Royal jelly acid derivative as well as synthesis method, pharmaceutical composition and application thereof

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a royal jelly acid derivative and a synthesis method, a pharmaceutical composition and application thereof. The royal jelly acid derivative is a compound shown as a formula (I), or an enantiomer, a diastereoisomer and a tautomer thereof, or a solvate or a pharmaceutically acceptable salt thereof. A series of royal jelly acid derivatives with novel structures are constructed by using a natural component royal jelly acid derived from royal jelly as an initial raw material, the royal jelly acid derivatives can play a role in resisting pulmonary fibrosis by inhibiting the activity of fibroblasts, the effect of the royal jelly acid derivatives is equivalent to that of pirfenidone, and the royal jelly acid derivatives are expected to be developed into candidate drugs for resisting pulmonary fibrosis. The ceramide NP has excellent effects in anti-inflammatory, anti-allergic and itching-relieving aspects, has a better effect than known ceramide NP, and can be used for preparing health care products, cosmetics and medicines. And # imgabs0 #.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a royal jelly acid derivative, a synthesis method thereof, a pharmaceutical composition and applications thereof. Background Art

[0002] Royal jelly, also known as bee milk, etc., can nourish and beautify the skin, enhance the body's resistance, promote growth, strengthen the physique, and help with sleep. Royal jelly contains more than 90 fatty acids, among which royal jelly acid (also known as queen bee acid, 10-hydroxy-2-decenoic acid) has the highest content. Royal jelly acid has been proven to have various bioactive properties, such as antibacterial, immunomodulatory, wound healing, antioxidant and anti-inflammatory activities.

[0003] For example, Chinese Patent Publication No. CN116790685A discloses a method for preparing royal jelly acid by biosynthesis and its application in skin care. This invention is based on the fermentation of a yeast engineering bacterium using a medium containing trans-2-decenoic acid to produce royal jelly acid. At the same time, through evaluation at the skin cell level and skin model level, the royal jelly acid can promote the synthesis of stratum corneum lipids and ceramides in aging skin, and repair the skin barrier; at the same time, it can promote the synthesis of mitochondrial ATP and NADPH in skin fibroblasts, reduce the content of mitochondrial reactive oxygen species, improve mitochondrial dysfunction, and inhibit apoptosis; further experiments found that royal jelly acid can repair DNA damage in fibroblasts under ultraviolet irradiation and slow down telomere shortening caused by cell division and replication, strengthening the protection of chromosome ends.

[0004] Another Chinese Patent Publication No. CN108245500A discloses the use of royal jelly acid in the preparation of drugs for treating diseases with elevated adenosine deaminase activity. This invention is based on an established screening platform for adenosine deaminase inhibitors, and it is confirmed that royal jelly acid has good adenosine deaminase inhibitory activity and can be used to treat diseases related to elevated adenosine deaminase activity, such as systemic lupus erythematosus, leukemia, typhoid, diabetes, liver diseases, tumors, excitotoxic neurological disorders, neurodegenerative diseases, myocardial ischemia or hypertension.

[0005] Pulmonary fibrosis is a disease characterized by diffuse alveolitis and disordered alveolar structure, which ultimately leads to pulmonary interstitial fibrosis. A variety of lung diseases, including various pathogenic infections, allergic pneumonia, acute respiratory distress syndrome, interstitial pneumonia, chronic obstructive pneumonia, tumors, and drug side effects (such as tumor radiotherapy and chemotherapy, abuse of high-dose glucocorticoids, etc.), can cause varying degrees of pulmonary fibrosis. Traditional Chinese medicines and natural products can treat pulmonary fibrosis through multiple channels and multiple targets, and have the advantages of low toxicity and few side effects, and are a huge resource library for developing anti-fibrotic drugs.

[0006] Currently, there is no report on synthesizing royal jelly acid derivatives with the ability to prevent and / or treat pulmonary fibrosis diseases using royal jelly acid as a raw material. Summary of the Invention

[0007] In view of the problems existing in the prior art, the present invention provides a royal jelly acid derivative, a synthesis method thereof, a pharmaceutical composition and an application thereof.

[0008] To achieve the above object, the technical solution adopted by the present invention is as follows: A royal jelly acid derivative, which has a compound shown in formula (I), or its enantiomer, diastereomer, tautomer, or its solvate or its pharmaceutically acceptable salt,

[0009] In formula (I), R 1 is selected from one of the following groups: , and .

[0010] The present invention also provides a synthesis method of the above-mentioned royal jelly acid derivative, which includes the following steps: (1) First, perform a transesterification reaction on royal jelly acid, triglyceride linoleate, and ionic liquid to obtain an intermediate; (2) Then, perform an acylation reaction on the intermediate and the compound shown in formula (II) to obtain the compound shown in formula (I).

[0011] The synthesis route is as follows:

[0012] In the synthesis route, R 1 is selected from one of the following groups: , and .

[0013] Preferably, the ionic liquid in step (1) is 1-methyl-3-hydroxypropyl imidazolium ionic liquid.

[0014] Preferably, the mass ratio of the triglyceride linoleate to the ionic liquid is 1:0.05 - 0.15.

[0015] Preferably, the molar ratio of the royal jelly acid to the triglyceride linoleate is 1:3 - 4.

[0016] Preferably, the temperature of the transesterification reaction is 70 - 90 °C, and the time of the transesterification reaction is 7 - 9 h.

[0017] Preferably, after the transesterification reaction, water is added, and extraction is performed 1 - 2 times with ethyl acetate, and the organic phase is washed with water, dried, and concentrated.

[0018] Preferably, the acylation reaction in step (2) is carried out in the presence of a condensing agent, an organic base and a solvent.

[0019] More preferably, the acylation reaction includes first reacting the intermediate with a condensing agent, an organic base and a solvent at 10 - 25 °C for 0.5 - 1.5 h, and then adding the compound shown in formula (II) and reacting at 20 - 35 °C for 16 - 20 h.

[0020] Preferably, after the acylation reaction, water is added for quenching, followed by centrifugation, recrystallization from methanol and drying.

[0021] Preferably, the organic base is N - hydroxysuccinimide, N,N - diisopropylethylamine or 4 - dimethylaminopyridine.

[0022] More preferably, the organic base is N - hydroxysuccinimide.

[0023] Preferably, the condensing agent is 1 - ethyl - (3 - dimethylaminopropyl)carbodiimide hydrochloride, N,N,N',N' - tetramethyl - O - (7 - azabenzotriazol - 1 - yl)uronium hexafluorophosphate or N,N' - carbonyldiimidazole.

[0024] More preferably, the condensing agent is 1 - ethyl - (3 - dimethylaminopropyl)carbodiimide hydrochloride.

[0025] Preferably, the solvent is methanol, dichloromethane or tetrahydrofuran.

[0026] More preferably, the solvent is methanol.

[0027] The molar ratio of the intermediate, the condensing agent, the organic base and the compound shown in formula (II) is 1:1.1 - 1.5:1.2 - 2.0:0.9 - 1.

[0028] Preferably, both step (1) and step (2) use TLC to monitor the reaction progress, and the reactions in step (1) and step (2) are carried out under a nitrogen or argon atmosphere.

[0029] The present invention also provides a pharmaceutical composition comprising the compound shown in formula (I) above, or its enantiomer, diastereomer, tautomer, or its solvate or its pharmaceutically acceptable salt, and a pharmaceutically acceptable carrier.

[0030] The present invention also provides the use of the compound shown in formula (I) above, or its enantiomer, diastereomer, tautomer, or its solvate or its pharmaceutically acceptable salt or the above - mentioned pharmaceutical composition in the preparation of a medicament for preventing and / or treating pulmonary fibrosis.

[0031] The present invention also provides an application of the compound shown in the above formula (I), or its enantiomer, diastereomer, tautomer, or its solvate or its pharmaceutically acceptable salt, or the above-mentioned pharmaceutical composition in the preparation of products for anti-inflammatory, anti-allergic and antipruritic, and enhancing the skin immune barrier.

[0032] Preferably, the product is a drug, a cosmetic or a health product.

[0033] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention uses 10-hydroxy-2-decenoic acid, a natural component derived from royal jelly, as a starting material to construct a series of novel-structured 10-hydroxy-2-decenoic acid derivatives. These 10-hydroxy-2-decenoic acid derivatives can play an anti-pulmonary fibrosis role by inhibiting the activity of fibroblasts, and their effects are comparable to those of pirfenidone, and are expected to be developed into candidate drugs for anti-pulmonary fibrosis.

[0034] (2) The 10-hydroxy-2-decenoic acid derivatives provided by the present invention also show excellent effects in anti-inflammatory, anti-allergic and antipruritic aspects, and are better than the known ceramide NP, and can be used to prepare health products, cosmetics and drugs.

[0035] (3) The synthetic route of the 10-hydroxy-2-decenoic acid derivatives provided by the present invention is simple and convenient, avoiding the use of raw materials that are difficult to obtain commercially, and is suitable for large-scale production. Description of the Drawings

[0036] Figure 1 It is the detection result of EdU staining.

[0037] Figure 2 It is the quantitative analysis result of EdU staining.

[0038] Figure 3 It is the influence of 10-hydroxy-2-decenoic acid EOP and 10-hydroxy-2-decenoic acid EOS on the gene expression levels of FN / GAPDH after TGF-β1 induces MRC-5 cells for 48 h.

[0039] Figure 4 It is the influence of 10-hydroxy-2-decenoic acid EOP and 10-hydroxy-2-decenoic acid EOS on the gene expression levels of COL-1 / GAPDH after TGF-β1 induces MRC-5 cells for 48 h.

[0040] Figure 5 It is the influence of 10-hydroxy-2-decenoic acid EOP and 10-hydroxy-2-decenoic acid EOS on the gene expression levels of α-SMA / GAPDH after TGF-β1 induces MRC-5 cells for 48 h.

[0041] Figure 6 It is the influence of 10-hydroxy-2-decenoic acid EOP and 10-hydroxy-2-decenoic acid EOS on α-SMA immunofluorescence after TGF-β1 induces MRC-5 cells for 48 h.

[0042] Figure 7This is the effect of royal jelly acid EOP or royal jelly acid EOS on the FN protein level in MRC-5 cells 48 hours after TGF-β1 induction.

[0043] Figure 8 This is the effect of royal jelly acid EOP or royal jelly acid EOS on the COL-1 protein level in MRC-5 cells 48 hours after TGF-β1 induction.

[0044] Figure 9 This is the effect of royal jelly acid EOP or royal jelly acid EOS on the α-SMA protein level in MRC-5 cells 48 hours after TGF-β1 induction.

[0045] Figure 10 This is the result of picrosirius red staining in the collagen fiber deposition experiment.

[0046] Figure 11 It is the inhibition rate of total collagen accumulation in the collagen fiber deposition experiment.

[0047] Figure 12 The blank control group was obtained by trypan blue staining.

[0048] Figure 13 This is the trypan blue staining result of the model group.

[0049] Figure 14 This is the trypan blue staining result of the ceramide NP group.

[0050] Figure 15 This is the trypan blue staining result of the royal jelly acid EOS group.

[0051] Figure 1 , Figure 6 and Figure 10 In the figure, from left to right, there are blank control group, model group, WJS-EOP low-dose group, WJS-EOP high-dose group, WJS-EOS low-dose group, WJS-EOS high-dose group and positive control group (PFD).

[0052] Figures 2 - 5 , Figures 7 - 9 and Figure 11 Compared with the blank control group, ## indicates P <0.01; * indicates that compared with the model group P <0.05, ** indicates P <0.01; ns indicates no statistically significant difference between the groups.

[0053] Among them, WJS-EOP is royal jelly acid EOP, WJS-EOS is royal jelly acid EOS, and PFD is pirfenidone. DETAILED DESCRIPTION

[0054] It should be noted that the raw materials used in the present invention are all ordinary commercially available products. Among them, human embryonic lung cells (Medical Research Council cell strain-5, MRC-5, #CL-0161) were purchased from Wuhan Punosai Life Science Co., Ltd.; MEM (containing NEAA) complete medium was purchased from Wuhan Punosai Life Science Co., Ltd.; BeyoClick™ EdU-488 kit (#C0071S) was purchased from Beyotime Biotechnology Co., Ltd.; pirfenidone was purchased from Shanghai TargetMol Co., Ltd.; 0.25% trypsin-EDTA was purchased from Gibco; 4% paraformaldehyde was purchased from Wuhan Boster Biological Engineering Co., Ltd.; dimethyl sulfoxide (DMSO, cell grade) was purchased from Sigma; RIPA lysis buffer was purchased from Shanghai Beyotime Biotechnology Co., Ltd.; RS1240 Sirius red staining solution was purchased from G-CLONE; skim milk powder was purchased from BD Biosciences; BCA protein quantification kit was purchased from Thermo Fisher; PVDF membrane (0.22 μm) was purchased from Millipore; DAPI was purchased from Invitrogen; PrimeScript TM RT Master Mix (#RR036A) was purchased from Takara; recombinant human transforming growth factor-beta 1 (TGF-β1) was purchased from Peprotech; Alexa Fluor ® 647 goat anti-mouse IgG (ab150115) was purchased from Abcam; Triton X-100 was purchased from GenStar; Fibronectin antibody (15613-1-AP) was purchased from Proteintech; Tubulin (66031-1-Ig) was purchased from Proteintech; α-SMA antibody (ab7817) was purchased from Abcam; Collagen I antibody (66761-1-Ig) was purchased from Proteintech; HRP-labeled goat anti-rabbit IgG (7074S) was purchased from Cell Signaling Technology; P815 cells were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences; HaCaT cells were purchased from the China Center for Type Culture Collection; macrophage RAW was purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences.

[0055] Methanol is an anhydrous solvent; HOSu refers to N-hydroxysuccinimide; EDCI refers to 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride; [hpmim]OH refers to 1-methyl-3-hydroxypropylimidazolium ionic liquid; EdU refers to 5-ethynyl-2'-deoxyuridine; MNP refers to 3-methyl-4-nitrophenol; PFD refers to pirfenidone.

[0056] Thin layer chromatography (TLC) was performed using 60F254 silica gel plates, and TLC development was carried out using UV light (254 nm) or phosphomolybdic acid. NMR spectra were characterized using a Bruker DPX 400 nuclear magnetic resonance spectrometer. 1 1H NMR was at 400 MHz, the solvent was deuterochloroform or deuteromethanol, and tetramethylsilane (TMS) was used as the internal standard.

[0057] Example 1 The synthesis method of EOG of 10-hydroxy-2-decenoic acid is as follows: (1) Transesterification reaction: Under an argon atmosphere, triglyceride linoleate (110 mmol), 10-hydroxy-2-decenoic acid (300 mmol), and [hpmim]OH (4.4 g, 5 wt%) were added to the reaction vessel, heated to 80 °C, and the transesterification reaction was carried out without solvent. After 8 h, TLC monitoring showed that the 10-hydroxy-2-decenoic acid reaction was complete; 275 mL of deionized water was added, and the mixture was extracted once with ethyl acetate and then washed twice with deionized water. The organic phase was dried and concentrated in vacuo to obtain an intermediate.

[0058] (2) Acylation reaction: Under an argon atmosphere, the intermediate (100 mmol), EDCI (130 mmol), and HOSu (120 mmol) were added to the reaction vessel. After reacting in 225 mL of methanol for 1 h, the compound shown in formula (II) (100 mmol) was added, and the reaction was continued at 25 °C for 18 h. TLC monitoring showed that the reaction was complete. Water was added to quench the reaction and a solid precipitated out. After centrifugation, a crude product was obtained. The crude product was recrystallized with methanol, centrifuged to obtain a wet solid, and then dried to obtain EOG of 10-hydroxy-2-decenoic acid. The total yield was 65% and the purity was 98.5%.

[0059] The synthesis route is as follows:

[0060] Among them, R in formula (II) 1 is: .

[0061] The 1H NMR characterization of the EOG of 10-hydroxy-2-decenoic acid prepared in this example was carried out, and the characterization results are as follows: 1 1H NMR (400 MHz, CDCl3) δ 6.86 (dt, J J = 15.2, 6.9 Hz, 1H), 6.52 (d, J J = 7.9 Hz, 1H), 5.89 – 5.82 (m, 1H), 5.45 – 5.28 (m, 4H), 4.04 (dt, J= 14.1, 4.9 Hz, 3H), 3.79 (d, J = 11.9 Hz, 2H), 2.78 (t, J = 6.4 Hz, 2H), 2.30 (t, J = 7.6 Hz, 2H), 2.27 – 2.14 (m, 2H), 2.06 (q, J = 6.9 Hz, 4H), 1.60 – 1.41 (m, 6H), 1.43 – 1.08 (m, 47H), 0.90 (td, J = 6.8, 4.0 Hz, 6H). Example 2 The synthesis method of royal jelly acid EOP is as follows: Acylation reaction: Under an argon atmosphere, add the intermediate prepared in Example 1 (100 mmol), EDCI (120 mmol) and HOSu (110 mmol) into the reaction vessel. After reacting in 225 mL of methanol for 1 h, add the compound shown in formula (II) (90 mmol), and continue to react at 25 °C for 16 h. Monitor the reaction by TLC until completion, add water to quench the reaction and precipitate a solid. After centrifugation, obtain the crude product. The crude product is recrystallized with methanol, and after centrifugation, obtain the wet solid, which is then dried to obtain royal jelly acid EOP. The total yield is 72% and the purity is 95.5%.

[0062] The synthesis route is as follows:

[0063] Among them, R in formula (II) 1 is: .

[0064] Perform 1H NMR characterization on the royal jelly acid EOP prepared in this example, and the characterization results are as follows: 1 1H NMR (400 MHz, CDCl3) δ 6.84 (dt, J = 14.3, 6.9 Hz, 1H), 6.57 (d, J = 8.0 Hz, 1H), 5.82 (d, J = 15.3 Hz, 1H), 5.35 (dq, J = 12.1, 5.3 Hz, 4H), 4.90 – 4.66 (m, 2H), 4.28 (s, 1H), 4.18 (s, 1H), 4.11 (d,J = 4.4 Hz, 1H), 3.89 (d, J =11.6 Hz, 1H), 3.78 – 3.68 (m, 1H), 3.61 (s, 2H), 2.76 (t, J = 6.4 Hz, 2H), 2.28(t, J = 7.6 Hz, 2H), 2.17 (q, J = 7.2 Hz, 3H), 1.66 – 1.57 (m, 4H), 1.39 – 1.18(m, 48H), 0.91 – 0.83 (m, 6H). Example 3 The synthesis method of royal jelly acid EOS is as follows: Acylation reaction: Under an argon atmosphere, add the intermediate prepared in Example 1 (100 mmol), EDCI (130 mmol) and HOSu (120 mmol) into the reaction vessel. After reacting in 225 mL of methanol for 1 h, add the compound shown in formula (II) (95 mmol), and continue to react at 25 °C for 20 h. Monitor the reaction by TLC until completion. Add water to quench the reaction and precipitate a solid. After centrifugation, a crude product is obtained. The crude product is recrystallized with methanol, and after centrifugation, a wet solid is obtained, which is then dried to obtain royal jelly acid EOS. The total yield is 78% and the purity is 98.2%.

[0065] The synthesis route is as follows:

[0066] Among them, R in formula (II) 1 is: .

[0067] The 1H NMR characterization of the royal jelly acid EOS prepared in this example is as follows: 1 1H NMR (400 MHz, CDCl3) δ 6.95 – 6.77 (m, 1H), 6.33 (d, J = 7.4 Hz, 1H),5.87 – 5.73 (m, 2H), 5.53 (dd, J = 15.4, 6.4 Hz, 1H), 5.43 – 5.27 (m, 4H), 4.35(s, 1H), 4.04 (t, J = 6.8 Hz, 2H), 3.97 (dd, J= 6.3, 2.6 Hz, 2H), 3.72 (d, J =10.1 Hz, 1H), 3.03 (s, 2H), 2.76 (t, J = 6.6 Hz, 2H), 2.28 (t, J = 7.6 Hz, 2H),2.18 (q, J = 6.9 Hz, 2H), 2.05 (t, J = 7.0 Hz, 5H), 1.74 (s, 1H), 1.45 (t, J = 7.1Hz, 3H), 1.36 – 1.28 (m, 20H), 1.25 (s, 22H), 0.88 (td, J = 6.9, 4.0 Hz, 6H). Test Example 1 The in vitro anti-pulmonary fibrosis effect of royal jelly acid derivatives was evaluated by detecting the effects of royal jelly acid EOP (WJS-EOP), royal jelly acid EOS (WJS-EOS) and pirfenidone on the in vitro trans-differentiation of human embryonic lung fibroblasts MRC-5 cells induced by TGF-β1. The specific experiments were as follows: 1. Experimental cells Human embryonic lung cells MRC-5 were cultured in MEM (containing NEAA) complete medium (containing 10% fetal bovine serum, 100 U / mL penicillin and 100 μg / mL streptomycin). Passage was carried out when the cell growth density reached 90%. Passage was carried out once every 2 - 3 days. When the cell density was 90%, cryopreservation and storage of the cells were carried out. When the cell shape was stable after passage to the third generation, part of the cells were cryopreserved for standby and part were used for experiments.

[0068] 2. Grouping and doses of test drugs Grouping: divided into blank control group, model group, positive control group, low-dose WJS-EOP group, high-dose WJS-EOP group, low-dose WJS-EOS group and high-dose WJS-EOS group.

[0069] Doses of the test drugs: In the blank control group, only the solvent (i.e., DMSO with a volume fraction of 0.1%) was added; in the model group, MRC-5 cells were over-proliferated after induction with 5 ng / mL TGF-β1; in the positive control group, pirfenidone (PFD) at 10 μmol / L was administered after induction with 5 ng / mL TGF-β1; in the low-dose WJS-EOP group, WJS-EOP at 5 μmol / L was administered after induction with 5 ng / mL TGF-β1; in the high-dose WJS-EOP group, WJS-EOP at 15 μmol / L was administered after induction with 5 ng / mL TGF-β1; in the low-dose WJS-EOS group, WJS-EOS at 5 μmol / L was administered after induction with 5 ng / mL TGF-β1; in the high-dose WJS-EOS group, WJS-EOS at 15 μmol / L was administered after induction with 5 ng / mL TGF-β1.

[0070] 3. Experimental methods 3.1 Human embryonic lung fibroblast MRC-5 cells were induced to proliferate in vitro with TGF-β1. After intervention with different doses of the test drugs, EdU staining was used for detection.

[0071] The specific experimental procedure is as follows: (1) Cell treatment: MRC-5 cells in the logarithmic growth phase were seeded at 3×10 3 cells / well in a 96-well plate. After 12 h of cell culture, the medium was changed to serum-free medium for synchronization treatment for 12 h, and different doses of the test drugs were added to each well for incubation for 48 h.

[0072] (2) EdU staining: Pre-warmed EdU was added to the original medium to a final concentration of 10 μmol / L, and incubated in an incubator for 2 h; after EdU labeling of the cells was completed, the culture medium was discarded, and 100 μL of 4% paraformaldehyde was added to each well and fixed at room temperature for 15 min; the fixing solution was aspirated, and the cells were washed 3 times with 200 μL of washing solution per well, 5 min each time; the washing solution was aspirated, and 0.3% Triton X-100 was added to each well and incubated at room temperature for 15 min for permeabilization; the permeabilization solution was aspirated, and the cells were washed 2 times with 200 μL of washing solution per well, 5 min each time; 50 μL of Click reaction solution was added to each well, and the culture plate was gently shaken and incubated at room temperature in the dark for 30 min. The Click reaction solution was removed, and the cells were washed 3 times with 200 μL of washing solution per well, 5 min each time; 100 μL of 1×Hoechst33342 (diluted with PBS at a ratio of v:v = 1:1000) was added to each well and incubated at room temperature in the dark for 10 min; the 1×Hoechst 33342 was aspirated, and the cells were washed 3 times with 200 μL of washing solution per well, 5 min each time.

[0073] (3)Imaging: Subsequently, take pictures at 100× magnification with a cell imaging system. Take pictures of the cell nuclei with blue fluorescence and the EdU incorporated into cell proliferation with green fluorescence; use Image J software to calculate the number of cells in the defined area, and the results are quantitatively analyzed as the Edupositive cells ratio% (i.e., the number of green fluorescent cells / the number of blue fluorescent cells).

[0074] 3.2 Induce the proliferation of human embryonic lung fibroblast MRC-5 cells with TGF-β1 in vitro. After intervention with different doses of the test drug, detect the changes in the mRNA levels of FN, COL-1, and α-SMA in human embryonic lung fibroblast MRC-5 cells induced by TGF-β1 after 48 h by RT-qPCR.

[0075] Real-time fluorescence quantitative polymerase chain reaction, and the specific experimental procedure is as follows: (1)Cell treatment: Inoculate MRC-5 cells in the logarithmic growth phase at 2.5×10 5 cells / well into a six-well plate. After culturing the cells for 12 h, change to serum-free medium for synchronization treatment for 12 h, and incubate with different doses of the test drug in each well for 48 h.

[0076] (2)RNA extraction: After drug stimulation, aspirate the culture medium, wash twice with pre-cooled PBS, add 1 mL of RNAisoPlus, pipette and transfer to a 1.5 mL EP tube, and let it stand at room temperature for 5 min; add 200 μL of chloroform to the EP tube, shake vigorously up and down for 15 s, let it stand at room temperature for 10 min, and centrifuge at 12000 rpm for 15 min at 4℃; after centrifugation, the sample is divided into three layers. The upper layer is the colorless aqueous phase layer that dissolves RNA. Carefully aspirate 400 μL of the aqueous phase layer and add it to a new EP tube; add an equal volume of isopropanol to the EP tube, invert and mix 8 - 10 times, let it stand at room temperature for 10 min, and centrifuge at 12000 rpm for 10 min at 4℃, discard the supernatant; add 1 mL of 75% ethanol solution prepared with DEPC water for washing, centrifuge at 8000 rpm for 5 min at 4℃, discard the supernatant, and dry in a fume hood at room temperature for 10 min; add 30 μL of DEPC water to fully dissolve the RNA precipitate. Detect the concentration and purity of RNA, and the OD 230 nm / OD 260 nm range is 1.8 - 2.0; after adjusting the RNA concentration to 500 ng / mL, immediately perform reverse transcription or store it at -80℃.

[0077] (3)Reverse transcription to synthesize cDNA: Operate according to the reaction system in Table 1. The total volume of the system is 10 μL. Place the PCR tube into the PCR instrument, adjust the program to react at 37°C for 15 min, then react at 85°C for 5 s, and maintain at 4°C.

[0078] Table 1 Reverse transcription reaction system

[0079] (4)Primer design and synthesis: The primers were designed, synthesized and verified by Shanghai Sangon Biotech Co., Ltd. The primer sequences are shown in Table 2.

[0080] Table 2 Primer sequences

[0081] (5)RT-qPCR: Prepare the RT-qPCR system according to Table 3, and use a real-time fluorescence quantitative PCR instrument for amplification. After pre-denaturation at 95°C for 30 s, denature at 95°C for 5 s and then anneal to 60°C for 30 s. This step is cycled 40 times, and the reaction is completed at 95°C for 5 s and 60°C for 60 s. Using GAPDH as an internal reference, detect the change in the expression level of the gene relative to the GAPDH gene, and calculate the 2-△△Ct value, that is, the change multiple of the expression level.

[0082] Table 3 RT-qPCR reaction system

[0083] 3.3 Use TGF-β1 to induce the proliferation of human embryonic lung fibroblasts MRC-5 cells in vitro. After intervention with different doses of the test drug, the effect on α-SMA was examined by immunofluorescence.

[0084] The process of the immunofluorescence experiment is as follows: (1)Cell treatment: Seed MRC-5 cells in the logarithmic growth phase at 1×10 4 cells / well in a Confocol dish. After culturing the cells for 12 h, change to serum-free medium for synchronization treatment for 12 h, and add different doses of the test drug to each well for incubation for 48 h.

[0085] (2)Sample treatment: Discard the medium, wash the cells with PBS at room temperature 3 times, 1 mL each time; aspirate the PBS completely, add 1 mL of 4% paraformaldehyde in the dish, and fix the cells at room temperature for 30 min; discard the paraformaldehyde, add 1 mL of PBS and wash 3 times, 5 min each time; aspirate the PBS completely, add 0.5% Triton X-100, and permeabilize the membrane at room temperature for 10 min. Continue to wash with 1 mL of PBS 3 times, 5 min each time; add 500 μL of 10% goat serum and block at room temperature for 1 h.

[0086] (3) Primary antibody incubation: Discard the blocking solution, add 250 μL of primary antibody solution (diluted with 10% goat serum) to the culture dish, and incubate overnight at 4°C in the refrigerator.

[0087] (4) Secondary antibody incubation: Remove the primary antibody, wash 3 times with 1 mL of PBS, 5 minutes each time. After washing, add 250 μL of fluorescent secondary antibody solution (1:100, diluted with 10% goat serum) in the dark, and incubate at room temperature in the dark for 1 h.

[0088] (5) Washing: Continue to wash 3 times with 1 mL of PBS, 5 minutes each time; add DAPI staining solution, incubate at room temperature in the dark for 15 minutes and then remove the staining solution; wash 2 times with 1 mL of PBS, 5 minutes each time.

[0089] (6) Laser confocal microscopy imaging: Use OLYMPUS FV3000 to take pictures and images, select appropriate emission and excitation wavelengths according to the fluorescent secondary antibody, and fix the imaging parameters.

[0090] 3.4 The human embryonic lung fibroblast MRC-5 cells were induced to proliferate in vitro by TGF-β1. After adding different doses of the test drugs for intervention, the changes in the protein levels of FN, COL-1, and α-SMA in the human embryonic lung fibroblast MRC-5 cells induced by TGF-β1 after 48 h were detected.

[0091] The procedure of Western blot (WB) is as follows: (1) Inoculate MRC-5 cells in the logarithmic growth phase at 2.5×10 5 cells / well in a six-well plate. After culturing the cells for 12 h, change to serum-free medium for synchronization treatment for 12 h, and add different doses of the test drugs to each well for co-incubation for 48 h.

[0092] (2) After the cell treatment is completed, discard the culture medium and wash 2 times with pre-cooled PBS. Add an appropriate amount of protein lysate, scrape the cells with a cell scraper and transfer them to a pre-cooled 1.5 mL centrifuge tube, lyse on ice for 30 min, and then centrifuge at 12000 rpm at 4°C for 15 min. The supernatant is the total cell protein.

[0093] (3) Prepare the standard curve according to the operation method of the Pierce ® BCA protein quantification kit and then use it. Add 20 μL of PBS and 5 μL of the protein sample to be tested to a 96-well plate, and add 200 μL of BCA working solution (A:B = 50:1), place it in an incubator, and incubate at 37°C for 30 min; detect the absorbance value at a wavelength of 562 nm with an enzyme-linked immunosorbent assay (ELISA) reader, and substitute it into the formula to quantitatively calculate the protein sample concentration.

[0094] (4) Calculate the volume of 20 μg protein according to the protein concentration, take samples and add them into new EP tubes. At the same time, add 4 μL of 5×SDS-PAGE protein loading buffer (containing β-mercaptoethanol), and make up to 20 μL system with PBS. Vortex the samples to mix evenly, centrifuge briefly, and heat at 100 °C for 5 min to denature the protein for later use.

[0095] (5) Prepare a separating gel with a volume fraction of 10%, and its components are shown in Table 4; prepare a stacking gel with a volume fraction of 5%, and its components are shown in Table 5; prepare 1× electrophoresis buffer, and its components are shown in Table 6; prepare 1× electrotransfer buffer, and its components are shown in Table 7.

[0096] Table 4 Components of the separating gel with a volume fraction of 10%

[0097] Table 5 Components of the stacking gel with a volume fraction of 5%

[0098] Table 6 Components of 1× electrophoresis buffer

[0099] Table 7 Components of 1× electrotransfer buffer

[0100] (6) Load 20 μL of protein sample into each well, add 3 μL of tris-colored prestained protein marker and 3 μL of 5×SDS-PAGE protein loading buffer to the edge lanes respectively. Set the electrophoresis voltage of the stacking gel to 70 V and electrophorese for 40 min; set the electrophoresis voltage of the separating gel to 120 V and electrophorese for 60 min.

[0101] (7) Activate the 0.22 μm PVDF membrane with methanol, cover it on the gel, remove the bubbles in the middle, fix the electrotransfer clamp by the sandwich method, transfer the membrane at 230 mA in an ice bath for 120 min; after transfer, block the PVDF membrane with 5% skim milk (prepared with 1×TBST) at room temperature for 1 h. After blocking, wash with TBST 3 times, 10 min each time; incubate with the primary antibody overnight at 4 °C, wash with TBST 3 times, 10 min each time; select the corresponding secondary antibody according to the source of the primary antibody, incubate at room temperature for 1 h, and wash with TBST 3 times, 10 min each time.

[0102] (8) Mix the ECLA and ECLB solutions in the luminescent solution at a volume ratio of 1:1, develop with a fully automatic chemiluminescent imaging system, and analyze the gray value of the target band using Image J software.

[0103] 3.5 Induce the proliferation of human embryonic lung fibroblasts MRC-5 cells in vitro with TGF-β1. After adding different doses of the test drug for intervention, detect the collagen fiber deposition experiment and the inhibition rate of total collagen accumulation in cells by Sirius red staining.

[0104] The specific experimental procedure of Sirius red staining is as follows: (1) Seed MRC-5 cells in the logarithmic growth phase at a density of 2.5×10 5 cells / well in a six-well plate. After culturing the cells for 12 h, change to serum-free medium for synchronization treatment for 12 h, and add different doses of the test drug to each well for co-incubation for 48 h.

[0105] (2) After the drug intervention is completed, aspirate the medium, add 4% paraformaldehyde to fix at room temperature for 30 min, then aspirate the fixing solution, wash 3 times with PBS, add 1 mL of 0.1% Sirius red staining solution to each well, and incubate in the dark at room temperature for 4 h.

[0106] (3) Discard the staining solution, wash 3 times with 0.1% glacial acetic acid, then add 1 mL of PBS to each well, take a 200× photo with a cell imaging system. After taking the photo, aspirate the PBS and add 1 mL of 0.1 mol / L NaOH to each well, shake at room temperature for 15 min. At this time, the staining solution deposited at the bottom of the plate will dissolve. After mixing evenly, take 100 μL and transfer it to a new 96-well plate, and measure the OD value at 540 nm with an enzyme-linked immunosorbent assay (ELISA) reader.

[0107] Calculate the total collagen accumulation deposition rate according to the following formula: Total collagen accumulation deposition rate of cells % = (OD value of the experimental group - OD value of the blank control group) ÷ (OD value of the model group - OD value of the blank control group) × 100%.

[0108] 4. Data processing and statistical analysis Use GraphPad Prism 8.0 software for data analysis and graphing, and the statistical results are expressed as Mean±SEM. According to the data type, use the corresponding analysis method. For the measurement data of two independent samples, when the variances are homogeneous, use the unpaired t-test; when the variances are inhomogeneous, use the unpaired t-test with Welch correction. When comparing multiple measurement samples, when the variances are homogeneous, use one-way analysis of variance; * P <0.05 indicates that there is a statistically significant difference between groups, ** P <0.01 indicates a significant difference between groups; ns indicates that there is no statistically significant difference between groups.

[0109] 5. Experimental results 5.1 Effects of 10-hydroxy-2-decenoic acid EOP and 10-hydroxy-2-decenoic acid EOS on the proliferation of TGF-β1-induced MRC-5 cells The results of EdU staining are asFigure 1 As shown Figure 1 In it, the cell nucleus was photographed with blue fluorescence, and EdU incorporated into cell proliferation was photographed with green fluorescence. The final result was quantitatively analyzed by the percentage of EdU-positive cells (i.e., the number of green fluorescent cells / the number of blue fluorescent cells), and one-way ANOVA was used for the test ( Figure 2 ). Through EdU staining, it was found that compared with the blank control group, MRC-5 cells in the model group proliferated excessively after TGF-β1 induction ( P <0.01). Compared with the model group, each drug-administered group could inhibit cell proliferation ( P <0.01). Among them, the inhibitory effect of the high-dose group of WJS-EOP (15 μmol / L) or the high-dose group of WJS-EOS (15 μmol / L) was the strongest, which was equivalent to that of the positive control group PFD (10 μmol / L), indicating that EOP and EOS of royal jelly acid could inhibit the proliferation of MRC-5 cells.

[0110] 5.2 Effects of EOP and EOS of royal jelly acid on the mRNA levels of FN, COL-1, and α-SMA in TGF-β1-induced MRC-5 cells As Figures 3 - 5 shown, compared with the blank control group, the model group could induce fibroblasts to transdifferentiate into myofibroblasts under TGF-β1 stimulation. The qPCR results showed that the expressions of FN, COL-1, and α-SMA mRNA were significantly increased after TGF-β1 induction ( P <0.01). Each drug-administered group could inhibit the increase in the mRNA levels of FN, COL-1, and α-SMA ( P <0.01). Among them, the inhibitory effect of the high-dose group of WJS-EOP (15 μmol / L) or the high-dose group of WJS-EOS (15 μmol / L) was the strongest, which was equivalent to that of the positive control group PFD (10 μmol / L), indicating that EOP or EOS of royal jelly acid could inhibit the increase in the mRNA levels of FN, COL-1, and α-SMA in MRC-5 cells.

[0111] 5.3 Effects of EOP or EOS of royal jelly acid on the expression of α-SMA in TGF-β1-induced MRC-5 cells As Figure 6As shown (blue represents the cell nucleus and red represents α-SMA expression), compared with the blank control group, the immunofluorescence results of the model group showed that the expression of α-SMA was significantly increased after TGF-β1 induction. Each administration group could inhibit the increase in α-SMA level, and the inhibitory effect was the strongest in the high-dose group of WJS-EOP (15 μmol / L) or the high-dose group of WJS-EOS (15 μmol / L), which was equivalent to that of the positive control group PFD (10 μmol / L), indicating that EOP or EOS of royal jelly acid could inhibit the increase in the expression level of α-SMA in MRC-5 cells.

[0112] 5.4 Effects of EOP or EOS of royal jelly acid on the protein levels of FN, COL-1 and α-SMA in TGF-β1-induced MRC-5 cells As Figures 7 - 9 shown, compared with the blank control group, the model group could induce the transdifferentiation of fibroblasts into myofibroblasts under the stimulation of TGF-β1, and the WB results showed that the protein expressions of FN, COL-1 and α-SMA were significantly increased after TGF-β1 induction ( P <0.01). Each administration group could inhibit the increase in the protein levels of FN, COL-1 and α-SMA ( P <0.01 or P <0.05), and the inhibitory effect was the strongest in the high-dose group of WJS-EOP (15 μmol / L) or the high-dose group of WJS-EOS (15 μmol / L), which was equivalent to that of the positive control group PFD (10 μmol / L). The results showed that EOP or EOS of royal jelly acid could inhibit the increase in the protein levels of FN, COL-1 and α-SMA in MRC-5 cells.

[0113] 5.5 Effects of EOP or EOS of royal jelly acid on the collagen fiber deposition in TGF-β1-induced MRC-5 cells Compared with the blank control group, the model group could induce the collagen fiber deposition of fibroblasts under the stimulation of TGF-β1, and the Sirius red staining results showed that the collagen fiber deposition was significantly increased after TGF-β1 induction ( Figure 10 ). As Figure 11 shown, each administration group could inhibit the collagen fiber deposition ( P <0.01 or P <0.05), and the inhibitory effect was the strongest in the high-dose group of WJS-EOP (15 μmol / L) or the high-dose group of WJS-EOS (15 μmol / L), which was equivalent to that of the positive control group PFD (10 μmol / L). The results showed that EOP or EOS of royal jelly acid could inhibit the collagen fiber deposition in TGF-β1-induced MRC-5 cells.

[0114] In summary, the royal jelly acid derivative can play an anti-pulmonary fibrosis role by inhibiting the activity of fibroblasts, and its effect is comparable to that of pirfenidone. The royal jelly acid derivative is expected to be developed into a candidate drug for anti-pulmonary fibrosis.

[0115] Test Example 2 Test for the anti-allergic and antipruritic effects of the royal jelly acid derivative. The specific experiment is as follows: 1. Cell treatment Seed P815 cells in a 6-well plate and incubate them in a cell culture incubator at 37 °C and 5% CO2 for 24 h, then discard the culture medium.

[0116] 2. Grouping and test drugs It is divided into a blank control group, a model group, a royal jelly acid EOS group, and a ceramide NP group. The blank control group is DMEM medium without sample solution; the model group is DMEM medium containing 10 μg / mL MNP; the royal jelly acid EOS group and the ceramide NP group are sample solutions diluted to a concentration of 15.625 mg / mL with DMEM medium containing 10 μg / mL MNP.

[0117] 3. Experimental method Add 1 mL of solution to each well in the blank control group, model group, royal jelly acid EOS group, and ceramide NP group. Incubate them in a cell culture incubator at 37 °C and 5% CO2 for 24 h, then discard the culture medium. Wash 3 times with 1 mL of PBS per well, stain with trypan blue, and observe the staining results under a microscope. The more stained cells, the more severe the cell degranulation.

[0118] 4. Experimental results The results are as Figures 12 - 15 shown. After MNP modeling, the trypan blue staining increased, the cell degranulation was obvious, and histamine was released, indicating successful modeling; after adding royal jelly acid EOS or ceramide NP, the trypan blue staining decreased, the cell degranulation was alleviated, and the histamine release was controlled, proving that royal jelly acid EOG or ceramide NP has anti-allergic and antipruritic effects to varying degrees, and the effect of royal jelly acid EOS is better than that of ceramide NP.

[0119] Test Example 3 Human β-defensin 2 is the first discovered inducible defensin, mainly derived from skin keratinocytes and mucosal epithelial cells, and plays an important role in the innate immune function of the skin and mucosa. It has strong killing activity against microorganisms such as bacteria, fungi, and viruses. Therefore, the test for the effect of enhancing the skin immune barrier of the royal jelly acid derivative is carried out. The specific experiment is as follows: 1. Experimental method Seed HaCaT cells at 1×10 6The cells were seeded at a density in 6-well plates and incubated overnight in a 37 °C, 5% CO₂ incubator. After 24 h, the culture medium was discarded, and 1 mL of solutions of ceramide NP, EOG, EOP, and EOS at different concentrations (3.90625 mg / L, 7.8125 mg / L, and 15.625 mg / L) were added respectively. The blank control group was DMEM medium without drugs, the positive control group was 30 μM quercetin, and the model group was 10 μg / mL LPS. There were 3 replicate wells in each group.

[0120] After pre-protecting with the drugs for 1 h, LPS was added to a final concentration of 10 μg / mL. After 24 h of drug administration, total RNA was extracted, reverse transcribed into cDNA, and quantified using a fluorescence quantitative PCR instrument.

[0121] The primer sequences are as follows: hBD-2—F (SEQ ID NO.9): CCAGCCATCAGCCATGACGGT; hBD-2—R (SEQ ID NO.10): GGAGCCCTTTCTGAATCCGCA.

[0122] 2. Experimental results After detection, the expression of human β-defensin 2 in the blank control group was 5.37%; the expression of human β-defensin 2 in the model group was 98.63%; the expression of human β-defensin 2 in the positive control group was 300.0%; when the concentrations were 3.90625 mg / L, 7.8125 mg / L, and 15.625 mg / L, the expression levels of human β-defensin 2 of ceramide NP were 136.5%, 202.5%, and 126.2% respectively; the expression levels of human β-defensin 2 of EOG were 198.0%, 205.2%, and 236.4% respectively; the expression levels of human β-defensin 2 of EOP were 196.6%, 208.5%, and 235.0% respectively; the expression levels of human β-defensin 2 of EOS were 194.8%, 207.4%, and 237.7% respectively.

[0123] It can be seen that compared with ceramide NP, the EOG derivatives showed excellent effects in enhancing the expression of human β-defensin 2, indicating that the EOG derivatives can effectively regulate the skin immune process, defend against the colonization of pathogenic microorganisms by regulating the immune system and assisting in stimulating the body's immune response, and maintaining the stability of the skin microecological balance.

[0124] Test Example 4 The anti-inflammatory effect of the EOG derivatives was tested. The specific experiment is as follows: 1. Experimental method Macrophages RAW were seeded at a density of 1×10 4Seed one cell / hole in a 96-well plate, place it in an incubator to adhere overnight. After 24 h, discard the supernatant, and add 100 μL of 10-HDA EOG, 10-HDA EOP, 10-HDA EOS, and ceramide NP diluted with DMEM medium at different concentrations (7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L). The negative control group is DMEM medium without samples, the positive control group is 30 μM quercetin, and the model group is 10 μg / mL LPS. Each group has 3 replicate wells.

[0125] Incubate in an environment of 5 wt% CO2 and 37 °C. After 2 h of drug administration, add 10 μg / mL LPS and co-incubate until 24 h. After the reaction ends, take 50 μL of cell supernatant and test the relative expression level of IL-1β mRNA by RT-PCR.

[0126] 2. Experimental results After detection, the IL-1β expression level in the negative control group is 49.02; the IL-1β expression level in the model group is 100.5; the IL-1β expression level in the positive control group is 72.13; when the concentrations are 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the IL-1β expression levels of ceramide NP are 99.49, 89.96, and 68.10 respectively; the IL-1β expression levels of 10-HDA EOG are 81.27, 78.32, and 65.84 respectively; the IL-1β expression levels of 10-HDA EOP are 84.11, 77.49, and 64.63 respectively; the IL-1β expression levels of 10-HDA EOS are 83.52, 78.74, and 64.95 respectively.

[0127] The above results show that ceramide NP and 10-HDA derivatives can reduce the expression of IL-1β in cells, have an anti-inflammatory effect, and this effect is dose-dependent; at medium and low concentrations, the anti-inflammatory effect of 10-HDA derivatives is significantly better than that of ceramide NP.

[0128] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than limiting the protection scope of the present invention. Any simple modification or equivalent replacement of the technical solution of the present invention by those of ordinary skill in the art does not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A royal jelly acid derivative, characterized in that, A compound represented by formula (I), or its enantiomer, diastereomer, tautomer, or its solvate or its pharmaceutically acceptable salt, In formula (I), R 1 is selected from one of the following groups: , and .

2. A method for synthesizing the royal jelly acid derivative as described in claim 1, characterized in that, comprising the following steps: (1) First, perform a transesterification reaction on royal jelly acid, triglyceride linoleate, and an ionic liquid to obtain an intermediate; (2) Then, perform an acylation reaction on the intermediate and the compound represented by formula (II) to obtain the compound represented by formula (I), The synthesis route is as follows: Among them, R 1 As described in claim 1.

3. The synthesis method according to claim 2, wherein The ionic liquid described in step (1) is 1-methyl-3-hydroxypropylimidazolium ionic liquid, the molar ratio of royal jelly acid to triglyceride linoleate is 1:3 - 4, and the mass ratio of triglyceride linoleate to ionic liquid is 1:0.05 - 0.

15.

4. The synthesis method according to claim 3, characterized in that, The temperature of the transesterification reaction is 70 - 90 °C, the time of the transesterification reaction is 7 - 9 h. After the transesterification reaction, water needs to be added, and it is extracted with ethyl acetate 1 - 2 times, and the organic phase is washed with water, dried, and concentrated.

5. The synthesis method according to claim 2, characterized in that, The acylation reaction described in step (2) is carried out in an environment of a condensing agent, an organic base, and a solvent. The acylation reaction includes first reacting the intermediate with the condensing agent, the organic base, and the solvent at 10 - 25 °C for 0.5 - 1.5 h, then adding the compound represented by formula (II), and reacting at 20 - 35 °C for 16 - 20 h. After the acylation reaction, water needs to be added for quenching, centrifuged, recrystallized with methanol, and dried.

6. The synthesis method according to claim 5, wherein, The organic base is N-hydroxysuccinimide, N,N-diisopropylethylamine, or 4-dimethylaminopyridine. The condensing agent is 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride, N,N,N',N'-tetramethyl-O-(7-azabenzotriazol-1-yl)uronium hexafluorophosphate, or N,N'-carbonyldiimidazole. The solvent is methanol, dichloromethane, or tetrahydrofuran. The molar ratio of the intermediate, the condensing agent, the organic base, and the compound represented by formula (II) is 1:1.1 - 1.5:1.2 - 2.0:0.9 - 1.

7. The synthesis method according to any one of claims 2-6, characterized in that, The reaction progress of both step (1) and step (2) is monitored by TLC. The reactions described in step (1) and step (2) are both carried out under a nitrogen or argon atmosphere.

8. A pharmaceutical composition, characterized in that, comprising the compound represented by formula (I) described in claim 1, or its enantiomer, diastereomer, tautomer, or its solvate or its pharmaceutically acceptable salt, and a pharmaceutically acceptable carrier.

9. Use of a compound represented by formula (I) described in claim 1, or its enantiomer, diastereomer, tautomer, or its solvate or its pharmaceutically acceptable salt, or the pharmaceutical composition described in claim 8 in the preparation of a medicament for preventing and / or treating pulmonary fibrosis.

10. Use of a compound represented by formula (I) as described in claim 1, or its enantiomer, diastereomer, tautomer, or its solvate or its pharmaceutically acceptable salt or the pharmaceutical composition described in claim 8 in the preparation of a product for anti - inflammation, anti - allergy and antipruritic and enhancing skin immune barrier, characterized in that The product is a medicament, a cosmetic, or a health product.

Images