Stress-relieving composition containing camellia extract and application of stress-relieving composition

Abstract

The invention relates to the technical field of skin care products, in particular to a stress relieving composition containing camellia flower extract and application of the stress relieving composition. The composition comprises the following components: a camellia extract, a porphyridium extract, an anise leaf extract and a vetiver extract, and the four components cooperate to regulate and control, completely intervene in a neuroinflammation path, block transmission of nerve stimulation signals, reduce release of neuropeptides and inflammatory factors, repair damaged nerve barriers and improve neurological function. The effect of comprehensively relieving the skin sensitivity reaction is achieved. The composition not only has a faster and more durable effect, but also has good safety and applicability, and is especially suitable for protecting and conditioning high-sensitivity skin and skin in an extreme environment.

Description

Technical Field

[0001] The present invention relates to the technical field of skin care products, and particularly relates to a stress-relieving composition containing camellia extract and its application. Background Art

[0002] In recent years, more and more people are troubled by sensitive skin. Sensitive skin is a skin condition that shows intolerance to changes in the external environment and the skin care products used. There are three mechanisms for the formation of sensitive skin: impaired skin barrier function, inflammatory state in the epidermis, and abnormal skin sensory nervous system. They often interact with each other to form a vicious cycle of sensitive skin. Sensitive skin is accompanied by subjective feelings such as skin tightness, tingling, short-term burning sensation, persistent itching sensation, etc., or objective phenomena such as capillary dilation, flushing, erythema, desquamation and dryness.

[0003] Currently, in the beauty and skin care industry, in response to skin sensitivity, inflammation and neurological discomfort, a variety of products and methods have been developed, mainly including anti-inflammatory repair creams, soothing sprays and antihistamine ointments, etc. These products can relieve some symptoms to a certain extent, but often have limited effect on improving the nerve conduction speed and cannot achieve rapid and lasting relief. Due to the highly complex signal conduction of skin sensory neurons and the bioelectric regulation mechanism, traditional products usually improve the blood vessel response by inhibiting the inflammatory response or sedating the nerve endings, and the effect is usually relatively slow and cannot meet the demand for rapid relief of acute stimuli. Especially in the case of intense stress response or severely sensitive skin condition, the existing methods have a long reaction time and cannot achieve instantaneous soothing, resulting in poor user experience. Moreover, products with a single mechanism of action are easily affected by individual differences and have unstable effects, which limits their wide application effect and popularity.

[0004] These challenges reflect that the industry urgently needs a new type of solution with multiple targets and multi-mechanism synergistic effects to achieve rapid inhibition of nerve conduction and immediate relief of skin sensitivity symptoms, so as to meet the urgent market demand for high-efficiency, safe and fast-response products. Summary of the Invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a stress-relieving composition containing camellia extract and its application. The raw material components in the composition cooperate with each other, and the prepared composition has the synergistic effect of multiple targets and multi-mechanisms, can achieve rapid inhibition of nerve conduction and immediate relief of skin sensitivity symptoms, and meet the urgent market demand for high-efficiency, safe and fast-response products.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a stress-relieving composition containing camellia extract, comprising the following components: camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract, and the weight ratio of the camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract is (0.1 - 5):(0.01 - 5):(0.1 - 3):(0.01 - 1).

[0008] The camellia extract is derived from plants of the Theaceae family and is rich in active ingredients such as flavonoid glycosides and kaempferol. By inhibiting the over-activation of TRPV1 receptors in skin sensory nerve endings, it reduces the release of neuropeptides such as substance P and calcitonin gene-related peptide CGRP caused by calcium ion influx, thereby rapidly relieving the burning sensation and pain signal conduction caused by external stimuli. It synergistically blocks the expression of histamine receptor H1R and reduces the neurogenic redness reaction.

[0009] The porphyra extract contains unique phycocyanin and sulfated polysaccharides. Its core mechanism is to regulate the expression of intercellular adhesion molecule (ICAM-1) in skin vascular endothelial cells, inhibit the degranulation of mast cells to release histamine and TNF-α, and block the vasodilation pathway in neurogenic inflammation. By balancing the activity of nitric oxide synthase, it effectively reduces the persistent erythema and temperature-sensitive reactions induced by stimuli.

[0010] The main active ingredients of the illicium lanceolatum leaf extract are anisatin derivatives and terpenoid compounds. Aiming at the over-excited state of skin neurons, it selectively inhibits the phosphorylation activation of sodium channel Nav1.7 and blocks the transmission of abnormal action potentials to the central nervous system. At the same time, by activating the κ-opioid receptor (KOR) pathway, it reduces the sensitivity of itch-conducting nerve fibers and inhibits the generation of itching sensation from the source.

[0011] The vetiver extract is characterized by sesquiterpenoids such as vetiverol and camphene. It enhances the inhibitory effect of GABA receptors in skin sensory neurons, blunts the itch signal transmission mediated by C fibers. It regulates the activation of transient receptor potential M8 (TRPM8) channels, produces a cooling and calming effect, neutralizes heat hyperalgesia reactions and repairs damaged nerve barriers.

[0012] Preferably, the weight ratio of the camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract is (0.5 - 3):(0.05 - 2):(0.5 - 1):(0.05 - 0.5).

[0013] More preferably, the weight ratio of the camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract is (0.5 - 1):(0.05 - 0.5):(0.6 - 0.8):(0.1 - 0.3).

[0014] Second aspect, the present invention provides an application of the stress-relieving composition containing camellia extract described in the first aspect in the preparation of skin care products.

[0015] Preferably, the skin care product is any one of lotion, emulsion, cream, mask, essence or spray, and the addition amount of the composition is 0.5%-5% of the total weight of the skin care product.

[0016] Third aspect, the present invention provides an essence, comprising raw materials in the following weight percentages: 0.5%-5% of the composition described in the first aspect, 0.05%-0.3% of a thickener, 0.5%-10% of a humectant, 0.5%-5% of a preservative, and 0.01%-0.3% of a pH regulator, with the balance being deionized water.

[0017] Preferably, the thickener comprises at least one of xanthan gum, carbomer, acryloyldimethyltaurate / VP copolymer, ammonium acryloyldimethyltaurate / VP copolymer, sclerotium gum and cetyl alcohol.

[0018] Preferably, the humectant comprises at least one of allantoin, betaine, β-glucan, trehalose, caprylyl glycol, dipropylene glycol, sodium hyaluronate, 1,3-butanediol, glycerol, pullulan and ceramide.

[0019] Preferably, the pH regulator comprises at least one of arginine, tromethamine and disodium EDTA.

[0020] Preferably, the preservative comprises at least one of 1,2-propanediol, 1,2-hexanediol and p-hydroxyacetophenone. More preferably, the preservative is 1,2-hexanediol and p-hydroxyacetophenone.

[0021] Fourth aspect, the present invention provides a preparation method of the essence in the third aspect, comprising the following steps:

[0022] S1. Mix the humectant, thickener and 50% of the deionized water, homogenize and mix evenly to obtain an aqueous solution;

[0023] S2. When the temperature of the aqueous solution in S1 drops to 55-65°C, add the preservative. When the system temperature drops to 40-45°C, further add the components of the composition described in the first aspect, essence and the remaining deionized water to the system, stir evenly, and finally add the pH regulator to adjust the pH to obtain the essence.

[0024] Preferably, the homogenization temperature in step S1 is 75-85°C.

[0025] Preferably, the pH in step S2 is adjusted to 5.5-6.5.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention provides a multi-component synergistic stress-relieving composition, which effectively combines camellia extract, Porphyridium cruentum extract, pseudo-star anise leaf extract and vetiver extract, and utilizes their respective active mechanisms to work together to significantly improve the redness, heat, itching, pain and other discomforts caused by neurogenic inflammation. The four are synergistically regulated to completely intervene in the neuroinflammatory pathway, block the transmission of nerve stimulation signals, reduce the release of neuropeptides and inflammatory factors, repair damaged nerve barriers, and achieve the effect of comprehensively alleviating skin sensitivity reactions. The combination makes full use of the ability of each component to inhibit nerve perception pathways, regulate vascular responses, and reduce inflammatory factors, realizes multi-mechanism synchronous anti-sensitivity, and solves problems that are difficult to deal with with existing methods from the root. Specifically, by inhibiting the excessive activation of nerve receptors TRPV1, PAR-2, etc., the cascade reaction of neuroinflammatory disease is blocked, thereby quickly relieving the burning sensation and pain caused by stimulation while enhancing the self-repair ability of the skin. Its advantage lies in the realization of multi-point and multi-mechanism combined effects, which is significantly superior to the existing single therapies or simple-ratio products on the market. It not only has faster and longer-lasting effects, but also has good safety and applicability. It is especially suitable for the protection and conditioning of highly sensitive skin and skin in extreme environments. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The following is a comparison chart of the essence in Application Example 1 and Comparative Application Example 8 (blank control group) before use (0 day) and after use (14 days). DETAILED DESCRIPTION

[0029] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0030] The sources of raw materials used in the following examples and comparative examples are as follows:

[0031] Camellia extract: Clariant-Personal Care, trade name

[0032] Porphyridium cruentum extract: The manufacturer is BSF Company, the trade name is

[0033] Illicium verum leaf extract: manufactured by Lucas Meyer, trade name Tazman Pepper TM AF;

[0034] Vetivyne extract: manufactured by Givaudan, trade name Vetivyne TM .

[0035] Other materials, reagents, etc. used in the examples can be obtained from commercial sources without special instructions.

[0036] Example 1

[0037] A stress-relieving composition containing camellia extract, comprising camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract in a weight ratio of 0.7:0.3:0.7:0.2, and the total weight of the camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract is 100 parts.

[0038] Example 2

[0039] A stress-relieving composition containing camellia extract, comprising camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract in a weight ratio of 0.5:0.05:0.8:0.3, and the total weight of the camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract is 100 parts.

[0040] Example 3

[0041] A stress-relieving composition containing camellia extract, comprising camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract in a weight ratio of 1:0.5:0.6:0.1, and the total weight of the camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract is 100 parts.

[0042] Example 4

[0043] A stress-relieving composition containing camellia extract, comprising camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract in a weight ratio of 0.5:0.05:1:0.5, and the total weight of the camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract is 100 parts.

[0044] Example 5

[0045] A stress-relieving composition containing camellia extract, comprising camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract in a weight ratio of 3:2:0.5:0.05, and the total weight of the camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract is 100 parts.

[0046] Comparative Example 1

[0047] The difference between Comparative Example 1 and Example 1 is that in Comparative Example 1, camellia extract and illicium lanceolatum leaf extract are not added, and the missing amount is supplemented with porphyra extract and vetiver extract in a weight ratio of 0.3:0.2.

[0048] Comparative Example 2

[0049] The difference between Comparative Example 2 and Example 1 is that: in Comparative Example 2, no Porphyridium cruentum extract is added, and the missing amount is supplemented with camellia extract, Illicium lanceolatum A. C. Smith leaf extract and vetiver extract in a weight ratio of 0.7:0.7:0.2.

[0050] Comparative Example 3

[0051] The difference between Comparative Example 3 and Example 1 is that: in Comparative Example 3, no vetiver extract is added, and the missing amount is supplemented with camellia extract, Porphyridium cruentum extract and Illicium lanceolatum A. C. Smith leaf extract in a weight ratio of 0.7:0.3:0.7.

[0052] Comparative Example 4

[0053] The difference between Comparative Example 4 and Example 1 is that: in Comparative Example 4, camellia extract, Porphyridium cruentum extract, Illicium lanceolatum A. C. Smith leaf extract and vetiver extract in a weight ratio of 0.7:0.3:0.07:0.2 are used, and the total weight of the camellia extract, Porphyridium cruentum extract, Illicium lanceolatum A. C. Smith leaf extract and vetiver extract is 100 parts.

[0054] Comparative Example 5

[0055] The difference between Comparative Example 5 and Example 1 is that: in Comparative Example 5, camellia extract, Porphyridium cruentum extract, Illicium lanceolatum A. C. Smith leaf extract and vetiver extract in a weight ratio of 0.7:0.3:0.7:5 are used, and the total weight of the camellia extract, Porphyridium cruentum extract, Illicium lanceolatum A. C. Smith leaf extract and vetiver extract is 100 parts.

[0056] Comparative Example 6

[0057] The difference between Comparative Example 6 and Example 1 is that: in Comparative Example 6, camellia extract, Porphyridium cruentum extract, Illicium lanceolatum A. C. Smith leaf extract and vetiver extract in a weight ratio of 7:0.3:0.7:0.2 are used, and the total weight of the camellia extract, Porphyridium cruentum extract, Illicium lanceolatum A. C. Smith leaf extract and vetiver extract is 100 parts.

[0058] Comparative Example 7

[0059] The difference between Comparative Example 7 and Example 1 is that: in Comparative Example 7, camellia extract, Porphyridium cruentum extract, Illicium lanceolatum A. C. Smith leaf extract and vetiver extract in a weight ratio of 0.7:0.3:7:0.2 are used, and the total weight of the camellia extract, Porphyridium cruentum extract, Illicium lanceolatum A. C. Smith leaf extract and vetiver extract is 100 parts.

[0060] Test Example 1: Inhibitory effect of the composition on the nerve sensory pathway

[0061] In this experiment, a histamine-induced neurogenic inflammation model of keratinocytes was established to accurately simulate the skin stress state of "redness, heat, itching, and pain". Under histamine stimulation, the gene expression of the heat-sensing channel TRPV1 receptor and the itching channel PAR-2 (F2RL1 receptor) in HaCaT cells will be significantly up-regulated, directly triggering the release of neuropeptides and vasodilation signals. Therefore, the strength of the composition's inhibitory effect on the nerve sensory pathway can indicate the strength of the composition's ability to relieve stress.

[0062] Samples: The stress-relieving compositions prepared in Examples 1-5 and Comparative Examples 1-7;

[0063] Test cells: The cell line used was human keratinocyte HaCaT (Shanghai Yaji Biotechnology Co., Ltd.), and the cryopreservation passage was the 9th passage;

[0064] Test conditions: Incubator temperature 37 ± 1 °C, humidity 90 ± 5%, carbon dioxide 5 ± 1%;

[0065] Cell culture and treatment were carried out according to the grouping, and then the test was carried out. The test method is as follows:

[0066] (1) Sample preparation: The sample was completely dissolved in DMSO, and then diluted with DMEM culture medium into a sample solution, where the mass percentage of the sample in the sample solution was 1 wt%;

[0067] (2) The cell suspension was inoculated into a 96-well cell culture plate at a density of 2000 cells / well, and 100 μL of culture medium was added to each well and cultured for 24 h;

[0068] (3) Induction and sample addition: The supernatant was discarded. The control group was added with 100 μL of DMEM medium containing 20 μM stimulant histamine solution (2105341, Gibco), and the sample group was added with 100 μL of medium containing 20 μM stimulant histamine solution and 1 wt% sample solution, and cultured for 24 h;

[0069] (4) Real-time fluorescence quantitative PCR was used to detect the gene expression levels of TRPV1 channel receptor TRPV1 and PAR-2 channel receptor F2RL1 in HaCaT cells of each group; Total RNA was extracted from HaCaT cells of each group by the TRIzol method; cDNA was synthesized by reverse transcription reaction using the TaKaRa reverse transcription kit (total reaction system was 20 μL); Real-time RT-PCR was carried out on a CFX96 TM Real-time system (Bio-Rad, USA); The PCR conditions were as follows: pre-denaturation at 95 °C for 30 seconds, followed by 40 cycles, each cycle including denaturation at 95 °C for 5 seconds, annealing at 60 °C for 30 seconds, and extension at 72 °C for 45 seconds; GAPDH was used as an internal reference gene, and the relative expression level of each gene was calculated using 2-ΔΔCT Calculated by the method, and the primer sequences used are shown in Table 1:

[0070] Table 1 Primer Sequences

[0071] Gene Primer sequence (5'→3') TRPV1-F CTGGACCTGGTCAACCTCAT TRPV1-R GATGGGGATCTTGGTGTCAG F2RL1-F CCGTGACCGTGACTTTGTCT F2RL1-R GCGGATGATGGTGTTGTAGG GAPDH-F GAGTCAACGGATTTGGTCGT GAPDH-R TTGATTTTGGAGGGATCTCG

[0072] Calculate the gene inhibition rate according to the following formula:

[0073] Gene inhibition rate = |(Target gene expression level 对照组 - Target gene expression level 样品组 )| / Target gene expression level 对照组 × 100%;

[0074] Wherein,

[0075] Target gene expression level 对照组 Is the target gene expression level of the control group;

[0076] Target gene expression level 样品组 Is the target gene expression level of the sample group;

[0077] Test Example 2: Inhibitory Effect of the Composition on Neurogenic Inflammation

[0078] In the experiment, capsaicin was used to specifically activate the TRPV1 channel of keratinocytes, directly triggering the neurogenic inflammation cascade reaction and inducing the massive release of key inflammatory factors such as TNF-α and IL-1α; This process precisely mimics the core mechanism of skin burning and redness: TNF-α amplifies vascular permeability to cause redness, and IL-1α stimulates pain neurons to induce stinging pain. The strength of the inhibitory effect of the composition on the inflammatory factors TNF-α and IL-1α can indicate the strength of the composition in relieving stress;

[0079] Samples: The stress-relieving compositions prepared in Examples 1-5 and Comparative Examples 1-7;

[0080] Test cells: The cell line used was human keratinocyte HaCaT (Shanghai Yaji Biotechnology Co., Ltd.), and the cryopreservation passage was the 9th generation;

[0081] Test conditions: Incubator temperature 37 ± 1 °C, humidity 90 ± 5%, carbon dioxide 5 ± 1%;

[0082] According to the grouping, cell culture and treatment were carried out, and then tests were carried out. The test method is as follows:

[0083] (1) Sample preparation: The sample was completely dissolved in DMSO, and then diluted with DMEM culture medium into a sample solution, where the mass percentage of the sample in the sample solution was 1 wt%;

[0084] (2) Inoculate the cell suspension into a 96-well cell culture plate at a density of 2000 cells / well, add 100 μL of culture medium to each well, and culture for 24 h;

[0085] (3) Induction and sample addition: Discard the supernatant. Add 100 μL of DMEM medium (2105341, Gibco) containing 4.6 μg / mL of the stimulant capsaicin solution to the control group, and add 100 μL of medium containing 4.6 μg / mL of the stimulant capsaicin solution and 1 wt% of the sample solution to the sample group, and culture for 24 h;

[0086] (4) Detection of inflammatory factors: Lyse the cells according to the instructions of the TNF-α ELISA detection kit (ml061140, Shanghai Enzyme-linked) and the IL-1α ELISA detection kit (ml061140, Shanghai Enzyme-linked), and collect the supernatant. Detect the absorbance at a wavelength of 450 nm by ELISA, and detect the concentrations of TNF-α and IL-1α (pg / mL).

[0087] Calculate the TNF-α inhibition rate and the IL-1α inhibition rate according to the following calculation method:

[0088] Inflammatory factor inhibition rate = |(inflammatory factor content 对照组 - inflammatory factor content 样品组 )| / inflammatory factor content 对照组 × 100%;

[0089] Among them,

[0090] Inflammatory factor content 对照组 is the inflammatory factor content of the control group;

[0091] Inflammatory factor content 样品组 is the inflammatory factor content of the sample group;

[0092] Table 2 Data of the inhibition rates of nerve sensory pathway receptors and inflammatory factors

[0093]

[0094] From the data of the gene inhibition rates and the inflammatory factor inhibition rates of Examples 1-5 and Comparative Examples 1-3 in Table 2, it can be seen that the TRPV1 inhibition rate, F2RL1 inhibition rate, TNF-α inhibition rate, and IL-1α inhibition rate of Examples 1-5 using the compound of four components of camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract are all significantly improved, indicating that the four components of camellia extract, porphyra extract, illicium lanceolatum leaf extract, and vetiver extract have a synergistic effect, enhancing the ability of the composition to relieve stress.

[0095] Combined with the data of Example 1 and Comparative Examples 4-7, it can be seen that when the weight ratio of camellia extract, porphyra extract, illicium lanceolatum leaf extract and vetiver extract is (0.5-1):(0.05-0.5):(0.6-0.8):(0.1-0.3), the TRPV1 inhibition rate, F2RL1 inhibition rate, TNF-α inhibition rate and IL-1α inhibition rate of the composition are optimal, thus making the soothing stress effect of the composition better.

[0096] Application Examples 1-5 and Comparative Application Examples 1-7

[0097] The compositions of Examples 1-5 and Comparative Examples 1-7 were added to the essence at a concentration of 3 wt% respectively to obtain the essences of Application Examples 1-5 and Comparative Application Examples 1-7, and the formula is shown in Table 3.

[0098] The preparation methods of the essences of Application Examples 1-5 and Comparative Application Examples 1-7 include the following steps:

[0099] The preparation method of the essence includes the following steps:

[0100] S1. Mix the humectant, thickener and 1 / 2 amount of deionized water, and homogenize and mix them at 80 °C to obtain an aqueous solution;

[0101] [ S2. Wait for the temperature of the aqueous solution in S1 to drop to 60 °C, add the preservative, and when the system temperature drops to 40 °C, further add each component, essence and the remaining deionized water in the compositions of each example and comparative example to the system, stir evenly, and finally add a pH regulator to adjust the pH to 6 to obtain the essence.

[0102] Table 3 Formulas of the essences of Application Examples 1-5 and Comparative Application Examples 1-7

[0103]

[0104]

[0105] Comparative Application Example 8

[0106] The difference between Comparative Application Example 8 and Application Example 1 is that the essence of Comparative Application Example 8 does not add the composition, and uses an equal amount of deionized water to replace the composition, and the preparation method is the same as that of Application Example 1.

[0107] Test Example 3: Short-term and long-term soothing stress effects on the human body

[0108] This test example verifies the improvement effects of the essences of Application Examples 1-5 and Comparative Application Examples 1-8 on facial barrier damage;

[0109] Samples: The essences prepared in Application Examples 1-5 and Comparative Application Examples 1-8;

[0110] Experimental method: According to the safety test methods specified in the Technical Specifications for Cosmetics Safety, subjects were included. 78 Asian adult testers aged 18 - 60 with sensitive skin were selected and randomly divided into 13 groups, with 6 people in each group. On the day when the subjects visited, after washing their faces with clear water in the test area, no products were applied. After sitting quietly for 20 minutes in an air-conditioned room with a temperature of 21 ± 1°C and a humidity of 50 ± 10%, the Tewameter TM Hex probe, CM 825 probe and MX 18 probe were used to measure the transepidermal water loss (TEWL), moisture content and erythema index (a* value) of the cheekbones as the initial values, and Visia-CR was used to photograph the facial status of the subjects.

[0111] Immediate test: All subjects washed their faces 6 times with a soap-based facial cleanser (Shiseido Specialist Facial Cleanser), about 1 minute each time. After waiting for 10 minutes, the TEWL and moisture content of the cheekbones of the face were measured and set as the values after modeling. Subsequently, 1 g of essence was applied to the whole face, and after waiting for 10 minutes, the TEWL and moisture content of the cheekbones of the face were measured as the index data after immediate use. It was found in the experiment that washing the face 6 times did not cause facial flushing, so the erythema index (a* value) was not detected in the immediate test;

[0112] Long-term test: The subjects used the sample twice a day, morning and evening. After 14 days, a follow-up visit was conducted, and the TEWL, moisture content, and erythema index (a* value) of the cheekbones were measured as the index data for 14 days, and Visia-CR was used to photograph the facial status of the subjects;

[0113] The experiment established a skin barrier damage model by washing the face 6 times. The larger the TEWL value during the immediate test, the more severe the skin barrier damage;

[0114] The immediate improvement rate and long-term improvement rate were calculated according to the following formula:

[0115] Immediate improvement rate (%) = |(X 使用后 - X 造模后 ) / (X 造模后 - X 初始值 )| × 100%

[0116] 14-day improvement rate (%) = |(X 使用后 - X 初始值 ) / X 初始值 | × 100%

[0117] In the formula:

[0118] X 初始值 refers to the index data measured for each subject before using the product;

[0119] X造模后 The data of each index after the subject washed their face 6 times during the instant test;

[0120] X 使用后 The data of each index tested after the subject used the product;

[0121] The calculated data is shown in Table 4 below;

[0122] Table 4 Test data of the essence of the application example and the comparative application example

[0123]

[0124] From the data of Application Examples 1-5 and Comparative Application Examples 1-3 in Table 4, it can be seen that for Application Examples 1-5 with the compound of four components of camellia extract, porphyra extract, illicium anisatum leaf extract and vetiver extract, the improvement rate of TEWL value decreased significantly, the improvement rate of moisture increased significantly, and the improvement rate of erythema was greater than 16%, indicating that the four components of camellia extract, porphyra extract, illicium anisatum leaf extract and vetiver extract have synergistic effects and the stress-relieving ability of the composition is enhanced.

[0125] Combined with the data of Application Example 1 and Comparative Application Examples 4-7, it can be seen that when the weight ratio of camellia extract, porphyra extract, illicium anisatum leaf extract and vetiver extract is (0.5-1):(0.05-0.5):(0.6-0.8):(0.1-0.3), the improvement rate of TEWL value, the improvement rate of moisture and the improvement rate of erythema of the composition are the best, thus making the stress-relieving effect of the composition better.

[0126] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A stress-relieving composition containing camellia extract, characterized in that, It comprises the following components: camellia extract, porphyra extract, illicium lanceolatum leaf extract and vetiver extract, and the weight ratio of the camellia extract, porphyra extract, illicium lanceolatum leaf extract and vetiver extract is (0.1 - 5):(0.01 - 5):(0.1 - 3):(0.01 - 1).

2. The stress-relieving composition containing camellia extract according to claim 1, wherein The weight ratio of the camellia extract, porphyra extract, illicium lanceolatum leaf extract and vetiver extract is (0.5 - 3):(0.05 - 2):(0.5 - 1):(0.05 - 0.5).

3. The stress-relieving composition containing camellia extract according to claim 1, wherein, The weight ratio of the camellia extract, porphyra extract, illicium lanceolatum leaf extract and vetiver extract is (0.5 - 1):(0.05 - 0.5):(0.6 - 0.8):(0.1 - 0.3).

4. Use of the stress - relieving composition containing camellia extract according to any one of claims 1 - 3 in the preparation of skin care products.

5. Use of the stress-relieving composition containing camellia extract according to claim 4 in the preparation of skin care products, characterized in that, The skin care product is any one of lotion, emulsion, cream, facial mask, essence or spray, and the addition amount of the composition is 0.5% - 5% of the total weight of the skin care product.

6. An essence, characterized in that, It comprises raw materials in the following weight percentages: 0.5% - 5% of the composition according to any one of claims 1 - 3, 0.05% - 0.3% of thickener, 0.5% - 10% of humectant, 0.5% - 5% of preservative and 0.01% - 0.3% of pH regulator, and the balance is deionized water.

7. The essence according to claim 6, characterized in that, The raw materials are selected from at least one of (a)-(d): (a) The thickener includes at least one of xanthan gum, carbomer, acryloyldimethyltaurate / VP copolymer, ammonium acryloyldimethyltaurate / VP copolymer, sclerotium gum and cetyl alcohol; (b) The humectant includes at least one of allantoin, betaine, β - glucan, trehalose, caprylyl glycol, dipropylene glycol, sodium hyaluronate, 1,3 - butanediol, glycerol, pullulan and ceramide; (c) The pH regulator includes at least one of arginine, tromethamine and disodium EDTA; (d) The preservative includes at least one of 1,2 - propanediol, 1,2 - hexanediol and p - hydroxyacetophenone.

8. The preparation method of the essence according to claim 7, characterized in that, It comprises the following steps: S1. Mix the humectant, thickener and part of deionized water, homogenize and mix evenly to obtain an aqueous solution; S2. When the temperature of the aqueous solution in S1 drops to 55 - 65 °C, add the preservative. When the system temperature drops to 40 - 45 °C, further add each component of the composition according to any one of claims 1 - 3, essence and the remaining deionized water to the system, stir evenly, and finally add the pH regulator to adjust the pH to obtain the essence.

9. The preparation method according to claim 8, characterized in that, The homogenization temperature in step S1 is 75 - 85 °C.

10. The preparation method according to claim 8, characterized in that, The pH in step S2 is adjusted to 5.5 - 6.5.

Images