. In one embodiment, this feature may be useful if the desired goal is to introduce a specific gene into only a local number of target cells.

[0126] The term "bioactive" refers to a molecule or agent that exerts an effect on cells or tissues. Representative examples of types of bioactive agents include therapeutic agents, vitamins, electrolytes, amino acids, peptides, polypeptides, proteins, enzymes, carbohydrates, lipids, polysaccharides, nucleic acids, nucleotides, polynucleotides, glycoproteins, lipoproteins, glycolipids, glycosaminoglycans, proteoglycans, growth factors, differentiation factors, hormones, neurotransmitters, prostaglandins, immunoglobulins, cytokines, and antigens. Various combinations of these molecules can be used. Examples of cytokines include macrophage-derived chemokines, macrophage inflammatory proteins, interleukins, and tumor necrosis factors. Examples of proteins include fibrous proteins (e.g., collagen, elastin) and adhesion proteins (e.g., actin, fibrin, fibrinogen, fibronectin, vitronectin, laminin, cadherin, selectin, intracellular adhesion molecule, and integrin). In various cases, the bioactive agent can be selected from fibronectin, laminin, thrombospondin, tenascin C, leptin, leukemia inhibitory factor, RGD peptide, anti-TNF, endostatin, angiostatin, thrombospondin, osteogenic protein-1, bone morphogenetic protein, osteonectin, somatomedin-like peptide, osteocalcin, interferon, and interleukin. In some embodiments, the bioactive agent includes a growth factor, a differentiation factor, or a combination thereof.

[0127] In some embodiments, the conjugates of the present invention are characterized by any one of the following: increased gene expression regulatory activity in a subject or intracellularly (e.g., gene downregulation or upregulation); increased intracellular release of D (via cleavage of the L1 or L3 moiety); increased free conjugate moiety (i.e., conjugate not bound to a protein or any other biopolymer) in blood, serum or any other biological fluid; and reduced serum protein binding. In some embodiments, the conjugates of the present invention are characterized by increased in vitro gene expression regulatory activity in the presence of serum. The terms “increased” and “reduced” include any of their grammatical forms and cover, respectively, a decrease or increase of at least 20%, 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99%, at least 100%, at least 200%, at least 1000%, at least 10000%, or between 20% and 500%, between 50% and 1000% compared to a control. In some embodiments, the control is a conjugate according to general formula (I) comprising a scrambled sequence of D. In some embodiments, the control is a conjugate according to general formula (I) comprising the same D sequence; wherein E, E' or E” is a structural analogue of the E, E' or E” moiety disclosed herein; and wherein the structural analogue is not any of the formulas or structures given herein. In some embodiments, the structural analogue is Apo-Si-S1 or Apo-Si-K-93A. In some embodiments, the structural analogue is Apo-K-160-A (see the Examples section).

[0128] In some embodiments, the conjugates of the present invention and / or their pharmaceutically acceptable salts are formulated in the form of a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises one or more conjugates of the present invention and a pharmaceutically acceptable carrier, excipient or adjuvant. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of one or more conjugates of the present invention.

[0129] As used herein, the terms "carrier", "excipient" or "adjuvant" refer to any component of a pharmaceutical composition that is not an active agent. As used herein, the term "pharmaceutically acceptable carrier" refers to a non-toxic, inert solid, semi-solid or liquid filler, diluent, encapsulating material, any type of formulation aid, or simply a sterile aqueous medium such as saline. Some examples of materials that can be used as pharmaceutically acceptable carriers are sugars such as lactose, glucose and sucrose, diols such as propylene glycol, polyols such as glycerol, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate, pyrogen-free water; isotonic saline, Ringer's solution; ethanol and phosphate buffer solutions, and other non-toxic compatible substances used in pharmaceutical formulations. Some non-limiting examples of substances that can be used as carriers herein include sugars, stearic acid, magnesium stearate, calcium sulfate, polyols, pyrogen-free water, isotonic saline, phosphate buffer solutions, and other non-toxic pharmaceutically compatible substances used in other pharmaceutical formulations. Wetting agents and lubricants such as sodium lauryl sulfate, and excipients, stabilizers, antioxidants and preservatives may also be present. Any non-toxic, inert and effective carrier can be used to formulate the compositions described herein.

[0130] Carriers can total from about 0.1% to about 99.99999% by weight of the pharmaceutical compositions described herein.

[0131] In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of a conjugate of the invention. In some embodiments, the compositions of the invention are administered in a therapeutically safe and effective amount. As used herein, the term "safe and effective amount" refers to an amount of a component that, when used in the manner presently described, is sufficient to produce the desired therapeutic response without undue adverse side effects (including but not limited to toxicity such as calcification, irritation or allergic response), commensurate with a reasonable benefit / risk ratio. The actual amount administered, as well as the rate and time course of administration, will depend on the nature and severity of the condition being treated. The treatment prescription (e.g., decisions regarding dosage, timing, etc.) is the responsibility of the general practitioner or specialist and typically takes into account the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to the practitioner. Examples of techniques and protocols can be found in Remington: The Science and Practice of Pharmacy, 21st Ed., Lippincott Williams & Wilkins, Philadelphia, Pa., (2005).

[0132] In some embodiments, an effective amount or dose of the active ingredient can be initially estimated from in vitro assays. In one embodiment, a dose can be formulated in an animal model and this information can be used to more accurately determine a useful dose in humans.

[0133] In one embodiment, the toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmacological procedures in vitro, in cell cultures, or in experimental animals. In one embodiment, data obtained from these in vitro and cell culture assays and animal studies can be used to formulate a range of doses for humans. In one embodiment, the dose may vary depending on the dosage form employed and the route of administration utilized. In one embodiment, the specific formulation, route of administration, and dose may be selected by an individual physician based on the condition of the patient. [See, e.g., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 13th Ed., McGraw-Hill / Education, New York, NY (2017)]. The term "therapeutically effective amount" refers to the amount of a drug that is effective in treating a disease or disorder in a mammal. The term "therapeutically effective amount" refers to the amount that is effective in achieving the desired therapeutic or prophylactic outcome at the necessary dose and for the necessary period of time. The exact dosage form and regimen will be determined by the physician based on the condition of the patient.

[0134] In some embodiments, provided is a method for preventing or treating a genetic disease in a subject in need thereof and / or for alleviating at least one symptom associated with a disease related to a mutant gene, comprising administering to the subject a therapeutically effective amount of the pharmaceutical composition of the present invention. In some embodiments, the therapeutically effective amount is sufficient to alleviate at least one symptom, or to alleviate the severity and / or inhibit the progression of the above-mentioned disease, disorder, or condition. In some embodiments, the therapeutically effective amount is sufficient to inhibit the translation of the mutant gene. In some embodiments, the therapeutically effective amount is sufficient to inhibit the transcription of the mutant gene. In some embodiments, the genetic disease is associated with an abnormal (e.g., increased) expression of a specific gene as compared to a control. In some embodiments, the abnormal expression includes an increase in gene expression of at least 2-fold, at least 5-fold, at least 10-fold, or more as compared to a healthy individual with normal expression of the specific gene, including any range therebetween.

[0135] In some embodiments, "significantly reduced", including any grammatical form thereof, encompasses a reduction of at least 20%, 30%, 40%, 50%, at least 60%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 100%, at least 200%, at least 1000%, at least 10000% in the transcription and / or translation of the mutant gene in a subject as compared to a control.

[0136] In some embodiments, the therapeutically effective amount is sufficient to significantly reduce or completely inhibit any one of one or more biological activities of a cell comprising the mutant gene (e.g., cell proliferation, metabolism, etc.).

[0137] In some embodiments, a therapeutically effective amount is sufficient to significantly reduce or completely eliminate the viral load in a subject. In some embodiments, a therapeutically effective amount is sufficient to significantly reduce or completely eliminate viral proliferation in a subject.

[0138] In some embodiments, "significantly reduce", including any grammatical form thereof, encompasses a reduction in viral load in a subject of at least 20%, 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99% compared to a control.

[0139] In some embodiments, "significantly reduce", including any grammatical form thereof, encompasses a reduction in viral proliferation in a subject of at least 20%, 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99%, at least 100%, at least 200%, at least 1000%, at least 10000% compared to a control. In some embodiments, "significantly reduce", including any grammatical form thereof, encompasses a reduction in the expression of at least one viral gene in a subject of at least 20%, 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99%, at least 100%, at least 200%, at least 1000%, at least 10000% compared to a control.

[0140] In some embodiments, the control includes an untreated subject with a disease. In some embodiments, the control includes an untreated subject with a mutant gene. In some embodiments, the control includes an untreated subject with a disease or disorder associated with a mutant gene. In some embodiments, the control includes an untreated subject with abnormal expression of a specific gene.

[0141] In some embodiments, administration includes local or systemic administration. In some embodiments, administration includes intradermal, intravenous, intramuscular, intralesional, subcutaneous, parenteral, intraventricular, intrathecal, and any other injection methods known in the art. The route of administration of the pharmaceutical composition will depend on the disease or condition to be treated. Additional routes of administration include, but are not limited to, oral administration, oral ingestion, topical administration, rectal administration, vaginal administration, sublingual administration, nasal administration, ocular administration, transdermal administration, subcutaneous administration, intramuscular administration, intraperitoneal administration, intrathecal administration, and pulmonary administration.

[0142] In some embodiments, the method includes administering the pharmaceutical composition of the present invention at least 1 time, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 7 times, or at least 10 times per day, or any value and range therebetween. Each possibility represents a separate embodiment of the present invention. In some embodiments, the method includes administering the composition or combination of the present invention 1 - 2 times per day or per week or per month, 1 - 3 times per day or per week or per month, 1 - 4 times per day or per week or per month, 1 - 5 times per day, 1 - 7 times per day or per week or per month, 2 - 3 times per day or per week or per month, 2 - 4 times per day or per week or per month, 2 - 5 times per day or per week or per month, 3 - 4 times per day or per week or per month, 3 - 5 times per day or per week or per month, or 5 - 7 times per day or per week or per month. Each possibility represents a separate embodiment of the present invention.

[0143] In some embodiments, the method includes administering the pharmaceutical composition of the present invention at least 1 time, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 7 times, or at least 10 times per day, or any value and range therebetween. Each possibility represents a separate embodiment of the present invention. In some embodiments, the method includes administering the composition or combination of the present invention 1 - 2 times per day or per week or per month, 1 - 3 times per day or per week or per month, 1 - 4 times per day or per week or per month, 1 - 5 times per day, 1 - 7 times per day or per week or per month, 2 - 3 times per day or per week or per month, 2 - 4 times per day or per week or per month, 2 - 5 times per day or per week or per month, 3 - 4 times per day or per week or per month, 3 - 5 times per day or per week or per month, or 5 - 7 times per day or per week or per month. Each possibility represents a separate embodiment of the present invention.

[0144] In some embodiments, the method includes administering the pharmaceutical composition of the present invention to a subject daily or weekly or monthly at a dose of 0.05 to 20 mg / kg, 0.05 to 0.1 mg / kg, 0.1 to 0.3 mg / kg, 0.3 to 0.5 mg / kg, 0.5 to 0.8 mg / kg, 0.8 to 1 mg / kg, 1 to 2 mg / kg, 2 to 5 mg / kg, 5 to 10 mg / kg, 10 to 15 mg / kg, 15 to 25 mg / kg (including any range or value therebetween).

[0145] In some embodiments, the method comprises administering to a subject a pharmaceutical composition of the invention at a daily dose of 0.05 to 50 mg / kg, 0.05 to 0.1 mg / kg, 0.1 to 0.3 mg / kg, 0.3 to 0.5 mg / kg, 0.5 to 0.8 mg / kg, 0.8 to 1 mg / kg, 0.8 to 25 mg / kg, 0.8 to 3 mg / kg, 0.8 to 10 mg / kg, 0.8 to 15 mg / kg, 0.8 to 5 mg / kg, 3 to 5 mg / kg, 3 to 10 mg / kg, 2 to 10 mg / kg, 1 to 2 mg / kg, 2 to 5 mg / kg / kg, 5 to 10 mg / kg, 10 to 15 mg / kg, 15 to 20 mg / kg (including any range or value therebetween). In some embodiments, the daily dose can be inferred from in vivo data such as the results given in the Examples section (e.g., Example 4).

[0146] It will be apparent to those skilled in the art that, for example, in vitro and in vivo assays can optionally be employed to assist in determining the optimal dosage range. The precise dosage employed in the formulation will also depend on the route of administration and the nature of the disease or disorder and should be decided according to the judgment of the practitioner and the circumstances of each patient. The effective dosage can be inferred from the dose-response curves obtained from in vitro or in vivo animal model test bioassays or systems.

[0147] In some embodiments, the subject is a mammal. In some embodiments, the subject is a laboratory animal. In some embodiments, the subject is a pet. In some embodiments, the subject is a rodent. In some embodiments, the subject is a farm animal. In some embodiments, the subject is a human subject.

[0148] In some embodiments, the subject has a disease or disorder including a viral disease, cancer, genetic disease, CNS disease, inflammatory disease, pulmonary disease, or any combination thereof.

[0149] In some embodiments, the pharmaceutical composition is formulated for systemic administration. In some embodiments, the pharmaceutical composition is formulated for topical administration. In some embodiments, the pharmaceutical composition is formulated for intravenous administration. In some embodiments, the pharmaceutical composition is formulated for administration to a subject.

[0150] As used herein, the term "pharmaceutically acceptable salt" refers to any non-toxic salt of the conjugate of the invention which, upon administration to a subject (e.g., a human), is capable of directly or indirectly providing the compound of the invention or its therapeutically active metabolite or residue. For example, the term "pharmaceutically acceptable" can mean approved by a regulatory agency of the Federal or State government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals and, more particularly, in humans.

[0151] Pharmaceutically acceptable salts are well known in the art. For example, S.M. Berge et al. described pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19. Pharmaceutically acceptable salts of the compounds of the present invention include those salts derived from suitable inorganic and organic acids and bases.

[0152] Non-limiting examples of pharmaceutically acceptable salts include, but are not limited to: alkali metal salts, alkaline earth metal salts, acetates, aspartates, benzenesulfonates, benzoates, bicarbonates, carbonates, halides (such as bromides, chlorides, iodides, fluorides), hydrogen tartrates, citrates, salicylates, stearates, succinates, sulfates, tartrates, caprates, edetates, fumarates, gluconates, and lactates or any combination thereof.

[0153] Additional examples of pharmaceutically acceptable non-toxic acid addition salts are salts of amino groups formed with inorganic acids (such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid) or with organic acids (such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid) or by using other methods used in the art such as ion exchange.

[0154] Other pharmaceutically acceptable salts include adipates, alginates, ascorbates, aspartates, benzenesulfonates, benzoates, bisulfates, borates, butyrates, camphorates, camphorsulfonates, citrates, cyclopentanepropionates, digluconates, dodecyl sulfates, ethanesulfonates, formates, fumarates, glucoheptanoates, glycerophosphates, glycolates, glucuronates, glycolates, hemisulfates, heptanoates, hexanoates, hydrochlorides, hydrobromides, hydroiodides, 2-hydroxyethanesulfonates, lactobionates, lactates, laurates, lauryl sulfates, malates, maleates, malonates, methanesulfonates, 2-naphthalenesulfonates, nicotinates, nitrates, oleates, oxalates, palmitates, pamoates, pectates, persulfates, 3-phenylpropionates, phosphates, picrates, pivalates, propionates, salicylates, stearates, succinates, sulfates, tartrates, thiocyanates, p-toluenesulfonates, undecanoates, valerates, etc.

[0155] In some embodiments, the conjugates of the present invention present in the pharmaceutical composition have pharmaceutical grade purity, i.e., they are characterized by a chemical purity of at least about 90%, at least about 95%, greater than 95% or greater than 99%.

[0156] In some embodiments, the pharmaceutical composition is used to treat a disease or disorder in a subject in need thereof. In some embodiments, the pharmaceutical composition is used to alleviate at least one symptom associated with a disease or disorder. In some embodiments, the disease or disorder is a genetic disease.

[0157] The term "genetic disease" encompasses diseases associated with any abnormal expression and / or mutation of one or more genes.

[0158] In some embodiments, non-limiting examples of genetic diseases include, but are not limited to, proliferative diseases (such as cancer), inflammatory diseases (such as IBD, rheumatoid arthritis), CF, hearing loss, and CMT1A. In some embodiments, the conjugate of the present invention and / or its pharmaceutically acceptable salt is formulated in the form of a pharmaceutical composition for treating or preventing a respiratory viral disease in a subject in need thereof. In some embodiments, the pharmaceutical composition comprises one or more conjugates of the present invention and a pharmaceutically acceptable carrier, excipient, or adjuvant. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of one or more conjugates of the present invention. In some embodiments, the pharmaceutical composition is used to treat or prevent a disease or disorder associated with a respiratory viral infection in a subject in need thereof.

[0159] In some embodiments, the respiratory virus is a virus such as adenovirus, coronavirus HKU1, coronavirus NL63, coronavirus 229E, coronavirus OC43, severe acute respiratory syndrome coronavirus 2 (SARS CoV 2), human metapneumovirus, human rhinovirus / enterovirus, influenza A, influenza A / H1, influenza A / H3, influenza A / H1-2009, influenza B, parainfluenza virus 1-4, respiratory syncytial virus.

[0160] In some embodiments, there is provided a method for preventing or treating a respiratory viral infection in a subject in need thereof and / or for alleviating at least one symptom associated with a disease associated with a respiratory viral infection, the method comprising administering to the subject a therapeutically effective amount of the pharmaceutical composition of the present invention. In some embodiments, the therapeutically effective amount is sufficient to alleviate at least one symptom, or to alleviate the severity and / or inhibit the progression of the above-mentioned disease, disorder, or condition. In some embodiments, the therapeutically effective amount is sufficient to inhibit the virulence of the respiratory virus. In some embodiments, the therapeutically effective amount is sufficient to significantly reduce or completely inhibit any one of one or more biological activities of the respiratory virus, such as replication (e.g., RNA replication), transcription, translation, proliferation, etc.

[0161] In some embodiments, the therapeutically effective amount is sufficient to reduce the viral load in the subject, or is sufficient to prevent viral proliferation, wherein the subject has a respiratory viral disease.

[0162] Definitions

[0163] As used herein, the term "alkyl" describes aliphatic hydrocarbons including straight-chain and branched-chain groups. Preferably, the alkyl group has 21 to 100 carbon atoms, and more preferably 21 - 50 carbon atoms. Whenever a numerical range is stated herein, such as "21 - 100", it implies that the group (in this case the alkyl group) can contain 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, etc., up to and including 100 carbon atoms. In the context of the present invention, a "long alkyl" is an alkyl having at least 20 carbon atoms in its backbone (the longest path of continuously covalently linked atoms). Thus, a short alkyl has 20 or fewer backbone carbons. As defined herein, an alkyl may be substituted or unsubstituted.

[0164] As used herein, the term "alkyl" also includes saturated or unsaturated hydrocarbons, and thus the term also encompasses alkenyl and alkynyl groups.

[0165] As defined herein, the term "alkenyl" describes an unsaturated alkyl having at least two carbon atoms and at least one carbon-carbon double bond. As described above, an alkenyl may be substituted or unsubstituted with one or more substituents.

[0166] As defined herein, the term "alkynyl" is an unsaturated alkyl having at least two carbon atoms and at least one carbon-carbon triple bond. As described above, an alkynyl may be substituted or unsubstituted with one or more substituents.

[0167] The term "cycloalkyl" describes a fully carbon monocyclic or fused-ring (i.e., rings sharing adjacent carbon atom pairs) group, wherein one or more rings do not have a fully conjugated π-electron system. As shown herein, a cycloalkyl group may be substituted or unsubstituted.

[0168] The term "aryl" describes a fully carbon monocyclic, polycyclic (bicyclic or tricyclic), mixed-ring or fused-ring polycyclic (i.e., rings sharing adjacent carbon atom pairs) group having a fully conjugated π-electron system. As shown herein, an aryl group may be substituted or unsubstituted. The term "aryl" also encompasses one or more heteroaryl rings, such as monocyclic, polycyclic (bicyclic or tricyclic), mixed-ring or fused-ring polycyclic heteroaryl rings.

[0169] As defined herein, the term "alkoxy" describes O-alkyl and -O-cycloalkyl groups.

[0170] As defined herein, the term "aryloxy" describes -O-aryl.

[0171] In the general formulas herein, each of the alkyl, cycloalkyl, and aryl groups may be substituted by one or more substituents, where each substituent group may independently be, for example, a halogen group, alkyl group, alkoxy group, cycloalkyl group, nitro group, amino group, hydroxy group, mercapto group, thioalkoxy group, carboxyl group, amide group, aryl group, and aryloxy group, depending on the substituent group and its position in the molecule. Additional substituents are also contemplated.

[0172] The terms “halide,” “halogen,” or “halo” describe fluorine, chlorine, bromine, or iodine.

[0173] The term “haloalkyl” describes an alkyl group as defined herein that is further substituted by one or more halogen groups.

[0174] The term “haloalkoxy” describes an alkoxy group as defined herein that is further substituted by one or more halogen groups.

[0175] The term “hydroxy” or “hydroxy” describes the —OH group.

[0176] The term “mercapto” or “thiol” describes the —SH group.

[0177] As defined herein, the term “thioalkoxy” describes the —S-alkyl group and the —S-cycloalkyl group.

[0178] As defined herein, the term “thioaryloxy” describes the —S-aryl and —S-heteroaryl groups.

[0179] The term “amino” describes the —NR′R″ group, with R′ and R″ as described herein.

[0180] The term “heterocyclic group” describes a monocyclic or fused ring group having one or more atoms such as nitrogen, oxygen, and sulfur in one or more rings. These rings may also have one or more double bonds. However, these rings do not have a fully conjugated π-electron system. Representative examples are piperidine, piperazine, tetrahydrofuran, tetrahydropyran, morpholino, and the like.

[0181] As defined herein, the term “carboxyl” or “carboxylate” describes the —C(O)OR′ group, where R′ is hydrogen, alkyl, cycloalkyl, alkenyl, aryl, heteroaryl (bonded through a ring carbon), or heterocyclic group (bonded through a ring carbon).

[0182] The term “carbonyl” describes the —C(O)R′ group, where R′ is as defined above.

[0183] The above terms also encompass their thio derivatives (thiocarboxyl and thiocarbonyl).

[0184] The term "thiocarbonyl" describes a -C(S)R' group, where R' is as defined above.

[0185] The "thiocarboxy" group describes a -C(S)OR' group, where R' is as defined herein.

[0186] The "sulfinyl" group describes a -S(O)R' group, where R' is as defined herein.

[0187] The "sulfonyl" or "sulfonate" group describes a -S(O)2R' group, where R' is as defined herein.

[0188] The "carbamoyl" or "carbamate" group describes an -OC(O)NR'R" group, where R' is as defined herein and R" is as defined for R'.

[0189] The "nitro" group refers to the -NO2 group.

[0190] As used herein, the term "amido" encompasses C-amido and N-amido.

[0191] The term "C-amido" describes a -C(O)NR'R" end group or a -C(O)NR'-linking group, these phrases being as defined above, where R' and R" are as defined herein.

[0192] The term "N-amido" describes an -NR"C(O)R' end group or an -NR'C(O)-linking group, these phrases being as defined above, where R' and R" are as defined herein.

[0193] As used herein, the term "carboxylic acid derivative" encompasses carboxyl, amide, carbonyl, anhydride, carbonate and carbamate.

[0194] The "cyano" or "nitrile" group refers to the -CN group.

[0195] The term "azo" or "diazo" describes an -N=NR' end group or an -N=N-linking group, these phrases being as defined above, where R' is as defined above.

[0196] The term "guanidine" describes an -R'NC(N)NR"R"' end group or an -R'NC(N)NR"-linking group, as these phrases are defined above, where R', R" and R"' are as defined herein.

[0197] As used herein, the term "azide" refers to the -N3 group.

[0198] The term "sulfonamide" refers to an -S(O)2NR'R" group, where R' and R" are as defined herein.

[0199] The term "phosphonyl" or "phosphonate" describes an -OP(O)-(OR')2 group, where R' is as defined above.

[0200] The term "phosphino" describes a -PR'R" group, where R' and R" are as defined above.

[0201] As defined herein, the term "alkylaryl" describes an alkyl group substituted with an aryl group as described herein. An exemplary alkylaryl is benzyl.

[0202] The term "heteroaryl" describes a monocyclic (e.g., C5-C6 heteroaryl ring) or fused-ring (i.e., rings sharing adjacent pairs of atoms) group that has one or more atoms, such as, for example, nitrogen, oxygen, and sulfur, in one or more of the rings and, additionally, has a fully conjugated π-electron system. In some embodiments, the terms "heteroaryl" and "C5-C6 heteroaryl" may be used interchangeably herein. Examples (but not limited to) of heteroaryl groups include pyrrole, furan, thiophene, imidazole, oxazole, thiazole, pyrazole, pyridine, pyrimidine, quinoline, isoquinoline, and purine. As described above, heteroaryl groups may be substituted or unsubstituted with one or more substituents. Representative examples are thiadiazole, pyridine, pyrrole, oxazole, indole, purine, etc.

[0203] As used herein, the terms "halo" and "halide" are used interchangeably herein and describe a halogen atom, i.e., fluorine, chlorine, bromine, or iodine, also referred to herein as fluoro, chloro, bromo, and iodo.

[0204] The term "haloalkyl" describes an alkyl group as defined above that is further substituted with one or more halo groups.

[0205] As used herein, the term "treatment" or "treating" a disease, disorder, or condition encompasses alleviating at least one symptom thereof, reducing its severity, or inhibiting its progression. Treatment does not necessarily mean that the disease, disorder, or condition is completely cured. For effective treatment, the compositions useful herein only need to reduce the severity of the disease, disorder, or condition, reduce the severity of the symptoms associated therewith, or provide an improvement in the quality of life of the patient or subject.

[0206] As used herein, the term "preventing" a disease, disorder or condition includes delaying, precluding, arresting or inhibiting the onset of a disease, disorder or condition. As used in connection with the presently described subject matter, the term "preventing" relates to a prophylactic process in which a subject is exposed to the presently described active ingredient prior to the induction or onset of a disease / disorder process. This can be done in the case where an individual has a genetic lineage indicative of a predisposition to the disease / disorder to be prevented. For example, it may be true that an individual's ancestors exhibited a predisposition to some inflammatory disorder.

[0207] The term "arresting" is used to describe a condition in which the disease / disorder process has started but the overt symptoms of the condition have not yet been recognized. Thus, an individual's cells may have a disease / disorder, but the external signs of the disease / disorder have not yet been clinically identified. In either case, the term preventing can be used to encompass both preventing and arresting.

[0208] In contrast, the term "treating" refers to the clinical application of an active agent to combat an existing condition, the clinical manifestation of which has been realized in a patient.

[0209] In the discussion, unless otherwise indicated, adjectives such as "substantially" and "about" modifying a condition or relationship characteristic of one or more features of an embodiment of the invention are understood to mean that the condition or feature is positioned within an acceptable tolerance for the operation of the embodiment for the intended application. Unless otherwise indicated, the word "or" in the specification and claims is to be regarded as the inclusive "or" rather than the exclusive "or", and denotes at least one, or any combination, of the items it conjoins.

[0210] It should be understood that the term "a / an" as used above and elsewhere herein refers to "one or more / one or more kinds" of the recited components. It will be clear to those of ordinary skill in the art that, unless specifically stated otherwise, the use of the singular includes the plural. Thus, the terms "a / an" and "at least one / at least one kind" may be used interchangeably in this application.

[0211] For a better understanding of the present teachings, and not in any way limiting the scope of the present teachings, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, as well as other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0212] In the description and claims of the present application, each of the verbs "comprise", "include", and "have" and their variations is used to indicate that one or more objects of the verb are not necessarily a complete list of components, elements, or parts of one or more subjects of the verb.

[0213] Other terms used herein are meant to be defined by their meanings as known in the art.

[0214] Unless specifically stated or obvious from the context, as used herein, the term "or" is understood to be inclusive.

[0215] Throughout the description and claims, the word "comprise" or variations such as "comprises" or "comprising" indicates the inclusion of any recited integer or group of integers, but does not exclude any other integer or group of integers.

[0216] As used herein, the term "consists essentially of" or variations such as "consist essentially of" or "consisting essentially of" used throughout the description and claims means the inclusion of any recited integer or group of integers, and optionally includes any recited integer or group of integers that do not materially change the basic or novel properties of the specified method, structure, or composition.

[0217] As used herein, terms such as "comprises", "comprising", "containing", "having", etc. may mean "includes", "including", etc.; "consisting mainly of" or "consisting essentially of", etc. also have the meanings given in U.S. patent law, and the term is open-ended, allowing for more than what is recited, provided that the basic or novel features of what is recited are not changed by the presence of more than what is recited, but excluding prior art embodiments. In one embodiment, the terms "comprises", "comprising", and "having" may be interchangeable with "consisting of".

[0218] Although the present invention has been described in connection with its specific embodiments, it is apparent that many alternatives, modifications, and variations will be apparent to those skilled in the art. Accordingly, all such alternatives, modifications, and variations are intended to be included within the spirit and broad scope of the appended claims.

[0219] All publications, patents, and patent applications mentioned in this specification are hereby incorporated by reference in their entirety into this specification to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference in its entirety into this specification. Additionally, the citation or identification of any reference in this application should not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

[0220] Examples

[0221] Generally, the terms used herein and the laboratory procedures employed in the present invention include molecular, biochemical, and microbiological techniques. These techniques are well-explained in the literature.

[0222] Example 1

[0223] Synthetic Procedures

[0224] A non-limiting exemplary synthetic procedure for the conjugates of the present invention is provided below.

[0225] A typical synthesis is shown in Scheme 1, which features the recognized protection of estrone and subsequent ring-opening with LiAlH4 / AlCl3. Using 3,5-difluorobenzyl bromide 4, the crude material can be selectively alkylated on the phenol. Purification and subsequent Mitsunobu reaction introduce the perfluorinated motif to afford compound 5 in good yield. The hydroxymethyl group is introduced by reaction with DMF and LDA to provide an intermediate aldehyde, which is in turn reduced using sodium borohydride in a one-pot procedure. The alcohol is activated with methanesulfonyl chloride and subsequently treated with methylaminohexanol to give alcohol 7. It is speculated that the intermediate workup could be carried out, but the presence of the chloride salt might cause the mesylate to be replaced by chlorine, giving the much less reactive benzyl chloride.

[0226]

[0227] Synthesis of Thioacetate 8 in Scheme 1

[0228] Using Mitsunobu reaction conditions, the alcohol is converted to thioacetate 8.

[0229]

[0230] Scheme 2. Synthesis of Thiotosylate 18

[0231] The synthesis of thiotosylate 18 starts with the coupling of ethyl diazoacetate with 3-bromopropan-1-ol to give ether 9. Diethyl malonate is alkylated with bromide 9 to give triester 10. The ester is reduced with LiAlH4 to give triol 11. The acetonide moiety is introduced by treatment with dimethoxypropane to give acetonide 12. The alcohol is first converted to a mesylate, and then sodium iodide compound 13 is used. An alternative method based on triphenylphosphine and NBS usually gives rise to many impurities and low yields. Finally, the halogen is replaced with potassium thiotosylate to give the desired structural unit thiotosylate 18.

[0232]

[0233] Scheme 3. Synthesis of Apo-Si-K-170-A

[0234] The thioacetate 8 is deprotected in situ using basic conditions, which also allows for nucleophilic attack on thiotosylate 18 to form disulfide 15. It should be noted that during the exposure of the acetonide to silica, it may spontaneously fall off, and the deprotected diol will stick to the column. Further elution of the column with up to 100% acetone can give the diol in reasonable purity and quantity. After purification, the material is subjected to acetonide removal using acidic proton conditions.

[0235] After crude workup, the material is directly suitable for selective dimethoxytrityl monoprotection to give 17. The final introduction of the phosphoramidite is again a well-established chemical method and gives Apo-Si-K-170-A in good yield.

[0236] Synthesis of thioacetate 8: (8R,9S,13S,14S)-13-methyl-6,7,8,9,11,12,13,14,15,16-decahydrospiro[cyclopenta[a]phenanthrene-17,2'-[1,3]dioxane]-3-ol (1)

[0237] Trimethoxymethane (297 g, 350 mL, 2.80 mol), 1,3-propanediol (213 g, 250 mL, 2.80 mol), and pTsOH (2 g, 10 mmol) were added to a suspension of estrone (252 g, 0.93 mol) in toluene (1.5 L). The mixture was heated to 60 °C and stirred for 16 h. Triethylamine (6 mL) and water (600 mL) were added and stirring was continued for an additional 1 h. The phases were separated and the organic layer was washed with water (3 × 400 mL) and brine. The mixture was dried over Na2SO4 and partially concentrated to approximately 1 L. The mixture was poured into heptane (4 L), and the white solid was filtered off, washed with heptane, and dried in vacuo. Compound 1 (271 g, 825 mmol) was isolated as a white solid in 88.5% yield.

[0238] (8R,9S,13S,14S,17S)-17-(3-Hydroxypropoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-ol (2)

[0239] At 0 °C, lithium aluminum hydride (6.2 g, 0.16 mol) was carefully added to a solution of (13S)-13-methyl-6,7,8,9,11,12,13,14,15,16-decahydrospiro[cyclopenta[a]phenanthrene-17,2'-[1,3]dioxane]-3-ol (45 g, 140 mmol) in THF (1 L), and then an additional amount of THF (1.5 L) was added. Still at 0 °C, aluminum chloride (73 g, 0.55 mol) was added (very exothermic!). The mixture was stirred at 0 °C for 15 min and then warmed to 60 °C. It was stirred at 60 °C for 2 h (watch for clogging), then cooled to 0 °C, and quenching was started by dropwise addition of NH4Cl(aq) (500 mL). The mixture was stirred at room temperature for 16 h. The phases were separated, and the organic layer was washed with brine and concentrated. A white solid was obtained, which was contaminated with estradiol (ca. 15%).

[0240] Using similar amounts, the reaction was repeated again in the same manner. After NMR analysis, the two portions were combined to give 95 g of the crude material.

[0241] 3-(((13S,17S)-3-((4-(2,2-Dimethoxyethyl)-3,5-difluorobenzyl)oxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-17-yl)oxy)propan-1-ol (3)

[0242] To a suspension of crude phenol 7 (95 g, assumed to be 0.22 mol), potassium carbonate (76 g, 0.55 mol) in acetone (1.5 L) and MeOH (200 mL) was added 3,5-difluorobenzyl bromide (100 g, 0.49 mol) and TBAI (5.1 g, 14 mmol). The resulting mixture was stirred at 65 °C for 16 h. The mixture was cooled to room temperature and filtered, and the filtrate was concentrated. Water (500 mL) was added, and the mixture was extracted with EtOAc (3 × 500 ml), and the combined organic layers were dried over sodium sulfate and concentrated.

[0243] The crude material was completely converted into the corresponding benzyl phenol.

[0244] (13S,17S)-3-((4-(2,2-dimethoxyethyl)-3,5-difluorobenzyl)oxy)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthrene (5)

[0245] To a solution of crude alcohol 8 in THF (700 mL) was added triphenylphosphine (86 g, 0.33 mol) and 1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-ol (100 g, 0.41 mol), followed by DIAD (59 mL, 0.3 mol), and the resulting mixture was stirred at room temperature for 1 h. Heptane (0.5 L) was added to the mixture, and the mixture was partially concentrated. More heptane (0.3 L) was added, and the mixture was stirred for 5 min. The solid was filtered off, and all the organics were washed with aqueous 5% hydrogen peroxide (3 × 100 mL), washed twice with brine and concentrated. Further purification using column chromatography (gradient 5% to 10% EtOAc / heptane) gave compound 5 (137 g, 0.14 mol, 74% (4 steps)) as a white crystalline solid.

[0246] (2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)phenyl)methanol (6)

[0247] At -78 °C, nBuLi (45 mL, 2.5 molar, 0.11 mol) was added to a solution of (13S,17S)-3-((3,5-difluorobenzyl)oxy)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthrene (73 g, 0.11 mol) in THF (1.3 L anhydrous). A dark color was observed and it became clear after 10 min. The resulting yellow / red mixture was stirred at -78 °C for 1.5 h. DMF (25 mL, 0.32 mol) (anhydrous) was added dropwise and stirred for 30 min while warming to room temperature. MeOH (100 mL) was added and sodium borohydride (6.1 g, 0.16 mol) was added (carefully), and stirring was continued for 0.5 h. Water (100 mL) was added and stirring was continued for 16 h, then concentrated under partial vacuum. EtOAc (1 L) was added and washed with brine and concentrated. Further purification was carried out using flash chromatography (large column, 15% to 25% EtOAc in heptane) to give the desired alcohol (23.6 g, 33.5 mmol) in 31% yield as a clear oil. The remainder was unreacted starting material.

[0248] 6-((2,6-Difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexan-1-ol (7)

[0249] To a solution of compound 10 (23.6 g, 33.5 mmol) and triethylamine (14.0 mL, 100 mmol) in DCM (250 mL) was added methanesulfonyl chloride (mesyl-Cl) (3.0 mL, 38.5 mmol), and the resulting mixture was stirred for 1 h. 6-(Methylamino)hexan-1-ol (9 g, 68.5 mmol) was added to this solution. The resulting mixture was stirred at room temperature for 16 h. The mixture was diluted with dichloromethane (200 mL) and the mixture was washed with aqueous saturated sodium bicarbonate and brine, dried over Na2SO4 and concentrated. The crude material was purified using column chromatography (10 - 20% acetone + 1% NEt3 in heptane) to give alcohol 7 (15.5 g, 59.1%) as a white solid.

[0250] S-(6-((2,6-Difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-Hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl)thioacetate (8)

[0251] Two batches were set up but were ultimately combined prior to purification.

[0252] To a solution of alcohol 7 (23.9 g, 29.2 mmol) (15.5 g, 19.0 mmol) in THF (800 mL) was added triphenylphosphine (10.7 g, 40.9 mmol) (7.0 g, 26.5 mmol) and DIAD (7.4 mL, 38 mmol) (4.8 mL, 24.6 mmol), and the mixture was stirred for 5 minutes. Then, thioacetic acid (5.3 mL, 38.0 mmol) (3.4 mL, 47.4 mmol) was added, and the mixture was stirred for 2 h. The mixtures were combined and concentrated. The crude material was purified by column chromatography (gradient of 5% to 10% acetone + 1% Et3N in heptane) to afford thioacetate 8 (39.3 g, 93%).

[0253] Synthesis of tosylate 18: Ethyl 2-(3-bromopropoxy)acetate (9)

[0254] At 0 °C, BF3·OEt2 (1.1 g, 0.94 mL, 7.4 mmol) was added to a solution of ethyl 2-diazoacetate (100 g, 0.74 mol) and 3-bromopropan-1-ol (0.10 kg, 74 mL, 0.74 mol) in DCM (100 mL). The reaction was stirred at 0 °C for 15 min and at room temperature for 3 h until no more gas evolution was observed. The mixture was diluted with DCM (500 mL), and the mixture was washed with H2O (500 mL) and brine (500 mL) and dried over Na2SO4. The solvent was removed in vacuo to afford ethyl 2-(3-bromopropoxy)acetate (9, 180 g, 0.80 mol, 110%) as a clear yellow oil.

[0255] Diethyl 2-(3-(2-ethoxy-2-oxoethoxy)propyl)malonate (10)

[0256] To a suspension of ice-cooled sodium hydride (8.9 g, 0.22 mol) in DMF (600 mL) was slowly added diethyl malonate (53 g, 51 mL, 0.33 mol). The resulting mixture was stirred at room temperature for 45 minutes. At 0 °C, bromide 9 (50 g, 0.22 mol) was added and the mixture was stirred at 0 °C for 10 minutes and overnight at room temperature. The mixture was partially concentrated. Then, water (1 L) was added and the mixture was extracted with EtOAc / heptane (1:1, 3 × 500 mL). The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The crude material was purified by column chromatography (20% EtOAc / heptane) to give triester 10 (45 g, 0.15 mol, 67%) as a clear oil.

[0257] 2-(3-(2,2-Dimethyl-1,3-dioxan-5-yl)propoxy)ethan-1-ol (12)

[0258] To a suspension of ice-cooled LiAlH4 (25 g, 0.66 mol) in THF (200 mL) was slowly added a solution of triester 10 (36 g, 118 mmol) in THF. The mixture was warmed to room temperature and stirred for 1 hour. At 0 °C, KOH (aq. 20%, 106 mL (160 mL / mol LiAlH4)) was slowly added and the resulting mixture was stirred at room temperature for 1 h min. The mixture was filtered through diatomaceous earth, dried over Na2SO4 and concentrated to give triol 11.

[0259] The material was dissolved in DCM (400 mL) and 2,2-dimethoxypropane (15 g, 17 mL, 141 mmol) and 4-methylbenzenesulfonic acid hydrate (2.2 g, 12 mmol) were added and the resulting mixture was stirred for 30 minutes. The mixture was partially concentrated. The residue was dissolved in EtOAc (550 mL) and washed with NaHCO3 (300 mL) and brine (300 mL), dried over Na2SO4 and concentrated to give the acetonide 12 (8.9 g, 41 mmol, 35%) as a clear yellow oil.

[0260] 5-(3-(2-Bromoethoxy)propyl)-2,2-dimethyl-1,3-dioxane (18)

[0261] To a solution of alcohol 16 (32 g, 147 mmol) and triethylamine (30 mL, 220 mmol) in DCM (120 mL) was added MsCl (13.7 mL, 176 mmol), and the resulting mixture was stirred at room temperature for 30 min. The mixture was washed with NaHCO3 (300 mL), dried over Na2SO4, and concentrated. The crude intermediate was dissolved in acetone (600 mL), and sodium iodide (43.9 g, 293 mmol) was added. The resulting mixture was refluxed for 16 h. The mixture was cooled to room temperature and concentrated. The mixture was diluted with dichloromethane and washed with water to remove all salts. The organic layer was dried over sodium sulfate and concentrated. All materials were dissolved in acetone (600 ml) and potassium 4-methylbenzenesulfonate (49.8 g, 220 mmol), and the resulting mixture was stirred at 60 °C for 16 h. The mixture was cooled to room temperature, concentrated, diluted with EtOAc, and washed with aqueous saturated sodium bicarbonate and brine, dried over sodium sulfate, and concentrated.

[0262] Synthesis of Apo-Si-K-170-A

[0263] N-(2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)-6-((2-(3-(2,2-dimethyl-1,3-dioxan-5-yl)propoxy)ethyl)disulfanyl)-N-methylhexan-1-amine (15)

[0264] The reaction was carried out in two parts:

[0265] To a solution of thioacetate 8 (19.6, 1 Eq, 22.6 mmol) and thiotosylate 18 (9.2 g, 1.5 Eq, 29.4 mmol) in DCM (500 mL) and MeOH (25 mL) was added sodium methoxide in MeOH (10.5 mL, 2 Eq, 56.5 mmol), and the resulting mixture was stirred at room temperature for 1 h. The mixture was diluted with DCM (200 mL), washed with NaHCO3 and brine, dried over Na2SO4, and concentrated.

[0266] The two parts were combined and further purified by column (gradient 10 - 40% EtOAc / heptane + 1% NEt3) to give disulfide 15 (29.6 g, 61%) as a pale yellow oil.

[0267] The fraction with much greater polarity contained the acetal-free material as diol 16 (11.2 g, 10.9 mmol, 24%).

[0268] 2-(3-(2-((6-((2,6-Difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl)disulfanyl)ethoxy)propyl)propane-1,3-diol (16)

[0269] p-TosOH (4.16 g, 1.2 Eq, 21.9 mmol) was added to a solution of disulfide 15 (21.2 g, 19.9 mmol) in DCM (40 mL) and MeOH (100 mL), and the resulting mixture was stirred at room temperature for 16 h. The reaction was quenched by the addition of NEt3 (10 mL), and the mixture was washed with aqueous saturated sodium bicarbonate, dried over sodium sulfate and concentrated to give diol 16 (18.0 g, 88%) as an off-white solid.

[0270] 2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(2-((6-((2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl)disulfanyl)ethoxy)pentan-1-ol (17)

[0271] 4,4'-(Chloro(phenyl)methylene)bis(methoxybenzene) (5.9 g, 18.0 mmol) was added to a solution of diol 16 (18.0 g, 18.0 mmol), DMAP (0.21 g, 1.8 mmol) and triethylamine (3.2 mL, 23 mmol) in DCM (350 mL), and the resulting mixture was stirred at room temperature for 16 h. The mixture was washed with aqueous saturated sodium bicarbonate, dried over sodium sulfate and concentrated. The crude material was purified by column chromatography (12% acetone in heptane + 1% NEt3, using silica deactivated by pretreatment with NEt3) to give alcohol 17 (15.3 g, 66%) as a yellow oil.

[0272] 2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(2-((6-((2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl)disulfanyl)ethoxy)pentyl(2-cyanoethyl)diisopropylphosphoramidite (Apo-Si-K-170-A)

[0273] To a solution of alcohol 17 (15.2 g, 11.5 mmol) in DCM (300 mL) was added 3-((bis(diisopropylamino)phosphino)oxy)propanenitrile (5.5 mL, 18.0 mmol) and N-methylmorpholine (1.75 g, 17.3 mmol) and a solution of TFA (985 mg, 8.7 mmol) (0.5 M NMM and 0.25 M TFA) in DCM (34.5 mL), and the resulting mixture was stirred at room temperature for 1.5 h. The mixture was washed with aqueous saturated sodium bicarbonate, dried over sodium sulfate and concentrated. The crude material was purified by column chromatography (10% acetone in heptane + 1% NEt3, silica pretreated with NEt3) to give Apo-Si-K-170-A (11.8 g, 67%) as a colorless oil.

[0274] Synthetic scheme for Apo-Si-K-170-B:

[0275]

[0276]

[0277] Scheme 4: Synthesis of Apo-Si-K-170B Synthetic scheme for Apo-Si-K-170-C:

[0278]

[0279]

[0280] Scheme 5: Synthesis of Apo-Si-K-170-C Synthetic scheme for Apo-Si-K-941:

[0281]

[0282]

[0283] Scheme 6: Synthesis of Apo-Si-K-941

[0284] Synthesis of Apo-Si-K-1014:

[0285] The initial synthetic route of Apo-Si-K-1014 focused on the formation of thiol (i.e., compound 4) and its further functionalization. This route started from chloride 2, which is an advanced intermediate from the synthesis of Apo-Si-K-170A and can be easily converted to thioacetate 3. Additionally, for another Aposense project, the release of thiol was required and studied. Although its release was easily achieved, the oxidation of sulfide was a very serious problem. After subsequent treatment, only disulfide was isolated. Structurally, the tertiary amine created a local basic environment in which the sulfide oxidation was greatly enhanced. By performing the release under anaerobic conditions and subsequent acidification, allowing for subsequent treatment to obtain free thiol 4 in the form of the HCl salt, which was found to be very stable. (The HCl salt also creates a local acidic environment that may hinder sulfide oxidation.) The condensation of the established free thiol 4 with acid 5 was found to be a reasonable choice, but ultimately this linkage was found to be very difficult. Activation of the acid with DCC or Pybop did not provide any conversion, while acyl chloride led to very low yields.

[0286]

[0287] Scheme 7: Thiol formation and further linkage

[0288] Results and Discussion

[0289] When the formation of thioester via condensation failed to provide results, the concept of introducing thioacetate was not abandoned. Instead of laboriously introducing thiol, as shown in Scheme 3, the thioacid (i.e., compound 7) was linked, which should shorten the route and give the thioester.

[0290]

[0291] Scheme 8: Alternative formation of thioester

[0292] The conversion of compound 5 to the corresponding thioacid 7 was achieved by treatment with CDI and subsequent treatment with NaSH. After acidic subsequent treatment, compound 7 could be isolated in almost quantitative yield and reasonable purity ( 1 The lower purity shown by 1H-NMR may be attributed to resonance structures). Treatment of the crude material with sodium hydride was expected to form the sodium salt, which could then react with chloride 2 (here pretreated with sodium hydride to remove the HCl salt). The linkage of compound 7 with compound 2 was successfully carried out, and the thioester was found to be more stable than expected.

[0293]

[0294] Scheme 9: Final determination of Apo-Si-K-1014

[0295] With compound 6, treatment with TBAF released the alcohol, and the phosphimidate was then linked with diisopropyl tetrazole. Compound Apo-Si-K-1014 was obtained by purification.

[0296] 9-((tert-Butyldiphenylsilyl)oxy)nonanethioic acid (7). A solution of 9-((tert-butyldiphenylsilyl)oxy)nonanoic acid (2.01 g, 4.87 mmol) in dichloromethane (125 mL) was treated with CDI (2.37 g, 14.6 mmol) at [temperature not specified] and stirring was continued for 1 h. Then sodium hydrosulfide hydrate (1.08 g, 14.6 mmol) was added in one portion, and stirring was continued at room temperature for 16 h. The mixture was washed with 2 M HCl, dried over sodium sulfate and concentrated.

[0297] The crude NMR showed complete and relatively clean conversion, and the material was used as such for the next step.

[0298] S-(6-((2,6-Difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-Hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl)9-((tert-butyldiphenylsilyl)oxy)nonanethioate (6). Sodium hydride (326 mg, 60% Wt, 8.14 mmol) was added to a solution of compound 7 (1.95 g, 4.56 mmol) in DMF (10 mL). Sodium hydride (163 mg, 60% Wt, 1.25 Eq, 4.07 mmol) was added to a solution of compound 2 (2.84 g, 3.26 mmol) in DMF (1.5 mL). After 5 min, the two solutions were combined. TBAI (10 mg) was added, the temperature was raised to 80 °C and maintained for 3 h. The mixture was cooled to room temperature, and heptane (350 mL) was added. It was washed with water (2 × 50 mL) and brine, dried over sodium sulfate and concentrated. The crude material was used as such for deprotection.

[0299] S-(6-((2,6-Difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl) 9-hydroxynonanethioate (6a) All the crude materials of compound 6 were dissolved in THF (75 mL), and a solution of 1 M TBAF (2.55 g, 9.77 mL, 1 mole, 9.77 mmol) in THF was added, and stirring was continued for 16 h. The mixture was concentrated and further purified by gradient flash chromatography (25% to 40% EtOAc + 1% Et3N in heptane). Compound 6a (925 mg, 0.75 mmol) was isolated in 23% yield as a viscous oil (trace amounts of TBDPS still present).

[0300] S-(6-((2,6-Difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl) 9-(((2-cyanoethoxy)(diisopropylamino)phosphino)oxy)nonanethioate (Apo-Si-K-1014) To a solution of compound 6a (925 mg, 0.94 mmol) in dichloromethane (50 mL) was added diisopropylammonium salt of tetrazole (241 mg, 1.5 1.41 mmol) and 3-((bis(diisopropylamino)phosphino)oxy)propionitrile (849 mg, 2.82 mmol). Stirring was continued for 16 h at room temperature. The mixture was concentrated by TLC and further purified by flash chromatography (20% to 40% ethyl acetate in heptane (very slow gradient (total + 1% Et3N)). Apo-Si-K-1014 (825 mg, 0.69 mmol) was isolated in 73% yield as a viscous oil.

[0301] Synthesis of Apo-Si-K-1007

[0302] The starting point will be the use of phenol 1 which has been synthesized several times. For clarity, its synthesis is included in Scheme 1. First, benzylation is carried out on the phenol of estradiol, and then the C-17 alcohol is further functionalized with allyl bromide to obtain compound 4. The alkene is hydroborated, and after subsequent oxidation workup, alcohol 5 is isolated. The alcohol is perfluorinated using Mitsunobo conditions to obtain the highly polar compound 6. This material can be easily purified by filtering with heptane on silica and further purified by recrystallization from acetonitrile. After hydrogenation and filtration, a large amount of phenol 1 can be obtained.

[0303]

[0304] Scheme 10

[0305] The functionalization of free phenol can be easily carried out using Mitsunobo conditions and a suitable alcohol. We synthesized compound 7 by combining bromide 10 with functionalized piperazine 11 (which can give compound 7). When applying Mitsunobo conditions, compound 9 can be easily obtained. Although the Mitsunobo reaction with phenol 1 is easy to carry out, the piperazine moiety of compound 7 is somewhat more difficult to achieve complete (and relatively clean) conversion.

[0306]

[0307] Scheme 11: Synthesis of Apo-Si-K-1007.

[0308]

[0309] Scheme 12: Alternative synthesis of compound 9

[0310] With compound 9, the release of the ester will give the handleable zwitterionic substance (i.e., compound 12). Initially, we tried to obtain a tert-butyl ester which could be released using acidic conditions such as 4M HCl in dioxane, but due to the very basic piperazine group, the ester seemed to be shielded, preventing its release. Therefore, an ethyl ester was used instead, which can be hydrolyzed with sodium hydroxide and concentrated as such.

[0311] To say that the handling of compound 12 and its derivatives is very difficult is an understatement.

[0312]

[0313] Scheme 13: Final stage towards compound Apo-Si-K-1007

[0314] The sodium salt of compound 12 can be used for subsequent peptide coupling. We have successfully converted this material into its corresponding acyl chloride and have also successfully carried out activation using PyBOP and EDCI, with the latter being easier to purify. With compound 13, the acetyl-clip was removed accordingly in acidic medium, but again a very polar and difficult-to-handle diol was obtained. Monoprotection of the crude diol with DMT allowed for more convenient handling of compound 15.

[0315] At this stage, the polarity issue and the very basic piperazine group seem to be the cause of all problems. The cyclic diamine may have some intramolecular interaction with the amide and is suspected of having some zwitterionic behavior. Additionally, for the last step, we typically use a buffer of N-methylmorpholine and TFA and suspect that the basicity of piperazine is sufficient to infinitely capture TFA, making purification troublesome. However, omission of the proton source failed to activate the phosphite ester reagent, which in turn allowed for attachment on the alcohol. To solve all these problems, the use of diisopropyl tetrazolide was tested, which gave Apo-Si-K-1007 with a slightly moderate yield but good purity.

[0316] Intermediate 20

[0317]

[0318] Scheme 14: Synthetic Route 1 of Intermediate 20

[0319] At room temperature, di-tert-butyl malonate was alkylated with ethyl 2-(3-bromopropoxy)acetate and NaH in DMF for 16 hours. After purification by distillation, compound 18 was isolated in 59% yield and 88.9% purity. Subsequently, an amide was formed with 7N NH3 in methanol at room temperature. After 16 hours, the reaction was complete and the mixture was concentrated. Compound 19 was isolated by GC-MS in almost quantitative yield and 85.3% purity.

[0320] Reducing compound 2 to compound 20 was proven to be challenging. First, reduction was tested with LiAlH4 (4.5 equivalents) in tetrahydrofuran at room temperature, and incomplete consumption of the starting material was observed. The temperature was raised to reflux, which led to complete consumption of the starting material. Additionally, the amide was reduced to an amine while the tert-butyl ester remained unaffected. Increasing the amount of LiAlH4 (10 equivalents) did not solve the problem either.

[0321]

[0322] Scheme 15: Synthetic Route 2 of Intermediate 20

[0323] Next, transesterification was tested with 0.5 N HCl (10 equivalents) in methanol at room temperature for 16 hours to give a mixture of starting material 19 and methyl ester 21. The reaction was repeated with 2 N HCl (10 equivalents) in methanol at room temperature and stirred for 2 days, and only methyl ester 21 was isolated in quantitative yield. Reduction of 21 with LiAlH4 (>7 equivalents) in tetrahydrofuran under reflux or with 2-methyltetrahydrofuran at room temperature did not form 20. This was confirmed when the Boc protection failed and no reaction occurred. Then, reduction was tested with borane-tetrahydrofuran (9.21 equivalents) under reflux, which showed complete consumption of the starting material and no product formation. The same was true when using borane dimethyl sulfide complex (10 equivalents).

[0324]

[0325] Scheme 16: Synthetic route 4 of intermediate 20(a).

[0326] Meanwhile, other routes were explored to provide amine 20a. Phthalimide synthesis of the iodine starting material was successfully carried out with potassium phthalimide (1.5 equivalents) in DMF at 50 °C for 8 hours, and compound 22 was isolated in quantitative yield. After 16 hours, deprotection was completed with hydrazine hydrate in ethanol under reflux. After purification by column chromatography, amine 20a was isolated in 91% yield as a mixture. It was speculated that the amine was unstable and needed to be protected.

[0327]

[0328] Scheme 17: Synthetic route 3 of intermediate 20(a).

[0329] After exposure to a large amount of protected alcohol, an attempt was made to convert the material to an azide. The protected alcohol was reacted with Et3N (1.8 equivalents) and methanesulfonyl chloride (1.3 equivalents) in dichloromethane to convert it to its corresponding methanesulfonate. Subsequently, reaction with sodium azide (5 equivalents) provided azide 23 in 50% yield. The Staudinger reduction with PPh3 in Et2O and water at room temperature was not successful and did not show conversion. Although the Staudinger reaction failed to reduce the amine, Pd / C and H2 were able to effect a complete and relatively clean conversion to amine 20a.

[0330] ((8R,9S,13S,14S,17S)-3-benzyloxy-17-hydroxyestratriene-1,3,5(10)-triene (3)

[0331] A mixture of estradiol (2,300 g, 1.1 mol), benzyl bromide (200 mL, 1.68 mol) and potassium carbonate (304 g, 2.2 mol) in acetone (2 L) and methanol (0.5 L) was heated under reflux for about 18 h. After cooling to room temperature, the reaction mixture was filtered and concentrated in vacuo. The concentrate was dissolved in hot toluene and concentrated under reduced pressure. The crude material (508 g) was used as such for the next reaction.

[0332] (8R,9S,13S,14S,17S)-17-Allyloxy-3-benzyloxyestra-1,3,5(10)-triene (4).

[0333] Sodium hydride (110 g, 60% dispersed in mineral oil, 2.7 mol) was added portionwise to a solution of crude alcohol 3 (508 g, about 1.1 mol) in anhydrous tetrahydrofuran (4 L). After about 30 min, allyl bromide (240 mL, 2.7 mol) and tetrabutylammonium iodide (40 g, 108 mmol) were added and the resulting mixture was heated under reflux for about 18 h. The reaction mixture was allowed to cool to room temperature and was carefully quenched with water (1 L). The mixture was partially concentrated. The mixture was dissolved in ethyl acetate (1.5 L) and washed with water (3 × 500 mL). The organic phase was washed with brine, dried over sodium sulfate and concentrated to give crude compound 4 (550 g, 1.36 mol) of sufficient purity for the next step.

[0334] (8R,9S,13S,14S,17S)-3-Benzyloxy-17-(3-hydroxypropoxy)estra-1,3,5(10)-triene (5).

[0335] At 0 °C, 9-borabicyclo[3.3.1]nonane (800 mL, 0.5 M solution in tetrahydrofuran, stable, 400 mmol) was added dropwise to a solution of crude alkene 4 (101.2 g, 251 mmol) in tetrahydrofuran (1 L) and, after the addition was complete, the mixture was stirred at room temperature overnight. The solution was cooled to 0 °C and aqueous 30% NaOH (150 mL, 1.3 mol) and 35% aqueous (120 mL, 1.3 mol) were added dropwise simultaneously and the resulting heterogeneous mixture was stirred vigorously at room temperature for about 1 h. The reaction mixture was then partitioned between ethyl acetate (2 L) and brine (500 mL). The organic phase was washed with an additional 500 mL of brine, dried over sodium sulfate and concentrated in vacuo. The procedure was repeated in a similar manner and the two portions were combined.

[0336] The concentrate was further purified by flash chromatography (silica gel, gradient 25% to 35% ethyl acetate in heptane) to give alcohol 5 (130 g, 310 mmol) as a white solid in 61% yield (3 steps).

[0337] (8R,9S,13S,14S,17S)-3-benzyloxy-17-[3-(perfluorotert-butoxy)propoxy]estra-1,3,5(10)-triene (6).

[0338] Under a nitrogen atmosphere, diisopropyl azodicarboxylate (80 mL, 407 mmol) was added dropwise to a stirred mixture of alcohol 5 (130 g, 301 mmol), triphenylphosphine (162 g, 618 mmol), perfluorotert-butanol (70 mL, 497 mmol) in anhydrous tetrahydrofuran (2 L). The mixture was stirred at room temperature for approximately 18 h. The reaction mixture was partially concentrated and heptane (1 L) was added. After complete removal of the tetrahydrofuran, precipitation began. The solid was removed by filtration and the filtrate was concentrated. Acetonitrile (1.5 L) was added and the mixture was stirred for 30 min while precipitation began. The solid was collected by filtration and dried in vacuo. Compound 6 (160 g, 251 mmol) was isolated in 81% yield as a white solid.

[0339] (8R,9S,13S,14S,17S)-3-hydroxy-17-[3-(perfluorotert-butoxy)propoxy]estra-1,3,5(10)-triene (Phenol 1). Experimental Notebook: MIJ252385-2

[0340] To a Parr vessel was added benzyl ether 6 (160 g, 251 mmol) in ethyl acetate (1 L), to which 10% palladium on carbon (4 g) was added. The mixture was stirred at room temperature under a hydrogen pressure of 5 bar. The reaction was monitored by 1 1H NMR. After approximately 72 h, the reaction mixture was filtered through a pad of diatomaceous earth (rinsed with ethyl acetate) and fresh 10% palladium on carbon (4 g) was added and the reaction was repeated under a hydrogen atmosphere (5 bar). After approximately 16 h, the reaction mixture was filtered through a pad of diatomaceous earth (rinsed with ethyl acetate) and concentrated to give Phenol 1 (125 g, 228 mmol) as a light grey solid in 91% yield.

[0341] Ethyl 4-(4-(3-hydroxypropyl)piperazin-1-yl)butyrate (7):

[0342] Ethyl 4-bromobutyrate (11.4 g, 8.34 mL, 58.2 mmol) and 3-(1-piperazinyl)-1-propanol (8.40 g, 58.2 mmol) in acetonitrile (10 mL) were stirred at room temperature for 16 h. Potassium carbonate (8.05 g, 58.2 mmol) was added and stirred for 1 h, diethyl ether (200 mL) was added, and the mixture was filtered on a glass filter and concentrated. A clear oil was isolated and used as such.

[0343] Ethyl 4-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)butyrate (9)

[0344] To a solution of (13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-ol (8.64 g, 15.8 mmol), ethyl 4-(4-(3-hydroxypropyl)piperazin-1-yl)butyrate (5.7 g, 22 mmol), and triphenylphosphine (5.8 g, 22 mmol) in tetrahydrofuran (150 mL) was added DIAD (4.3 mL, 22 mmol). The mixture was stirred at room temperature for 16 h and then concentrated. The mixture was dissolved in diethyl ether (200 mL) and treated with ethereal 2 M HCl (12 mL), giving a copious precipitate. The mixture was stirred for an additional 30 min and then filtered. The solid was washed with ethyl acetate. Further purification by flash chromatography (60% ethyl acetate to 60% ethyl acetate + 1% Et3N to 100% ethyl acetate + 1% Et3N in heptane) gave compound 9 (7.9 g, 10 mmol) as a clear oil in 64% yield.

[0345] 4-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)butyric acid (12)

[0346] To a solution of ester 9 (6.93 g, 8.79 mmol) in tetrahydrofuran (40 mL) was added sodium hydroxide (0.44 g, 11.0 mmol) and water (40 mL). Stirring was continued for 18 h. The seemingly oily mixture became a clear solution. The mixture was carefully concentrated in a 1 L flask (a large amount of foam was generated due to its soap-like nature). Compound 12 (6.47 g, 8.5 mmol) was obtained as a solid and used in the next step as such.

[0347] 3-(3-(2,2-Dimethyl-1,3-dioxan-5-yl)propoxy)-N-(3-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)propyl)acrylamide.

[0348] To a solution of compound 12 (3.06 g, 3.91 mmol), 2-(3-(2,2-dimethyl-1,3-dioxan-5-yl)propoxy)ethylamine (1.19 g, 5.47 mmol), and triethylamine hydrochloride (538 mg, 3.91 mmol) in DMF (40 mL) was added DIPEA (2.1 mL, 11.7 mmol) and EDCI (900 mg, 4.69 mmol). The mixture was stirred at room temperature for 72 h. Complete coupling was confirmed only by TLC and MS. Ethyl acetate (50 mL) was added to the mixture, and the mixture was washed with aqueous saturated potassium carbonate, then heptane (40 mL) was added, washed with water, and the mixture was concentrated. Further purification was carried out using flash chromatography (2% to 10% methanol (7M NH3) in dichloromethane) to give compound 13 (1.7 g, 1.8 mmol) as a viscous oil.

[0349] N-(3-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)propyl)-3-((5-hydroxy-4-(hydroxymethyl)pentyl)oxy)propanamide hydrochloride (14)

[0350] To a solution of compound 13 (1.7 g, 1 Eq, 1.8 mmol) in dichloromethane (2 ml) and methanol (75 mL) was added 37% HCl (0.5 ml). Stirring was continued for 3 h (a large amount of white precipitate). The mixture was concentrated and triturated with ethyl acetate. The white solid of HCl salt 14 (1.7 g, 1.8 mmol) was used as such.

[0351] N-(2-((5-(Bis(4-methoxyphenyl)(phenyl)methoxy)-4-(hydroxymethyl)pentyl)oxy)ethyl)-4-(4-(3-(((8R,9S,13S,14S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)butanamide (15)

[0352] Under a nitrogen atmosphere, compound 14 (841 mg, 914 μmol) was dissolved in dichloromethane (100 mL). Triethylamine (185 mg, 255 μL, 1.83 mmol) and 1-[chloro-(4-methoxyphenyl)phenylmethyl]-4-methoxy-benzene (294 mg, 868 μmol) were added, and the mixture was stirred at room temperature for 16 h. When TLC showed almost complete conversion, an additional amount of 1-[chloro-(4-methoxyphenyl)phenylmethyl]-4-methoxy-benzene (31.0 mg, 91.4 μmol) was added. Stirring was continued for 1 h, then the mixture was washed with aqueous saturated sodium bicarbonate, dried over sodium sulfate and concentrated. Further purification was carried out using flash chromatography (gradient 5% to 7% methanol (containing 7 M NH3) in dichloromethane) to give compound 15 (880 mg, 0.72 mmol) as a clear oil.

[0353] 2-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(2-(4-(4-(3-(((8R,9S,13S,14S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)butanamido)ethoxy)pentyl (2-cyanoethyl)diisopropylphosphoramidite (Apo-Si-K-1007)

[0354] At 0 °C, 3-((bis(diisopropylamino)phosphino)oxy)propanenitrile (620 mg, 2.06 mmol) was added to a solution of compound 15 (880 mg, 720 μmol) in dichloromethane (50 mL) and diisopropylammonium salt tetrazole (194 mg, 1.13 mmol). The mixture was stirred at room temperature for 4 h and then concentrated. Further purification using flash chromatography (gradient 100% ethyl acetate to 20% acetone in ethyl acetate (total +1% Et3N)) gave Apo-Si-K-1007 (470 mg, 0.33 mmol) in 44% yield as a clear oil.

[0355] 5-(3-(2-Azidoethoxy)propyl)-2,2-dimethyl-1,3-dioxane (23). To a solution of 2-(3-(2,2-dimethyl-1,3-dioxan-5-yl)propoxy)ethan-1-ol (7.0 g, 32 mmol), dichloromethane (70 mL) and triethylamine (8.0 mL, 58 mmol). The solution was cooled to 0 °C. Methanesulfonyl chloride (3.2 mL, 42 mmol) was added dropwise via a dropping funnel while maintaining the temperature below 1 °C. The mixture was stirred at room temperature for 30 min, then quenched with aqueous saturated sodium bicarbonate, further diluted with dichloromethane, and the organic layer was collected. The organic layer was dried over sodium sulfate and concentrated.

[0356] The material was dissolved in acetone (700 mL), and sodium azide (10 g, 160 mmol) and TBAI (200 mg) were added, and the material was heated to reflux. After 16 h, the mixture was cooled to room temperature, filtered and concentrated. The pale yellow oil was purified using flash chromatography (30% to 60% ethyl acetate in heptane) to give compound 23 (3.0 g, 10 mmol).

[0357] 5-(3-(2-Aminoethoxy)propyl)-2,2-dimethyl-1,3-dioxane, named (20a): Palladium on carbon (250 mg, 2.35 mmol) was added to a solution of azide 23 (4 g, 0.02 mol) in tetrahydrofuran (50 mL) and ethanol (20 mL). Vacuum was applied and the air was purged with hydrogen (3x). Stirred at room temperature for 16 h under a hydrogen atmosphere. Filtered through a short pad of diatomaceous earth and concentrated. The crude material was found to be suitable for the next reaction.

[0358] The synthesis of key intermediate 7 is described in the following scheme. Protection of estrone with acetal (i.e., compound 3) allows for selective ring opening as a means of obtaining the C3-ether. Typically, this opening is achieved using 4 equivalents of AlCl3 and 1.2 equivalents of LiAlH4 and refluxing for several hours, but this harsh reaction does not allow for other functional groups. A milder method has recently been developed, using TMSOTF and BH3·DMS at -78 °C, but it is not applicable to free phenols. Although the benzyl protecting group on phenol is generally suitable for all purposes, removing it by hydrogenation is rather cumbersome. Placing the desired C3-chloride (i.e., compound 4) in position and effecting ring opening gives a complete and relatively clean conversion to compound 5.

[0359] Synthesis of Apo-Si-K-1000

[0360] The synthesis of Apo-Si-K-1000 is described in the following scheme:

[0361]

[0362]

[0363] Scheme 18: Synthesis of Apo-Si-K1000

[0364] Synthesis of Apo-Si-K-1013

[0365] The Mitsunobu condition is used to attach the perfluorinated motive to produce compound 6. For the subsequent workup, all materials are dissolved in heptane such that most of the triphenylphosphine oxide precipitates, and further purification is carried out by filtration essentially using silica, resulting in excellent purity as all by-products and Mitsunobu reagents adhere to the silica.

[0366]

[0367] Scheme 18: Synthesis of compound 8

[0368] Alkylation of piperazine on the chloride proceeds readily and appears to be selective. When an aqueous workup is employed, the excess piperazine is washed away. Further functionalization of compound 8 can be carried out by treating compound 7 with 1 equivalent of bromide.

[0369]

[0370] Scheme 19: Synthesis of Apo-Si-K-1013

[0371] In the presence of a base such as piperazine, deprotection of Boc-protected amines is always difficult. Piperazine is first protonated, leading to precipitation of the substance, which hinders acid deprotection. However, using 4M HCl in dioxane allows the substance to dissolve sufficiently, enabling complete deprotection. Subsequent coupling of the peptide with PyBOP or DCC / DMAP permits the attachment of the acid. However, purification at this stage seems troublesome, presumably due to the basic group of piperazine and the amide formed. Treatment with TBAF and attachment of the phosphonium ester are the final steps to obtain Apo-Si-K-1013.

[0372] For the final attachment, we had to abandon our initial protocol (TFA, NMM) because we thought that the basic piperazine hindered the successful removal of TFA and the final compound was difficult to obtain in the form of a salt. However, discarding TFA from the mixture did not provide any conversion, and it seems that the phosphonium ester reagent requires acidic activation for successful attachment. Using diisopropylamine-tetrazole as the base and a Lewis acid, successful coupling was achieved, and the Lewis acid was weak enough to be removed by further purification.

[0373] (8R,9S,13S,14S)-13-Methyl-6,7,8,9,11,12,13,14,15,16-decahydrospiro[cyclopenta[a]phenanthrene-17,2'-[1,3]dioxolane]-3-ol (3). Experimental Notebook (Notebook): RVE21010102-01 To a suspension of (8R,9S,13S,14S)-3-hydroxy-13-methyl-6,7,8,9,11,12,13,14,15,16-decahydro-17H-cyclopenta[a]phenanthren-17-one (250 g, 1.00 Eq, 924 mmol) in toluene (1.5 L) was added triethyl orthoformate (205 g, 231 mL, 1.5 Eq, 1.38 mol), 1,3-propanediol (105 g, 100 mL, 1.5 Eq, 1.38 mol), and pTsOH (1.75 g, 0.01 Eq, 9.24 mmol). The suspension was stirred mechanically. No exotherm was observed when the chemicals were added together. The mixture was warmed to 60 °C (internal) and stirred for 2 h. The mixture became a pale yellow solution. The reaction mixture was stirred overnight at 60 °C (internal). 1,3-Propanediol (35.18 g, 33.41 mL, 0.5 Eq, 462.3 mmol) and triethyl orthoformate (68.5 g, 76.9 mL, 0.5 Eq, 462 mmol) were added at 60 °C, and the reaction was stirred for 3 h. The reaction was cooled to 40 °C, then triethylamine (4.67 g, 6.44 mL, 0.05 Eq, 46.2 mmol) and water (599 g, 599 mL, 36 Eq, 33.2 mol) were added, and the mixture was stirred for 10 min. The phases were separated, and the organic layer was concentrated to approximately 1 L and allowed to stand for 16 h. A solid precipitated, the mixture was stirred mechanically for 4 h, then filtered, washed with 300 mL of toluene and 200 mL of heptane, and dried by suction filtration. The product was obtained as a white solid (235 g, 77.4%), ground, and the 1H NMR was measured.

[0374] (13S)-3-(3-Chloropropoxy)-13-methyl-6,7,8,9,11,12,13,14,15,16-decahydrospiro[cyclopenta[a]phenanthrene-17,2'-[1,3]dioxolane] (4).

[0375] To a solution of (13S)-13-methyl-6,7,8,9,11,12,13,14,15,16-decahydrospiro[cyclopenta[a]phenanthrene-17,2'-[1,3]dioxane]-3-ol (34.50 g, 1 Eq, 105.0 mmol) in DMF (40 mL) was added cesium carbonate (51.34 g, 1.5 Eq, 157.6 mmol) and 1-bromo-3-chloropropane (33.07 g, 20.78 mL, 2 Eq, 210.1 mmol). Stirring was continued at room temperature for 16 h. The mixture was diluted in ethyl acetate (50 mL) and heptane (250 mL) and washed with water (3 × 50 mL) and brine (50 mL), dried over sodium sulfate and concentrated. The product was isolated in quantitative yield as a clear oil. The crude material was used as such in the next reaction.

[0376] 3-(((8R,9S,13S,14S,17S)-3-(3-chloropropoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-17-yl)oxy)propan-1-ol (5).

[0377] To a 2 L reaction vessel was added a solution of (8R,9S,13S,14S)-3-(3-chloropropoxy)-13-methyl-6,7,8,9,11,12,13,14,15,16-decahydrospiro[cyclopenta[a]phenanthrene-17,2'-[1,3]dioxane] (104 mmol) in dichloromethane (anhydrous, 1 L), and the solution was cooled to -78 °C (cooled with solid dry ice). Borane dimethyl sulfide complex (10.2 g, 12.8 mL, 1.3 Eq, 135 mmol) was added in one portion via syringe (T dropped to -75 °C and then back to -78 °C). Trimethylsilyl trifluoromethanesulfonate (30.0 g, 24.4 mL, 1.3 Eq, 135 mmol) was added to the mixture in a rapid stream (∼1 min), and the reaction was stirred at -75 °C for 2 h. Brine (500 mL) was carefully added to quench the reaction mixture in solution, and stirring was continued for 16 h. The layers were separated (separation was clear). The organic layer was washed with water and brine and concentrated. The product (42.2 g, 104 mmol) was isolated as a clear oil.

[0378] (13S,17S)-3-(4-chlorobutoxy)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthrene (6)

[0379] Dissolve 3-(((13S,17S)-3-(3-chloropropoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-17-yl)oxy)propan-1-ol (44 g, 1 Eq, 0.11 mol) in THF (1 L) and cool to 0 °C. Add triphenylphosphine (40 g, 1.4 Eq, 0.15 mol), 1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-ol (33 g, 20 mL, 1.3 Eq, 0.14 mol) to this solution and add DIAD (27 g, 26 mL, 97% Wt, 1.2 Eq, 0.13 mol) dropwise. Stir the reaction at room temperature for 1 h. Concentrate the mixture, treat with heptane (~1 L), and stir for 16 h to precipitate. Filter off the solid and wash with heptane. Concentrate the organics. Further purify using flash chromatography (5% EtOAc in heptane) to give compound 6 (61.3 g, 96 mmol) as a clear oil in 91% yield (3 steps).

[0380] 1-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazine (7)

[0381] Treat a mixture of (13S,17S)-3-(3-chloropropoxy)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthrene (61.32 g, 1 Eq, 98.11 mmol), piperazine dichloride (46.81 g, 3 Eq, 294.3 mmol), and potassium carbonate (47.46 g, 3.5 Eq, 343.4 mmol) in acetonitrile (1.5 L) with 35% aqueous sodium hydroxide (34 g, 31 mL, 3 Eq, 294.3 mmol) and reflux for 48 h. Intermediate analysis shows partial conversion. Add piperidine (8.4 g, 98 mmol) and continue heating for an additional 16 h. Cool the mixture to room temperature, filter, and concentrate partially. Add ethyl acetate (1 L), and wash the mixture with water (2 × 150 mL) and brine, dry over sodium sulfate, and concentrate. Isolate the crude material (68.0 g) in quantitative yield, which is clean enough for subsequent chemistry.

[0382] (3-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)propyl)carbamic acid tert-butyl ester (8).

[0383] A mixture of tert-butyl (3-bromopropyl)carbamate (1.2 g, 1.1 Eq, 5.1 mmol), 1-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazine (3.1 g, 1 Eq, 4.6 mmol), and potassium carbonate (1.3 g, 2 Eq, 9.2 mmol) in acetonitrile (40 mL) was heated to 60 °C for 16 h. The mixture was concentrated and further purified by flash chromatography (gradient 50% to 80% EtOAc in heptane (+1% Et3N)). Compound 8 (3.2 g, 3.8 mmol) was isolated as an oil.

[0384] 3-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)propan-1-amine (9)

[0385] A suspension of compound 9 (3.2 g, 1 Eq, 3.8 mmol) was treated with 4 M HCl in dioxane (50 mL) and stirred for 3 h, then concentrated. The HCl salt was obtained in quantitative yield.

[0386] 9-((tert-Butyldiphenylsilyl)oxy)-N-(3-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)propyl)nonanamide (12)

[0387] To a suspension of compound 9 (3.2 g, 1 Eq, 3.8 mmol) in dichloromethane (350 mL) was added DMAP (0.46 g, 1 Eq, 3.8 mmol) and triethylamine (1.9 g, 2.7 mL, 5 Eq, 19 mmol). After 5 min, a solution of 9-((tert-butyldiphenylsilyl)oxy)nonanoic acid (10, 1.9 g, 1.2 Eq, 4.6 mmol) in dichloromethane (1 mL) and PyBOP were added. Stirring was continued for 5 h. The mixture was washed with 2 M NaOH (2 × 40 mL), then with brine, dried over sodium sulfate and concentrated. The crude material of compound 11 was used as such.

[0388] The material was dissolved in THF (50 mL), and a solution of 1 M tetrabutylammonium fluoride (5.7 mL, 1.5 Eq, 5.7 mmol) in THF was added, and stirring was continued at room temperature for 16 h. The mixture was concentrated and dissolved in ethyl acetate (250 mL), washed with water (3 × 50 mL), then with brine. The organic matter was dried over sodium sulfate and concentrated. Purification was carried out using flash chromatography (gradient of 2% to 8% MeOH in dichloromethane with 7 M NH3) to give compound 12 as an oil, still containing PyBOP-residue. The material was dissolved in dichloromethane (50 mL), and 2 M HCl in diethyl ether (4 mL) was added and stirred for 30 min. The white solid was filtered and washed with dichloromethane and ethyl acetate. The white solid was collected and partitioned between ethyl acetate (150 mL) and 1 M aqueous sodium hydroxide. The organic layer was dried over sodium sulfate and concentrated. Compound 12 (1.38 g, 1.6 mmol) was isolated as a viscous oil.

[0389] 2-Cyanoethyl (9-((3-(4-(3-(((8R,9S,13S,14S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)propyl)amino)-9-oxononyl)diisopropylphosphoramidite (1):

[0390] At 0 °C, 3-((bis(diisopropylamino)phosphino)oxy)propanenitrile (937 mg, 2 Eq, 3.11 mmol) was added to a solution of compound 12 (1.38 g, 1 Eq, 1.55 mmol) and diisopropylammonium salt tetrazole (293 mg, 1.1 Eq, 1.71 mmol) in dichloromethane (50 mL). The mixture was stirred at room temperature for 16 h and then concentrated. Further purification was performed using flash chromatography (very slow gradient of 30% to 60% acetone in heptane (total +1% Et3N)) to afford compound Apo-Si-K-1013 (830 mg, 0.76 mmol) and a less pure fraction (100 mg, 0.09 mmol) as a clear oil.

[0391] Oligoribonucleotide synthesis

[0392] Oligoribonucleotides were synthesized on solid phase using a Mermade 12 synthesizer (LGC Bioautomation) according to the phosphoramidite technique, at a scale of approximately 2 × 55 μmol per sequence (2 columns, 55 μmol each). The synthesis was carried out on a solid support made of controlled pore glass, which was loaded with N-benzoyl-deoxycytidine (CPG, loaded with 84 μmol / g) or N-benzoyl-2'-O-methyl-adenosine (CPG, The loading was 85 μmol / g. Conventional DNA and RNA phosphoramidites and auxiliary reagents were purchased from SAFC Proligo (Hamburg, Germany). Specifically, the following phosphoramidite compounds were used: (5'-O-dimethoxytrityl-N6-(benzoyl)-2'-O-tert-butyldimethylsilyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5'-O-dimethoxytrityl-N4-(acetyl)-2'-O-tert-butyldimethylsilyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, (5'-O-dimethoxytrityl-N2-(isobutyryl)-2'-O-tert-butyldimethylsilyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5'-O-dimethoxytrityl-2'-O-tert-butyldimethylsilyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, (5'-O-dimethoxytrityl-N6-(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5'-O-dimethoxytrityl-N4-(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, (5'-O-dimethoxytrityl-N2-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. To introduce 5'-monophosphate, a Phosphat-On reagent available from ChemGenes (CLP-1544) was used. The Apo-Si-K170A building block was dissolved in 70% anhydrous DCM in anhydrous acetonitrile (100 mM) containing molecular sieves except for 2'-O-methyl-uridine phosphoramidite in 30% anhydrous DCM in anhydrous acetonitrile, all other building blocks were dissolved in anhydrous acetonitrile (100 mM) containing molecular sieves . Iodine (50 mM pyridine:H2O = 9:1) was used as the oxidation reagent. 5-Ethylthiotetrazole (ETT, 500 mM in acetonitrile) was used as the activator solution. Unless otherwise stated, the coupling time was 5 minutes. Both the Apo-Si building block and 5'-phosphate were incorporated into the sequence using a double-coupling step with a coupling time of 11 minutes for each coupling (total coupling time of 22 min). The oxidizer contact time for these two building blocks was extended to 2.5 min, while the standard oxidizer contact time was set at 1.5 min.

[0393] Synthesize the sequence without removing the final DMT group.

[0394] Cleavage and deprotection:

[0395] After the assembly of the oligoribonucleotide sequence, the cyanoethyl protecting groups are cleaved. The CPG from two columns of each sequence is combined and treated with NH3:EtOH = 3:1 (15 ml) at 45 °C for 18 h. The resin is filtered off and washed with 20% ethanol (2 × 5 ml).

[0396] Subsequently, the TBDMS protecting groups are removed using triethylamine hydrogen fluoride complex at elevated temperature. The deprotection reaction is quenched by the addition of H2O. The crude mixture is then filtered off (ZapCap nylon 0.2 μm bottle top filter) and the filter is washed thoroughly with H2O. The crude mixture is adjusted to 100 mM triethylammonium acetate (TEAAc) and loaded onto 300 ml (X69346K2) and 400 ml (X69347K2).

[0397] Purification:

[0398] The crude oligomers are purified by RP HPLC using a 16x 150 mm column (Dr. Maisch) packed with Source RPC resin (GE Healthcare) on a Pure instrument (GE Healthcare). Buffer A is 100 mM triethylammonium acetate (TEAAc, pH 7), and buffer B contains 95% acetonitrile in buffer A. A flow rate of 7.2 mL / min and a temperature of 60 °C are employed. UV traces at 260 and 280 nm are recorded. A gradient of 20% B to 100% B is employed over 48 column volumes. The appropriate fractions are pooled and precipitated with 3M NaOAc, (pH = 5.2) and 85% ethanol in the refrigerator. The precipitate is separated by centrifugation, redissolved in water (50 ml), treated with 10x PBS buffer (3 ml) at pH 7.4, and desalted by size exclusion HPLC on a Pure instrument using a 50x165 mm ECO column (YMC, Dinslaken, Germany) packed with Sephadex G25-Fine resin (GE Healthcare).

[0399] Annealing:

[0400] To generate the desired siRNA duplex, two complementary strands are annealed by combining equimolar aqueous solutions of the two strands. The mixture is placed in a 70 °C water bath for 5 minutes and then cooled to ambient temperature over 2 h. The required aliquots are lyophilized for four days and stored at -20 °C.

[0401] Analysis method:

[0402] The crude single strand was analyzed by analytical LC-MS on a 2.1×50 mm XBridge column (Waters) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system in combination with an LCQ Deca XP-plus Q-ESI-TOF mass spectrometer (Thermo Finnigan).

[0403] Buffer A was 16.3 mM triethylamine, 100 mM hexafluoroisopropanol (HFIP) in 1% MeOH in H2O, and buffer B was 95% MeOH in buffer A. A flow rate of 250 μl mL / min and a temperature of 60 °C were used. UV traces were recorded at 260 and 280 nm. A gradient of 1 - 40% B in 0.5 min, followed by 40 to 100% B in 13 min was used.

[0404] The final single strand was analyzed by analytical LC-MS on a 2.1×50 mm XBridge column (Waters) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system in combination with a Compact ESI-Qq-TOF mass spectrometer (Bruker Daltonics).

[0405] Buffer A was 16.3 mM triethylamine, 100 mM hexafluoroisopropanol (HFIP) in 1% MeOH in H2O, and buffer B was 95% MeOH in buffer A. A flow rate of 250 μl mL / min and a temperature of 60 °C were used. UV traces were recorded at 260 and 280 nm. A gradient of 1 - 100% B in 31 min was used.

[0406] The final duplex was analyzed by analytical LC-MS on a 2.1×50 mm XBridge column (Waters) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system in combination with a Compact ESI-Qq-TOF mass spectrometer (Bruker Daltonics).

[0407] Buffer A is 16.3 mM triethylamine, 100 mM hexafluoroisopropanol (HFIP) in 1% MeOH in H2O, and Buffer B is 95% MeOH in Buffer A. A flow rate of 250 μl mL / min and a temperature of 60 °C were used. UV traces were recorded at 260 and 280 nm. A gradient of 1 - 100% B over 31 min was used.

[0408] Prior to duplex analysis, the disulfide bonds of the duplex and each single-stranded Apo-Si-K170A structural unit were reduced in situ. To each analysis sample (50 M, in 100 mM TEAAc, 50 μl), 5 μl of a solution of 100 mM D,L-dithiothreitol (DTT) in 100 mM triethylammonium bicarbonate buffer (TEAB, pH 8.5) was added and left to stand at room temperature for at least 1 h before analysis.

[0409] Example 2

[0410] Cell-free silencing of EGFP using an exemplary conjugate of the present invention

[0411] Method

[0412] dsiRNA duplex: The siRNA duplex is a Dicer substrate designed to silence the EGFP gene.

[0413] The nucleotide sequences of the Apo-Si-K-170-A, Apo-Si-K-170-B, Apo-Si-K-170-C, Apo-Si-K-941, Apo-Si-K-1000, Apo-Si-K-1007, Apo-Si-K-1013, and Apo-Si-K-1014 conjugates are as follows:

[0414] · Sense: 5'-phosphate (Apo-Si-K-170A)ACCCTGAAGTTCATCTGCACCACCG-3'(SEQ ID NO:1)

[0415] · Antisense: 5'-phosphate (Apo-Si-K-170A)CGGTGGTGCAGATGAACTTCAGGGTCA-3'(SEQ IDNO:2)

[0416] · Sense: 5'-phosphate (Apo-Si-K-170B)ACCCTGAAGTTCATCTGCACCACCG-3'(SEQ ID NO:1)

[0417] · Antisense: 5'-phosphate (Apo-Si-K-170B) CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO:2)

[0418] · Sense: 5'-phosphate (Apo-Si-K-170C) ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO:1)

[0419] · Antisense: 5'-phosphate (Apo-Si-K-170C) CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO:2)

[0420] · Sense: 5'-phosphate (Apo-Si-K-941) ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO:1)

[0421] · Antisense: 5'-phosphate (Apo-Si-K-941) CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO:2)

[0422] · Sense: 5'-phosphate (Apo-Si-K-1000) ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO:1)

[0423] · Antisense: 5'-phosphate (Apo-Si-K-1000) CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO:2)

[0424] · Sense: 5'-phosphate (Apo-Si-K-1007) ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO:1)

[0425] · Antisense: 5'-phosphate (Apo-Si-K-1007) CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO:2)

[0426] · Sense: 5'-(Apo-Si-K-1013) ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO:1)

[0427] · Antisense: 5'-(Apo-Si-K-1013) CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO:2)

[0428] · Sense: 5'-(Apo-Si-K-1014)ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO:1)

[0429] · Antisense: 5'-(Apo-Si-K-1014)CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO:2)

[0430] Protein-free fraction after incubation with BSA

[0431] For systemic administration into the blood, it is valuable for a drug to have a fraction that binds to serum / plasma proteins and a free fraction that freely migrates through the extracellular space into cells. To examine this aspect of the Apo-Si-K-170-A, Apo-Si-K-170-B, and Apo-Si-K-170-C conjugates, gel electrophoresis was employed: 20 picomole samples of the Apo-siRNA construct were diluted in Tris buffer at pH = 7.4 and bovine serum albumin (BSA) was added to final concentrations of 2 mg / ml and 5 mg / ml. All samples were incubated overnight at 37°C. These samples were then loaded onto a 12% native polyacrylamide gel and migrated for 1 hour in an electric field of 5 V / cm (Bio-Rad mini protean). Control samples included dsi-RNA construct samples diluted with water instead of BSA. Apo-Si-S1, a structurally similar Apo-Si conjugate that binds to BSA with high affinity, was used as a positive control. The chemical structure of Apo-Si-S1 is shown below:

[0432] where * represents the junction point of the oligonucleotide.

[0433] Results: Figure 1 Showed the protein-free fraction after incubation with BSA. In contrast to Apo-Si-S1, which interacts almost completely with BSA (>95% binding), a large free fraction was observed among the conjugates tested, with Apo-Si-K-170-A showing a higher free fraction than Apo-Si-K-170-B and Apo-Si-K-170-C.

[0434] Furthermore, the inventors have observed that Apo-K-160-A,

[0435]

[0436] (It is a structural analog similar to Apo-Si-K-170-A) is inactive in the presence of serum (even in the presence of serum, at a concentration of 600 nM, when incubated with Apo-K-160-A, no GFP inhibition was observed in HeLa-GFP cells).

[0437] Therefore, the inventors concluded that compared to analogs with structures similar to those not according to the present invention, the conjugates of the present invention have significantly lower binding affinities for serum proteins (such as BSA).

[0438] Therefore, it is speculated that the conjugates of the present invention will have greater potency in vivo (compared to conjugates with similar structures), due to their lower non-specific binding to serum proteins, especially when administered iv.

[0439] Cleavage of the disulfide bond moiety of the Apo conjugate when incubated with glutathione (GSH)

[0440] One hallmark in the design of the Apo-Si-K-170-A, Apo-Si-K-170-B, and Apo-Si-K-170-C moieties is the incorporation of a disulfide bond, with the aim of undergoing selective cleavage under the reducing conditions prevalent in the cytoplasm, thereby releasing the carried genetic drug to interact with the following cytoplasmic gene-silencing complexes: Dicer and RISC. To demonstrate this feature, 20 picomoles of the RNA sample was diluted in 30 mM Tris buffer (pH = 7.4, supplemented with 5 mM glutathione (GSH, Sigma)). All samples were incubated at 37 °C for 4 hours. Control samples were diluted in water. The samples were then loaded onto a 12% native polyacrylamide gel and migrated in an electric field of 5 V / cm for 1 hour (Bio-Rad mini protean).

[0441] Results: Figure 2 Incubation of the Apo-Si-K-170-A, Apo-Si-K-170-B, and Apo-Si-K-170-C conjugates with glutathione (5 mM, for 4 hours at 37 °C) was shown to result in robust cleavage of the conjugates in the following order: Apo-Si-K-170-C > Apo-Si-K-170-A > Apo-Si-K-170-B >> Apo-Si-K-93-A.

[0442] Apo-Si-K-93-A (chemical structure shown below) is a structurally similar conjugate with a disulfide bond. Therefore, based on Figure 2 the results shown, the inventors concluded that compared to structurally similar conjugates, the conjugates of the present invention are characterized by a greater ability to effect cytoplasmic disulfide bond cleavage.

[0443] Apo-Si-K-93-A:

[0444]

[0445] where * is the attachment point of the oligonucleotide, H or phosphate residue.

[0446] Example 3

[0447] Ex vivo silencing of EGFP using exemplary conjugates of the invention

[0448] Cell culture

[0449] Ex vivo study: Hela-GFP and 3T3-GFP cell lines were obtained from Cell Biolabs. Cells were grown in Dulbecco's Modified Eagle Medium (Gibco) supplemented with 10% FBS (Gibco), 100 U / ml penicillin, 100 mg / ml streptomycin (Biological Industries, Israel) and 10 μg / ml blasticidin. Cells were maintained in an incubator at 37 °C with 5% CO2 humidified air. One day prior to transfection, cells were plated on 24-well black glass bottom plates (40,000 cells / well). The next day, cells were exposed to Apo-Si-K-170-A, Apo-Si-K-170-B and Apo-Si-K-170-C conjugated to EGFP-dsiRNA (see above) in the presence of complete medium containing 10% serum. For serum-free transfection conditions, the medium was aspirated, the cells were washed with Hank's Balanced Salt Solution (HBSS), and then the medium was replaced with serum-free Opti-MEM (Thermo Fisher Scientific) for 24 h, followed by incubation with complete medium for an additional 48 h. Downregulation of protein expression was measured 72 h after transfection. For this purpose, the medium was aspirated and the cells were washed with HBSS. EGFP fluorescence intensity was quantified using an Infinite M200-Pro multimode microplate reader (Tecan) with an excitation wavelength of 488 nm and an emission wavelength of 535 nm. Untreated cells were used as controls. Experiments were performed in triplicate; results are presented as mean + SD.

[0450] Results: In the presence of complete medium (10%) serum, in the Hela-GFP cell line, 600 nM of conjugates Apo-Si-K-170-A, Apo-Si-K-170-B and Apo-Si-K-170-C reduced the expression of EGFP to 49.9%, 83.1% and 70.8% of the control, respectively (see Figure 3A ).

[0451] Under serum-free conditions, the Apo-Si-K-170-A conjugate induced potent EGFP knockdown in a dose-dependent manner. When the cells were treated with 10 and 40 nM of the conjugate respectively, the EGFP expression decreased to 57.1% and 30.0% of the control. The same trend was observed for the Apo-Si-K-170-B and Apo-Si-K-170-C conjugates (see Figure 3B ).

[0452] In the 3T3-GFP cell line under serum-free conditions, the Apo-Si-K-170-A conjugate induced significant EGFP knockdown in a dose-dependent manner. When the cells were treated with 10 and 40 nM of the conjugate respectively, the EGFP expression decreased to 71.0% and 45.5% of the untreated control. The same trend was observed for the Apo-Si-K-170-B and Apo-Si-K-170-C conjugates (see Figure 3C ).

[0453] Conclusion: In the presence of serum, in the Hela-GFP cell line, the Apo-Si-K-170-A conjugate has enhanced silencing ability compared to the Apo-Si-K-170-B and Apo-Si-K-170-C conjugates.

[0454] Results: In the 3T3-GFP cell line under serum-free conditions, the Apo-Si-K-941 conjugate induced potent EGFP knockdown in a dose-dependent manner. When the cells were treated with 40 and 150 nM of the conjugate respectively, the EGFP expression decreased to 53.87% and 23.99% of the untreated control. The same trend was observed for the Apo-Si-K-170A conjugate (see Figure 3D ).

[0455] Conclusion: Under serum-free conditions, in the 3T3-GFP cell line, the Apo-Si-K-170-A conjugate has enhanced silencing ability compared to the Apo-Si-K-491 conjugate.

[0456] In addition, the conjugate based on Apo-Si-K-1013 showed strong downregulation of EGFP in vivo (data not shown).

[0457] Example 4

[0458] CF efficacy in vivo

[0459] Cystic fibrosis (CF) is a genetic disorder that, due to frequent lung infections (>70,000 cases globally, 1,000 new cases per year), results in limited breathing ability and coughing up mucus. Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause dysfunction of the CFTR protein, and ions cannot flow out of the cell due to blocked channels. Without chloride (Cl - ) attracting water to the cell surface, mucus in various organs becomes thick and sticky. Epithelial sodium channel (ENaC) is a membrane-bound ion channel that selectively permeates Na + . ENaC consists of three homologous subunits (α, β, γ) encoded by four genes: SCNN1A / B / G / D. In the absence of functional CFTR, the ENaC channel is upregulated and further reduces the secretion of salt and water by reabsorbing sodium ions. Therefore, the respiratory complications of CF are not only caused by insufficient chloride secretion, but by increased sodium and water reabsorption; the αENaC subunit is essential for full channel function, and the β and γ subunits are regulators of ENaC activity, and residual ENaC activity can be measured in their absence. The exemplary inhaled conjugate of the present invention (K170A-ENaC conjugate) is designed to block sodium absorption, which can maintain airway surface hydration, which can help make mucus less thick and thus easier to keep the airways of CF patients clear. In addition, ENaC inhibition may act synergistically with CFTR modulators.

[0460] The sequence of the K170A-ENaC conjugate is as follows:

[0461] Sense:

[0462] 5'-phosphate-(Apo-Si-K170A)TGTGCAACCAGAACAAATCAGACTG-3' (SEQ ID NO:3)

[0463] Antisense:

[0464] 5'-phosphate-(Apo-Si-K170A)CAGTCTGATTTGTTCTGGTTGCACAGT-3' (SEQ ID NO:4).

[0465] Evaluation of the efficacy of CF in a mouse model: After induction with dexamethasone, the use of the K170A-ENaC conjugate (K170A-ENaC conjugate, 400 nM) bound to dicer substrate siRNA resulted in a 63% knockdown (KD) of the SCN1A gene in adenocarcinoma human alveolar basal epithelial cells (A549), and (75%) in Hela transfected cells. Next, purebred female ICR mice were IT-treated with microspores containing the substance (100 - 200 μg) in 50 μL of 5% glucose on days 1, 2, and 5, and terminated on day 7, and knockdown evaluation was performed by real-time PCR analysis. Notably, CF patients only require a 50% KD of ENaC. In vivo experiments showed that high KD was obtained in a dose-dependent manner with the K170A-ENaC conjugate (100 μg - 46%, 150 μg - 58%, 200 μg - 76%), while 200 μg of only siRNA or 200 μg of the K170A-ENaC conjugate bound to dicer substrate siRNA-GFP as a control non-related sequence only resulted in a 15% KD. These results indicate the high selectivity and high potential of the K170A-ENaC conjugate as a CF treatment. As can be seen from Figure 6 In local delivery, there was no systemic exposure of MNM-siRNA in the liver and kidneys, and ENaC KD was specific to the target tissue. After entering the cell, the reducing environment of the cytoplasm caused the detachment of MNMs, and the siRNA was retained in the cell. MNMs were metabolized and secreted, while the RNA was trimmed by Dicer, and the single-stranded RNA entered the RNA-induced silencing complex (RISC) to affect the cleavage of complementary mRNA.

[0466] Example 5

[0467] In vivo HL efficacy

[0468] Hearing loss (HL) is an underestimated disorder that affects more than 1.5 billion people globally. There are different types of HL, but the most prevalent (90%) is sensorineural HL (SNHL). SNHL usually occurs after damage or dysfunction of the hair cells in the inner ear; their synapses with the primary auditory neurons or the vestibulocochlear nerve (synaptopathy); the stria vascularis or the central processing centers of the brain. After intracochlear (IC) delivery in guinea pigs (GP), the cochlear distribution of the Cy3-labeled dsiRNA conjugate of the present invention was evaluated compared to naked Cy3-labeled dsiRNA.

[0469] In vivo studies consisted of five groups of GPs: one (1) sham-treated group (untreated), one (1) group treated with Cy3-naked dsiRNA via the IC administration route (one ear), and two (2) groups treated with the Apo-Si-K170A Cy3-dsiRNA conjugate via the IC administration route and sampled at different time points):

[0470] · Group 1: Sham-treated group (n = 3) - both ears were tested

[0471] · Group 2: Cy3-naked dsiRNA treatment group (IC route) - T +30小时 (14.4 μg / ear) (n = 6)

[0472] · Group 3: Apo-Si-K170A Cy3-dsiRNA conjugate treatment group (IC route) - T +25小时 (14.4 μg / ear) (n = 6)

[0473] · Group 4: Apo-Si-K170A Cy3-dsiRNA treatment group (IC route) - T +30小时 (14.4 μg / ear) (n = 6)

[0474] The sequence of the Apo-Si-K170A Cy3-dsiRNA conjugate is as follows:

[0475] Sense:

[0476] 5'-phosphate (Apo-si-K170A)(Cy3)TTACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO:5).

[0477] Antisense:

[0478] 5'-phosphate (Apo-si-K170A)CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO:2).

[0479] The dsiRNA was delivered by IC infusion using an Alzet osmotic pump connected to a catheter inserted at the base of the cochlea for 24 hours. At 1 or 6 hours after IC infusion (T +25小时 or T +30小时, animals were sacrificed at 1 or 6 hours (corresponding to 24 hours after continuous infusion), and at two time points (1 or 6 hours) after the end of delivery, two different histological techniques were used: flat surface preparation and cochlear cross sections to qualitatively evaluate the distribution (presence or absence) of Cy3-labeled MNMs-dsiRNA conjugates in cochlear tissue. For the flat surface preparation technique, the distribution of Cy3-labeled MNMs-dsiRNA conjugates and Cy3-naked dsiRNA in hair cells, supporting cells, and auditory fibers in three segments along the cochlear partition (apex, middle, and base of the cochlea) was described. For the cochlear cross section technique, the distribution of Cy3-labeled MNMs-dsiRNA and Cy3-dsiRNA in hair cells, supporting cells, auditory fibers, and spiral ganglion neurons in three parts of the cochlea (apex, middle, and base of the cochlea) was described.

[0480] It can be seen from Figure 7A -C that compared with the naked dsiRNA-treated group (IC) T+30 hours (group 2) shown in Figure 7D -F, in the Apo-Si-K170AdsiRNA conjugate-treated group (IC) T+30 hours (group 4), enhanced Cy3 signals were observed in inner hair cells (IHC), outer hair cells (OHC), supporting cells (SC), auditory nerve fibers (ANF), and spiral ganglion cells (indicated by arrows) at the base, middle, and apex of the cochlea.

[0481] Example 6

[0482] In vitro CMT1A efficacy

[0483] Materials and methods

[0484] In vitro studies were performed using 3T3-NIH cells in 6-well plates (200,000 cells / well, 2 ml / well). The test materials (Apo-Si-K1000-PMP22 or Apo-Si-K1000-nonspecific dsiRNA sequence) were diluted (10 - 400 nM) in OptiMEM medium from a 20 μM stock solution and incubated in a humidified incubator at 37 °C / 5% CO2 for 48 hours. Under serum-free conditions, before transfection with the Apo-Si-MNM construct, the medium was removed, the cell monolayer was washed once with a large volume of HEPES-buffered saline, and replaced with OptiMEM.

[0485] The sequence of Apo-Si-K1000-PMP22 is as follows:

[0486] Sense: 5'-p(Apo-Si-K1000)GAAATGGTGCTATAGATTTACCATT-3(SEQ ID NO:6).

[0487] Antisense: 5'-p(Apo-Si-K1000)AATGGTAAATCTATAGCACCATTTCAC-3'(SEQ ID NO:7).

[0488] Twenty-four hours after transfection, fresh complete DMEM medium (10% FBS) containing penicillin / streptomycin antibiotics was added. RNA was extracted using the pure link RNA minikit, lysed with 1 ml of TRIzol reagent according to the manufacturer's protocol, and its concentration was measured by nanodrop for cDNA preparation. RT-PCR was performed by the Fast SYBR green master mix protocol, which used specific probes for the target gene and β-actin as an endogenous control.

[0489] Similar assays were performed in HeLa cells (40,000 cells / well, 2 ml wells) with test materials in the concentration range of 100 - 400 nM and in S16-Schwann cells (350,000 cells / well, 2 ml wells) with test materials in the concentration range of 50 - 200 nM.

[0490] Charcot Marie-Tooth type 1A (CMT1A) is thought to be caused by a duplication of the region on chromosome 17 that encodes the overexpressed peripheral myelin protein 22 (PMP22 protein). PMP22 is an integral membrane protein, a hydrophobic glycoprotein, and is mainly highly expressed in Schwann cells. It is a major component of compact myelin in the peripheral nervous system and accounts for 2 - 5% of the total protein content. It has been reported that it plays a key role in maintaining cholesterol homeostasis in Schwann cells. Therefore, direct delivery of dsiRNA targeting the PMP22 gene into the cytoplasm of Schwann cells using MNMs could prove to be a breakthrough in the development of treatment for this disorder.

[0491] The inventors developed PMP22-targeted dsiRNA (MNM-PMP22), which was designed for systemic or intrathecal administration.

[0492] Initial in vitro studies conducted by the inventors have demonstrated that Apo-Si-K1000-PMP22 successfully silenced the expression of the PMP22 gene in a concentration-dependent manner in 3T3-NIH cells (see Figure 8A ). The IC 50 for this effect was ~50 nM. In HeLa cells (see Figure 8B) and S16 - Schwann cells (see Figure 8C ) Similar results were obtained. In these studies, it was further demonstrated that the Apo - Si - K1000 - PMP22 dsiRNA conjugate did not alter the expression of unrelated genes, demonstrating the specificity of this method. In summary, these results highlight the great potential of the Apo - Si dsiRNA delivery method in the treatment of CMT1A.

[0493] Example 7

[0494] In vivo antiviral activity

[0495] RSV: Apo - Si - K170A - V20, in the RSV mouse infection model. Female BALB / c mice infected with RSV were treated with a vehicle, a positive control compound (ribavirin, 50 mpk), or the test article according to a predetermined protocol and dose. Lung tissues were harvested on day 5 to determine virus titers, thereby evaluating the efficacy of RSV inhibition.

[0496] The chemical structure of Apo - Si - K170A - V20 is as follows:

[0497] Sense:

[0498] 5'-p(Apo - Si - K170A)GGCTCTTAGCAAAGTCAAGTTGAAT - 3'(SEQ ID NO:8)

[0499] Antisense:

[0500] 5'-p(Apo - Si - K170A)ATTCAACTTGACTTTGCTAAGAGCCAT - 3'(SEQ ID NO:9)

[0501] The experimental results are summarized in Figure 9 .

[0502] Compared with the vehicle group, the positive control ribavirin (50 mg / kg) significantly reduced the lung virus titer by 0.869 Log (plaque / g lung tissue, similar hereinafter), which was expected and showed good consistency with historical data. When administered at doses of 40, 80, and 120 μg / dose, the test article Apo - Si - K170A - V20 reduced the lung virus titer by 0.563, 1.324, 1.966, and 1.549 Log (as Figure 9 shown), indicating that the anti - RSV efficacy is optimal under the set conditions and there is an obvious dose response. Conclusion, in the mouse model, Apo - Si - K170A is highly effective against RSV infection.

[0503] SARS-CoV-2: The efficacy of Apo-Si-MNMs-dsiRNA (also used as "drug" in this article) administered by intranasal and intratracheal instillation against SARS-CoV-2 virus infection was tested in African green monkeys (AGMs) in two studies. In the first study, AGMs (n = 10) were divided into two groups: Apo-Si-MNMs-dsiRNA (n = 5) vs. vehicle-control (n = 5). On day 0, animals were infected with SARS-related CoV-2, isolate USA-WA1 / 2020 (BEI Resources) by intranasal and intratracheal delivery of the virus (total load 3×10e5). On days -3, -2, and -1 prior to infection, the drug was administered at a continuous dose three times a day as prophylactic treatment. The total dose of the drug was 10 mg; 2.5 mg was delivered to each nostril and 5 mg was delivered intratracheally. The clinical manifestations, body weight, and body temperature of the animals were observed daily.

[0504] The chemical structure of Apo-Si-MNMs-dsiRNA is as follows:

[0505] Sense:

[0506] 5' p-(Apo-Si-K170A)CTAAAGGACCTCACGAATTTTGCTC 3' (SEQ ID NO:10)

[0507] Antisense:

[0508] 5' p-(Apo-si-K170A)GAGCAAAATTCGTGAGGTCCTTTAGTA 3' (SEQ ID NO:11)

[0509] No clinical signs were observed during the administration of the drug. No changes in body weight and body temperature related to the test article were observed. At the scheduled necropsy on day 7, the animals were grossly unremarkable. The ratio of final body weight to lung weight was calculated and showed no difference between the two groups. The viral load was evaluated by qRT-PCR.

[0510] The experimental results are summarized in Figure 10A -B.

[0511] As Figure 10A shown by the viral load, in oropharyngeal tissues on day 2, the results were statistically significant in terms of a viral load reduction of ~2 logs (p = 0.04), reflecting a 98% gene knockdown. In bronchoalveolar lavage (BALF), a reduction in viral load of ~1 log was observed on day 2, reflecting an 86% gene knockdown ( Figure 10B ).

[0512] The second efficacy evaluation of SARS-CoV-2 in AGM included treatment using an intranasal device and nebulization. Animals were infected with SARS-related CoV-2, isolate USA-WA1 / 2020 (BEI Resources) on day 0. The treatment groups received treatment on days 0, 1, 2, and 4. The clinical manifestations, body weight, and body temperature of the animals were observed daily. Similarly, for the first AGM efficacy study, no clinical signs were observed. As Figure 11A shown in -C, the qRT-PCR results indicated that the viral load in oropharyngeal tissues decreased by ~2 logs, and the viral load in BALF and nostrils decreased by ~2 logs, with a strong and persistent inhibitory effect on the viral load, resulting in a decrease in the viral load of ~3 logs.

[0513] Conclusion: In the AGM model, Apo-Si-K170A is highly effective against SARS-CoV-2 infection.

[0514] Example 8

[0515] Asthma evaluation in a mouse model

[0516] The inventors tested the in vivo efficacy of the exemplary conjugate (Apo-Si-K170A-MNM) of the present invention in an OVA-induced mouse asthma model. Asthma is a chronic airway inflammatory disease characterized by airway hyperresponsiveness (AHR), airway inflammation, and remodeling. OVA-induced allergic asthma is a classical model and is commonly used to determine the anti-asthmatic effects of test articles. The purpose of the experiments disclosed below was to evaluate the therapeutic efficacy of Apo-Si-K170A-MNM targeting the STAT6 gene in an OVA-induced mouse asthma model.

[0517] Apo-Si-K170A STAT6 includes the following sequences:

[0518] Sense strand 5'-phosphate (Apo-si-K170A)AGATGCTTTCTGTTACAACATGGCC-3' (SEQ ID NO:12); and

[0519] Antisense strand 5'-phosphate / (Apo-si-K170A)GGCCATGTTGTAACAGAAAGCTCTGA-3' (SEQ ID NO:13)

[0520] Ova mouse model

[0521] Female Balb / C mice were randomly divided into 5 groups according to their body weight. The mouse treatment groups were intraperitoneally (IP) injected with 100 μL of OVA / alum solution (0.30 mg / mL) on days 0, 7, and 14. The sham-treated group was injected with 100 μL of 1×PBS accordingly. On days 27 - 29, the mice were challenged by nebulizing with 1% OVA solution (treatment groups) or PBS (sham-treated control) for 30 min via DSI Buxco Mass.

[0522] On days 26 and 27 (6 hours before the first OVA challenge), the mice were treated by intratracheal injection (IT) with 200 - 250 μg of Apo-Si-K170A STAT6 construct. 5% glucose was administered to the sham-treated and vector control mice.

[0523] On day 29, the mice were euthanized by exsanguination under deep anesthesia (via IP injection of a single dose of Zoletil 50 (50 mg / kg, 10 ml / kg) and Xylazine (5 mg / kg, 2 ml / kg)).

[0524] Cytokine evaluation in BALF

[0525] On day 29, the mice were euthanized, the trachea was surgically exposed, and the right lung was lavaged three times with 0.5 mL of 1×PBS to collect bronchoalveolar lavage fluid (BALF). The collected BALF samples were centrifuged at 1500 rpm for 10 min at 4°C. The supernatant was stored at -80°C for subsequent cytokine detection.

[0526] The levels of cytokines IL-4 and IL-13 in the BALF supernatant were tested by Quantikine ELISA kits (R&D systems M4000B, M1300CB).

[0527] Total IgE determination in plasma

[0528] Blood was collected (on day 29) into EDTA-K2 tubes and immediately centrifuged at 3000 g for 10 min at 4°C. Plasma was collected and snap-frozen in liquid nitrogen. The total IgE level in plasma was quantitatively analyzed by an ELISA kit (Abcam GR3377142-1).

[0529] Surprisingly, the inventors observed a downregulation of Th2 cytokine markers (Il-4&Il-13) in the BALF of the asthma mouse model by the exemplary conjugates of the present invention. As Figure 12A shown, treatment with Apo-Si-K170A STAT6 significantly reduced the IL-4 level, similar to the sham treatment. As Figure 12BAs shown, compared with the sham treatment group, the level of IL-13 in the vector group was significantly increased (p<0.01), and it decreased after treatment with Apo-Si-K170A STAT6 (mean ± SEM, N = 1, n = 6 - 12, **P<0.01, ***P<0.001, t-test).

[0530] For this reason, the Apo-Si-K170A STAT6 construct inhibits IgE levels (see Figure 13 ), and there are significant differences in the production of Th2 cytokine markers compared with control mice.

[0531] Example 9

[0532] In Vivo and In Vitro Experiments on Idiopathic Pulmonary Fibrosis Model

[0533] The inventors aimed to use the exemplary conjugates of the present invention (Apo-Si-Apo-Si-K-170A-SPARC) to treat IPF and other obstructive lung diseases (such as COPD). The present inventors proposed pulmonary administration of the conjugate for direct delivery of the conjugate to the target site, thereby preventing systemic exposure and potentially enhancing the efficacy of the drug.

[0534] Secreted Protein Acidic and CysteineRich (SPARC) is an important mediator of cell-matrix interaction and plays an important role in tissue fibrosis through its high expression level in fibrotic diseases and stimulation of TGF-β signaling. It is a secreted acidic extracellular matrix glycoprotein that plays an important role in promoting the formation of collagen fibers, which are deposited in the extracellular matrix and cause fibrosis. Studies on siRNA-targeted knockdown of this gene in vitro and in vivo have shown its promising potential, which can not only prevent collagen accumulation in lung cells but also alleviate chronic inflammation and fibrosis in a bleomycin (BLM)-induced IPF mouse model.

[0535] Apo-Si-K-170A-SPARC was designed to downregulate the expression of SPARC in the lung, resulting in a significant reduction in the generation of collagen fibers and collagen accumulation in the diseased lung. The inventors hypothesized that Apo-Si-K-170A-SPARC could effectively prevent the progression of alveolar wall thickening, as well as induce a repair process and clearance of fibrotic tissue.

[0536] Apo-Si-K-170A-SPARC consists of dsiRNA, which is conjugated to a selected Apo-Si-K-170A MNM moiety at the 5'-end on each strand, and then annealed to form a duplex with the following general structure:

[0537] Sense strand (5'-phosphate / (Apo-Si-MNM-SPARC)CCACTTGAAACCTTCTACTAATCAA-3' (SEQ ID NO:14)

[0538] Antisense strand (5'-phosphate / (Apo-Si-MNM-SPARC)TTGATTAGTAGAAGGTTTCAAGTGGCA-3' (SEQ ID NO:15).

[0539] In vitro evaluation of various Apo-Si-K-170A constructs

[0540] To select the SPARC gene target sequence, several commercially available sequences (IDT trifecta products) were ordered. The selected sequences were structurally modified and extended according to the publication of M.A. Behlke and the IDT design manual to generate sequences and modifications 25 / 27 base pairs long of dicer substrate small interfering RNA (dsiRNA) (Scott D. Rose and Mark A. Behlke. Chapter 2 Synthetic Dicer-Substrate siRNAs as Triggers of RNA Interference; 2012). Non-related negative control dsiRNA sequences were selected from the literature or non-target related genes. Based on in vitro evaluation of the efficacy of using the Lipofectamine RNAiMax delivery system in several cell lines, the dsiRNA sequence (Apo-Si-K-170A-SPARC) showing the best performance in vitro was selected for further development ( Figure 14 ). Additional test sequences also showed strong SPARC downregulation (not shown).

[0541] To evaluate the ability of the Apo-Si-MNM construct to downregulate the SPARC gene in cell lines, 3T3 / NIH cells were transfected with the Apo-Si-MNM construct. Two days after transfection, the inhibitory effect of Apo-Si-MNM was evaluated by RNA extraction and qPCR analysis. The lead candidate constructs including the most effective dsiRNA sequence (Apo-Si-K-170A-SPARC) demonstrated significant and specific downregulation of the SPARC gene in a dose-dependent manner ( Figure 15 ). In contrast, the negative control sequence (Apo-Si-K170A conjugate targeting the control gene, designated K170A-Dyn1i2) did not affect the SPARC expression level ( Figure 15 ).

[0542] In vivo evaluation of Apo-Si-K-170A-SPARC

[0543] To evaluate the in vivo effects of Apo-Si-K-170A-SPARC, we established a bleomycin-induced IPF model in C57BL mice. In this well-characterized model, bleomycin (BLM) was administered by intranasal application (40 μL / mouse, 0.6 UI / Kg). BLM induced a strong inflammatory response in the lungs that lasted for approximately 10 days, characterized by significant weight loss, elevated white blood cell counts in the lung exudate, and elevated levels of inflammatory cytokines, especially those associated with TGF-β signaling. At the end of this stage, the fibrotic stage of the disease emerged. Body weight usually recovered, but the concentration of soluble collagen in the lung exudate increased, and fibrotic tissue began to form. Various inflammatory genes and collagen-forming genes were significantly upregulated in lung tissue mRNA.

[0544] To evaluate the therapeutic effect of Apo-Si-K-170A-SPARC on the disease, we designed a treatment protocol that started on day 4 after BLM administration. Apo-Si-K-170A-SPARC was administered by intratracheal (IT) injection and compared to sham-treatment with the vehicle as a control.

[0545] In these studies, it was found that Apo-Si-K-170A-SPARC caused a significant knockdown effect on SPARC mRNA expression in diseased mice, which was even lower than the expression of SPARC in naive mice, demonstrating the great potency of the exemplary conjugates of the present invention.

[0546] Example 10

[0547] In vitro experiments on the influenza A virus model

[0548] The inventors aimed to evaluate the in vitro anti-influenza virus inhibitory activity of the exemplary conjugates of the present invention (Apo-Si-K170A-InfA construct) based on the cytopathic effect (CPE) assay of MDCK cells, which targeted the influenza A virus genes PB1 and PB2.

[0549] Materials and methods:

[0550] Using bioinformatics tools, we generated 30 siRNA sequences against the influenza A PB1 and influenza A PB2 genes (15 sequences for each gene). The siRNAs were selected based on the gene sequences of the influenza A / California / 07 / 2009 (H1N1) strain and the influenza A / Perth / 16 / 2009 (H3N2) virus strain. The inhibitory effects of each siRNA were evaluated in a series of assays using 3T3 / NIH transfected with plasmids expressing PB1 or PB2, respectively, against the siRNAs being evaluated and their sources. The leading sequences of each gene were also cross-tested with plasmids from other virus strains. Finally, the top sequences were modified according to the Bhelke modification method and conjugated with the Apo-Si-K170A molecular nanomotor to generate the final 4 Apo-Si-K170A-InfA constructs.

[0551] The Apo-Si-K170A-InfA constructs include:

[0552] 1. The sense strand sequence of K170A-MF03-PB1 5'-phosphate (Apo-Si-K170A)

[0553] GATACTGAATCTTGGACAAAAGAAA-3' (SEQ ID NO:16)

[0554] The antisense strand sequence of 5'-phosphate (Apo-Si-K170A)

[0555] TTTCTTTTGTCCAAGATTCAGTATCGA-3' (SEQ ID NO:17)

[0556] 2. The sense strand sequence of K170A-MF13-PB1 5'-phosphate (Apo-Si-K170A)

[0557] TGAGAAAGATGATGACTAATTCACA-3' (SEQ ID NO:18)

[0558] The antisense strand sequence of 5'-phosphate (Apo-Si-K170A)

[0559] TGTGAATTAGTCATCATCTTTCTCACA-3' (SEQ ID NO:19)

[0560] 3. The sense strand sequence of K170A-MF43-PB2 5'-phosphate (Apo-Si-K170A)

[0561] GCAATAGGGTTGAGGATTAGCTCAT-3' (SEQ ID NO:20)

[0562] Antisense strand sequence 5'-phosphate (Apo-Si-K170A)

[0563] ATGAGCTAATCCTCAACCCTATTGCTG-3'(SEQ ID NO:21)

[0564] 4. K170A-MF45-PB2 sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0565] GGATGATGGCAATGAGATACCCAAT-3'(SEQ ID NO:22)

[0566] Antisense strand sequence 5'-phosphate (Apo-Si-K170A)

[0567] ATTGGGTATCTCATTGCCATCATCCAC-3'(SEQ ID NO:23)

[0568] Additional Apo-Si-K170A-InfA construct with initial indication of biological activity.

[0569] 5. K170A-MF44-PB2 sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0570] GGAACAAGCCGTAGACATATGCAAG-3'(SEQ ID NO:24)

[0571] Antisense strand sequence 5'-phosphate (Apo-Si-K170A)

[0572] CTTGCATATGTCTACGGCTTGTTCCTC-3'(SEQ ID NO:25)

[0573] 6. K170A-MF33-PB2 sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0574] GCAGAAGAGTAGACATAAACCCTGG-3'(SEQ ID NO:26) Antisense strand sequence 5'-phosphate (Apo-Si-K170A)

[0575] CCAGGGTTTATGTCTACTCTTCTGCGT-3'(SEQ ID NO:27)

[0576] 7. K170A-MF31-PB2 sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0577] CACAAGAAGATTGCATGATAAAAGC-3'(SEQ ID NO:28)

[0578] Antisense strand sequence 5'-phosphate (Apo-Si-K170A)

[0579] GCTTTTATCATGCAATCTTCTTGTGAA-3'(SEQ ID NO:29)

[0580] 8. K170A-MF01-PB1 sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0581] GAATCAACAAGGAAGAAAATTGAGA-3'(SEQ ID NO:30)

[0582] Antisense strand sequence 5'-phosphate (Apo-Si-K170A)

[0583] TCTCAATTTTCTTCCTTGTTGATTCAT-3'(SEQ ID NO:31)

[0584] K170A-MF02-PB1 sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0585] GCATTGACCTGAAGTATTTCAATGA-3'(SEQ ID NO:32)

[0586] Antisense strand sequence 5'-phosphate (Apo-Si-K170A)

[0587] TCATTGRAAATACTTCAGGTCAATGCTT-3'(SEQ ID NO:33)

[0588] 10. K170A-MF03-PB1 sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0589] GATACTGAATCTTGGACAAAAGAAA-3'(SEQ ID NO:34)

[0590] Antisense strand sequence 5'-phosphate (Apo-Si-K170A)

[0591] TTTCTTTTGTCCAAGATTCAGTATCGA-3'(SEQ ID NO:35)

[0592] Virus strains and cell lines

[0593] In this assay, we used influenza A / California / 07 / 2009 (H1N1)pdm09 (VR-1894) and influenza A / California / 2 / 2014 (H3N2) (VR-1938) strains that infect MDCK cells (CCL-34). All virus strains and cells were obtained from ATCC. The PB1 and PB2 genes of the influenza A / California / 2 / 2014 (H3N2) (VR-1938) strain were compared with those of influenza A / Perth / 16 / 2009 (H3N2) to ensure that there were no significant mismatches that might impede the compatibility of the siRNA with the strain.

[0594] Assay solution

[0595] OptiPRO serum-free medium supplemented with 2 mM L-glutamine, 1% non-essential amino acids (both from Gibco), and 1% penicillin-streptomycin (HyClone) was used as the assay medium.

[0596] Before the start of the study, the constructs were obtained in lyophilized powder form and resuspended in RNase- and DNase-free molecular water to obtain a stock concentration of 0.3 mM. Dilution of the constructs into the working solution was performed in OptiPRO assay medium (as described above). Each test construct was assayed in triplicate at 8 concentrations in a 2-fold serial dilution starting from 30 μM.

[0597] Antiviral assay

[0598] MDCK cells were seeded in 96-well plates at a density of 15,000 cells / well (96-well plates) in 100 μL of assay medium per well and cultured at 37 °C and 5% CO2 for 5 hours. Test articles prepared according to their respective serial dilutions were added to the cells at a final volume of 150 μl per well. The resulting cell cultures were incubated for an additional 24 hours.

[0599] After 24 h, the supernatant was removed and then the cells were infected with influenza, MOI = 0.012 for the H1N1 strain and MOI = 0.005 for the H3N2 strain. The infection was carried out in assay medium containing trypsin. For the test wells of the test article, assay medium was added. The final volume of the cell culture was 200 μl per well. The final concentration of trypsin was 2.5 μg / mL. The resulting cell cultures were incubated at 35 °C and 5% CO2 for an additional 5 days until significant CPE was shown in the virus control (virus-infected cells, untreated with the compound). Finally, at D7, CPE was measured using CCK8 (Life-iLab) according to the manufacturer's manual. The plates were read 2 h and 3 h after CCK8 treatment. The antiviral activity of the compound was calculated based on the protection against virus-induced CPE at each concentration normalized by the virus control.

[0600] The results of this experiment (presented in Figure 16A -D) showed that the Apo-Si-MNM-dsiRNA construct showed a good dose response between concentrations of 0.3 - 1.6 μM, with an effective concentration 50% (EC 50 of 1.47 μM to 0.5 μM).

[0601] Based on the results of Examples 10 and 7, it is speculated that the conjugates of the present invention can be used to treat viral infections such as respiratory viral infections.

[0602] Although certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes and equivalents will now occur to those of ordinary skill in the art. Accordingly, it is to be understood that the appended claims are intended to cover all such modifications and variations that fall within the true spirit of the invention.

Claims

1. A conjugate having the structure of general formula (I): including its pharmaceutically acceptable salts, hydrates, solvates and metal chelates, wherein: D is a polynucleic acid; Each of y, z and w is an integer independently selected from 0, 1, 2, 3 or 4, provided that at least one of y, z or w is not 0; E, E' or E” may be the same or different and each independently has the structure of general formula (II), including its pharmaceutically acceptable salts, hydrates, solvates and metal chelates, Formula (II): wherein: X is absent or represents its salt, or both; Each of a, b, c, d, e, f, g is an integer independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10; R represents one or more substituents each independently selected from H, F, Cl, Br, I, provided that at least one of the one or more substituents is F; R5 is H or a straight-chain or branched C1-C5 alkyl; R6 is selected from H, hydroxyalkyl, and -(CH2) n R'; wherein n is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and wherein R' is selected from a bond, H, and a phosphate group; L1 is a linking group selected from -NH-C(=O)-, -C(=O)NH-, -C(=O)-S, -S-S- and -S-C(=O); L2 is a linking group selected from -O-, -S-, -CH2-, or is absent; * is the point of attachment of D; Or wherein, E, E' or E” may be the same or different and each independently has the structure of general formula (III), including its pharmaceutically acceptable salts, hydrates, solvates and metal chelates, wherein: Each of h, i, j, k is an integer independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10; R7 is selected from H, hydroxyalkyl, and -(CH2) n R'; where n is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and where R' is selected from a bond, H, and a phosphate group; L3 is a linking group selected from -NH-C(=O)-, -C(=O)NH-, -S-S- and -NH-C(=O); L4 is a linking group selected from -O-, -S-, -CH2-, or is absent; * is the point of attachment of D; 2. The conjugate according to claim 1, wherein, L1 is S-S, and L2 is -O- or -S-.

3. The conjugate according to claim 1 or 2, wherein, E, E' or E” may be the same or different and each independently has the structure of general formula (IIa), including its pharmaceutically acceptable salts, hydrates, solvates and metal chelates: wherein each of R1-R4 is independently selected from H, F, Cl, Br, I, provided that at least one of R1-R4 is F.

4. The conjugate according to claim 3, wherein R1, R2, R4 are H, and R3 is F.

5. The conjugate according to claim 3 or 4, wherein, R1, R3, R4 are H, and R2 is F.

6. The conjugate according to any one of claims 3 to 5, wherein, R2, R3, R4 are H, and R1 is F.

7. The conjugate according to any one of claims 3 to 6, wherein, R1 and R2 are H, and R3 and R4 are F.

8. The conjugate according to any one of claims 3 to 7, wherein, R3 and R4 are H, and R1 and R2 are F.

9. The conjugate according to any one of claims 3 to 8, wherein R1, R2, R3 are F, and R4 is H.

10. The conjugate according to any one of claims 3 to 9, wherein, R1, R2, R4 are F, and R3 is H.

11. The conjugate according to any one of claims 3 to 10, wherein, R1, R3, R4 are F, and R2 is H.

12. The conjugate according to any one of claims 3 to 11, wherein, R2, R3, R4 are F, and R1 is H.

13. The conjugate according to any one of claims 1 to 12, wherein, R5 is Me.

14. The conjugate according to any one of claims 1 to 13, wherein, R6 is -CH2OH, including any of its salts.

15. The conjugate according to any one of claims 1 to 13, wherein, R6 is H or -CH2OH.

16. The conjugate according to any one of claims 1 to 15, wherein, L3 is -S-S-, and L4 is -O-; or wherein, L3 is selected from -S-C(=O), -C(=O)S-, -NH-C(=O) and -C(=O)NH-, and L4 is absent.

17. The conjugate according to any one of claims 1 to 16, wherein, L1 is selected from -S-C(=O), -C(=O)S-, -NH-C(=O) and -C(=O)NH-; and wherein, L2 is -O- or absent.

18. The conjugate according to any one of claims 1 to 17, wherein, R7 is -CH2OH, including any of its salts.

19. The conjugate according to any one of claims 1 to 18, wherein, R7 is H.

20. The conjugate according to any one of claims 1 to 19, wherein, One of y, z and w is 0.

21. The conjugate according to any one of claims 1 to 19, wherein, Both y and z are 0.

22. The conjugate according to any one of claims 1 to 21, wherein, The sum of y, z and w is 2; wherein: (i) each of E, E' or E” is independently represented by formula (II) or formula (IIa), a is 3, and b is 1; or (ii) each of E, E' or E” is independently represented by formula (III), and h is 3.

23. The conjugate according to any one of claims 1 to 21, wherein, The sum of y, z and w is 3; wherein: (i) each of E, E' or E” is independently represented by formula (II) or formula (IIa), a is 3, and b is 1; or (ii) each of E, E' or E” is independently represented by formula (III), and h is 3.

24. The conjugate according to any one of claims 1 to 23, wherein D is an oligonucleotide drug.

25. The conjugate according to any one of claims 1 to 24, wherein, D is a viral vector or a bacterial vector.

26. The conjugate according to any one of claims 1 to 25, wherein, E, E' or E” is selected from: Apo-Si-K-1014, Apo-Si-K-170-A, Apo-Si-K-170-B, Apo-Si-K-170-C, Apo-Si-K-1000, Apo-Si-K-1013, Apo-Si-K-1014 and Apo-Si-K-1007, wherein, W is H or *.

27. A precursor of the conjugate of formula II according to any one of claims 1 to 26, wherein, The precursor is represented by formula (IV): wherein R” is a phosphoramidite, and wherein each of R6' and R7' is independently H, -OX' or –(CH2) n OX', where n is an integer between 1 and 10, and X' is H or a hydroxy protecting group.

28. A precursor of the conjugate of formula III according to any one of claims 1 to 26, wherein, The precursor is represented by formula (V): indicate wherein R” is a phosphoramidite and wherein each of R6' and R7' is independently H, -OX' or -(CH2) n OX', where n is an integer between 1 and 10 and X' is H or a hydroxy protecting group.

29. A pharmaceutical composition comprising one or more conjugates according to any one of claims 1 to 26 and a pharmaceutically acceptable negative carrier.

30. The pharmaceutical composition according to claim 29, comprising a therapeutically effective amount of said one or more conjugates.

31. Use of the pharmaceutical composition according to claim 29 or 30 for the treatment of a disease in a subject in need thereof.

32. The pharmaceutical composition for the use according to claim 31, wherein, The diseases include genetic diseases, viral diseases, cancers, CNS diseases, inflammatory diseases, pulmonary diseases or any combination thereof.

33. The pharmaceutical composition for the use according to claim 32, wherein, The genetic diseases include cystic fibrosis, hereditary hearing loss, IBD and CMT1A.

34. The pharmaceutical composition for the use according to claim 32, wherein, The viral diseases include respiratory viral diseases.

35. The pharmaceutical composition for the use according to claim 34, wherein, The respiratory viral diseases are induced by an infection selected from coronavirus infection, RSV infection, influenza infection or any combination thereof.

36. The pharmaceutical composition for the use according to claim 32, wherein, The pulmonary diseases include asthma and idiopathic pulmonary fibrosis (IPF).

37. A method for delivering a polynucleic acid into the cells of a subject, comprising administering to the subject a conjugate according to any one of claims 1 to 27, or a pharmaceutical composition according to claim 29 or 30.

38. A method for treating or preventing a disease in a subject, the method comprising administering to the subject a therapeutically effective amount of a conjugate according to any one of claims 1 to 26 or a pharmaceutical composition according to claim 29 or 30, thereby treating or preventing the disease.

39. The method according to claim 38, wherein, The administration includes systemic administration, local administration, intravenous administration, surface administration, pulmonary administration or any combination thereof.

40. The method according to claim 38 or 39, wherein, The diseases include genetic diseases, viral diseases, cancers, CNS diseases, inflammatory diseases, pulmonary diseases or any combination thereof.

Images