Recombinant rabies virus nano-antibody fused with solubilizing oligopeptide and cell penetrating peptide and application of recombinant rabies virus nano-antibody in preparation of rabies prevention and treatment products

Abstract

The invention relates to the technical field of biological medicines, in particular to a recombinant rabies virus nano-antibody fused with a solubilizing oligopeptide and a cell penetrating peptide and application of the recombinant rabies virus nano-antibody in preparation of rabies prevention and treatment products. The recombinant rabies virus nano-antibody fused with the solubilizing oligopeptide and the cell penetrating peptide comprises a humanized rabies virus nano-antibody, and the C end of the humanized rabies virus nano-antibody is fused with a solubilizing tag peptide P17 and the cell penetrating peptide. The recombinant rabies virus nano antibody utilizes a prokaryotic expression system, is low in cost, has excellent cell membrane and BBB penetrating ability, can enter a central nervous system from veins for virus neutralization treatment, and has an efficient passive immune effect.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly relates to a recombinant rabies virus nanobody fused with a solubility-enhancing short peptide and a cell-penetrating peptide and its application in the preparation of rabies prevention and treatment products. Background Art

[0002] Rabies is an acute and severe zoonotic infectious disease caused by the highly neurotropic rabies virus (RABV). The rabies virus is transmitted through the saliva of infected animals. It first replicates in the muscle tissue at the wound site, and then enters the peripheral nerves by binding the acetylcholine receptor at the neuromuscular junction to the glycoprotein on the virus envelope. The rabies virus spreads along the peripheral nerves to the central nervous system through the retrograde transport mechanism of the axon. The virus mainly multiplies in large numbers in the gray matter area of the brain and causes fatal encephalitis and central respiratory failure. Timely post-exposure prophylaxis (PEP) is the most effective method for preventing and controlling rabies.

[0003] Currently, the core standard of PEP is the combined administration of human rabies immune globulin (HRIG) and rabies vaccine. The effectiveness of RIG and vaccine therapy in treating rabies infection has been recognized, especially when administered immediately after exposure. However, RIG has a relatively high economic cost, insufficient supply, and limited production. Compared with traditional equine rabies immunoglobulin (ERIG) and human rabies immunoglobulin (HRIG), rabies monoclonal antibody preparations have the advantages of large-scale production, a single antibody spectrum, relatively high purity, higher safety, and higher neutralization efficiency. In addition, due to the existence of the blood-brain barrier (BBB), which limits the entry of many therapeutic drugs into the CNS, with the development of nanotechnology, some nanodelivery systems can overcome the limitations of the BBB and improve the ability of drugs to target the brain. Nanotechnology provides a potential tool for rabies treatment.

[0004] Nanobody (Nb) is an antibody without a light chain found in the serum of camelids. This antibody only contains a variable domain of the heavy chain of the heavy-chain antibody (VHH), two constant regions CH2 and CH3, lacks two light chains and the constant region CH1, and has a relative molecular mass of only 12-14 kDa. As a new type of biological agent, nanobody has unique advantages, such as small molecular weight, precise targeting, and easy modification, and has significant potential in the prevention and control of infectious diseases. Some studies have shown that nanobodies can intervene in multiple stages of the virus life cycle, such as virus adsorption, entry, and release, and have good effects in the treatment of novel coronavirus infection, influenza, etc. Nanobodies also play a role in rabies virus. The nanobody of rabies virus glycoprotein fused with the Fc fragment of IgG can extend its half-life, so as to better neutralize rabies virus and have a better protective effect on infected mice. Some studies have shown that the synergistic mechanism of nanobody combined with vaccine can prolong the onset time of virus-challenged mice, extend the median survival time, and reduce its mortality rate.

[0005] Cell-penetrating peptides (CPPs) are typically composed of 5 to 30 amino acids and have a high net positive charge at physiological pH. As a class of short peptides capable of delivering biomacromolecules across cell membranes, they can be used as molecular transporters, assisting therapeutic drugs (such as small molecules, nucleic acids, proteins, and nanoparticles) in crossing physiological barriers. Due to their inherent advantages such as high delivery capacity, low toxicity, and extensive functionality, CPPs have become one of the most commonly used technologies for intracellular delivery in recent years. They are also considered effective tools for intracellular delivery across the blood-brain barrier (BBB), intestinal tract, nasal cavity, and skin. The ability of CPPs to rapidly transport biomaterials and therapeutic drugs across cell membranes provides a powerful tool for transporting macromolecules across the BBB. The T7 peptide can achieve targeting by binding to the transferrin receptor (TfR) and has been widely used as a ligand in the construction of tumor-targeted nanodrug delivery systems. Angiopep-2 (An2) is a short peptide composed of 19 amino acids that specifically binds to low-density lipoprotein receptor-related protein 1 (LRP-1). An2 peptide, a highly effective LRP-1 targeting ligand, has expanded its reach beyond brain cancer to include neurological diseases such as brain injury and stroke. PepH3, a short cationic peptide derived from the dengue virus type 2 capsid protein, possesses the ability to penetrate the blood-brain barrier and can be conjugated to single-domain antibodies (sdAbs) to target amyloid-β (Aβ) oligomers. Studies have shown that PepH3 peptides, when used as labeling ligands for nanocarriers, can enhance the uptake of nanoparticles into brain endothelial cells and also enhance the transcytosis of sdAbs across the BBB. TAT peptides, a cell-penetrating peptide derived from the human immunodeficiency virus transcriptional activator, have become a classic drug delivery tool due to their efficient transmembrane ability and broad applicability. RVG29, a 29-amino acid peptide derived from the rabies virus glycoprotein (RVG), specifically binds to nicotinic acetylcholine receptors on neurons. Its modified nanoparticle drug delivery systems (such as nucleic acids, synthetic nanoparticles, and liposomes) offer a potential therapeutic strategy for drug delivery across the BBB.

[0006] In summary, traditional antisera or monoclonal antibodies can effectively neutralize rabies virus in vitro, but they face many difficulties in entering the central nervous system or cells to neutralize and treat the virus. Therefore, the recombinant fusion of cell-penetrating peptides and small nanobodies to facilitate their crossing of cell membranes or the blood-brain barrier will provide a promising candidate drug for the treatment and passive immunization of rabies. Summary of the Invention

[0007] To overcome the deficiencies and drawbacks of the prior art, the primary object of the present invention is to provide a recombinant rabies virus nanobody that fuses a solubilizing short peptide and a cell-penetrating peptide. This antibody is based on a binding nanobody of the rabies virus glycoprotein (G protein) and further fuses a solubilizing short peptide and a cell-penetrating peptide (CPP).

[0008] Another object of the present invention is to provide the application of the above-mentioned recombinant rabies virus nanobody.

[0009] Another object of the present invention is to provide a recombinant vector.

[0010] The fourth object of the present invention is to provide a biological material that expresses the recombinant rabies virus nanobody fusing the solubilizing short peptide and the cell-penetrating peptide.

[0011] The fifth object of the present invention is to provide a preparation method for the above-mentioned recombinant rabies virus nanobody fusing the solubilizing short peptide and the cell-penetrating peptide.

[0012] The objects of the present invention are achieved by the following technical solutions:

[0013] A recombinant rabies virus nanobody that fuses a solubilizing short peptide and a cell-penetrating peptide, comprising a humanized rabies virus nanobody, with a solubilizing tag peptide P17 and a cell-penetrating peptide fused to its C-terminus;

[0014] The cell-penetrating peptide is preferably at least one of T7, An2, PepH3, RVG29, and TAT;

[0015] The amino acid sequence of the recombinant rabies virus nanobody that fuses the solubilizing short peptide and the cell-penetrating peptide is shown as at least one of SEQ ID No.1-5;

[0016] The nucleotide sequence of the gene encoding the recombinant rabies virus nanobody that fuses the solubilizing short peptide and the cell-penetrating peptide is shown as at least one of SEQ ID No.6-10;

[0017] The application of the recombinant rabies virus nanobody that fuses the solubilizing short peptide and the cell-penetrating peptide in the preparation of rabies prevention and / or passive immunization products;

[0018] A recombinant expression vector, which contains the gene encoding the recombinant rabies virus nanobody that fuses the solubilizing short peptide and the cell-penetrating peptide;

[0019] The recombinant vector is obtained by ligating the gene encoding the recombinant rabies virus nanobody that fuses the solubilizing short peptide and the cell-penetrating peptide with an expression vector;

[0020] The expression vector is preferably pET28a;

[0021] A biological material expressing a recombinant rabies virus nanobody fused with a solubility-enhancing short peptide and a cell-penetrating peptide, which is obtained by transferring the above recombinant vector into an expression system;

[0022] The expression system can be bacteria or fungi;

[0023] The bacteria are preferably Escherichia coli SHuffle T7;

[0024] The application of the recombinant vector and the biological material in the preparation of rabies prevention and / or passive immunization products;

[0025] The preparation method of the recombinant rabies virus nanobody fused with the solubility-enhancing short peptide and the cell-penetrating peptide comprises the following steps:

[0026] Induce the expression of the biological material expressing the recombinant rabies virus nanobody fused with the solubility-enhancing short peptide and the cell-penetrating peptide, and purify it to obtain a humanized recombinant rabies virus nanobody;

[0027] The preparation method of the recombinant rabies virus nanobody fused with the solubility-enhancing short peptide and the cell-penetrating peptide preferably comprises the following steps:

[0028] (1) Transfer the recombinant expression vector into SHuffle T7 competent cells to obtain a strain expressing the recombinant rabies virus nanobody fused with the solubility-enhancing short peptide and the cell-penetrating peptide;

[0029] (2) Expand the culture of the strain obtained in step (1) to an OD 600 When it reaches 0.6 - 0.7, add IPTG to induce expression;

[0030] (3) Centrifuge the bacterial liquid after induction expression in step (2), resuspend it, and then ultrasonically disrupt it, and then centrifuge it, and filter the supernatant;

[0031] (4) Purify the supernatant filtered in step (3) by nickel ion resin affinity chromatography to obtain the recombinant rabies virus nanobody fused with the solubility-enhancing short peptide and the cell-penetrating peptide;

[0032] The conditions for the induction expression are preferably to add IPTG to induce expression for 24 h;

[0033] The conditions for the purification are preferably: elute the non-specifically bound proteins with 20 mmol and 40 mmol imidazole in sequence; then elute the proteins with 100 mmol, 200 mmol, 260 mmol and 500 mmol imidazole in sequence, and collect the eluate;

[0034] The technical principle of the present invention:

[0035] After the body is infected with the rabies virus, the virus will invade the central nervous system from the peripheral nerves and replicate and spread in neurons. Due to the existence of the blood-brain barrier (BBB), most conventional drugs, including antibodies, are difficult to enter the brain and cannot effectively neutralize the virus. At the same time, currently, immunoglobulin or monoclonal antibodies are mainly used in the passive immunoprophylaxis of rabies, which is costly. Therefore, there is an urgent need to find a pharmaceutical preparation that can replace conventional immunoglobulin in the treatment and passive immunization of rabies. In this invention, the RABV nanobody plasmid screened and constructed in the early stage of the laboratory was modified, and a solubility-enhancing short peptide P17 (a short peptide that improves the solubility of nanobody prokaryotic expression) and different cell-penetrating peptides (T7, An2, PepH3, RVG29, and TAT) were fused at its C-terminus. Using the prokaryotic expression system, a recombinant rabies virus nanobody with low cost, which can improve the ability of the nanobody to penetrate cell membranes and the BBB, can enter the central nervous system from the vein for virus neutralization treatment, and has an efficient passive immunization effect, was produced, in order to provide an alternative drug for the treatment and passive immunization of rabies.

[0036] The present invention has the following advantages and effects compared with the prior art:

[0037] (1) The present invention optimized the sequence composition of the recombinant rabies virus nanobody: ① A solubility-promoting short peptide P17 was introduced on the basis of the original sequence, replacing the original relatively large molecular weight MBP tag. In this way, the recombinant rabies virus nanobody can be solubly expressed in Escherichia coli, and its molecular weight is reduced to 1 / 3 of the original, improving its ability to penetrate the blood-brain barrier; ② Five different cell-penetrating peptides were fused at the C-terminus of the recombinant rabies virus nanobody. Through passive immunoprotection experiments and infection treatment experiments, it was confirmed that these 5 cell-penetrating peptides can improve the passive immunization effect of the rabies virus nanobody and its ability to penetrate the blood-brain barrier from the vein into the brain to neutralize the virus to varying degrees. Among them, the recombinant nanobodies with the best passive immunoprotection effect, which can achieve 100% protection, are 213E6-P17-T7, 213E6-P17-An2, and 213E6-P17-RVG29; the one with the best treatment effect on infected mice is 213E6-P17-PepH3, followed by 213E6-P17-An, 213E6-P17-RVG29, 213E6-P17-T7, and 213E6-P17-TAT.

[0038] (2) The present invention provides a recombinant rabies virus nanobody that can be produced by Escherichia coli, which has a low preparation cost, can effectively neutralize the virus and has the ability to penetrate cell membranes and the blood-brain barrier. It is expected to replace the currently used rabies passive immunization preparations (human immunoglobulin or monoclonal antibodies), and also provides a potential new drug for the treatment of rabies. Brief Description of the Drawings

[0039] Figure 1 It is a map of the recombinant nanobody.

[0040] Figure 2 It is a map of the SDS-PAGE electrophoresis identification results of the purified recombinant nanobodies 213E6-P17-T7, 213E6-P17-PepH3, 213E6-P17-An2, 213E6-P17-TAT, and 213E6-P17-RVG29. Among them, M: Color protein prestained Marker, 1: Flow-through, 2: Elution with Solution I, 3: 20 mmol imidazole eluent, 4: 40 mmol imidazole eluent, 5: 100 mmol imidazole eluent, 6: 200 mmol imidazole eluent, 7: 260 mmol imidazole eluent, 8: 500 mmol imidazole eluent.

[0041] Figure 3 It is a map of the Western blot detection results of the recombinant nanobody in the mouse brain after intravenous injection. Among them, a: 213E6-P17-T7, b: 213E6-P17-PepH3, c: 213E6-P17-An2, d: 213E6-P17-RVG29, e: 213E6-P17-TAT.

[0042] Figure 4 It is a map of the results of the survival rate and body weight change of mice in the in vitro neutralization protection test of the recombinant nanobody.

[0043] Figure 5 It is a map of the results of the survival rate and body weight change of mice in the passive immunotherapy of challenged mice.

[0044] Figure 6 It is a map of the results of the survival rate and body weight change of mice after intravenous injection of the recombinant nanobody on the 3rd day after infection.

[0045] Figure 7 It is a map of the results of the survival rate and body weight change of mice after intravenous injection of the recombinant nanobody on the 4th day after infection.

[0046] Figure 8 It is a map of the results of the survival rate and body weight change of mice after intravenous injection of the recombinant nanobody on the 5th day after infection.

[0047] Figure 9 It is a map of the results of the survival rate and body weight change of mice after intravenous injection of the recombinant nanobody on the 6th day after infection. Detailed Description of the Invention

[0048] The present invention will be further described in detail below in conjunction with the embodiments and the drawings, but the embodiments of the present invention are not limited thereto.

[0049] The patent application publication number is CN118440190A, and the patent application title is "A Humanized Rabies Virus Nanobody, Recombinant Nanobody Protein and Their Application in the Preparation of Rabies Prevention and Treatment Products", which discloses a humanized rabies virus nanobody (RV-hNb07). By genetic engineering methods, enhanced green fluorescent protein (EGFP) and blood-brain barrier penetrating peptides T7 or PepH3 are fused to its C-terminus, and the recombinant nanobody fusion protein gene is inserted into the pMal-p5x vector, and expressed and purified by prokaryotic bacteria. This recombinant vector fuses a maltose-binding protein (MBP protein) with a relatively large molecular weight (about 40 kD) to the C-terminus of the nanobody to increase the solubility of the nanobody; in order not to affect the activity of the nanobody, the MBP needs to be removed with factor Xa protease after purifying the protein, and then purified again. That is, it needs to be purified twice and digested once, with complex operations and high costs.

[0050] On the basis of the above patent application, the present invention continues to modify and optimize the humanized rabies virus nanobody (RV-hNb07), introducing a small molecular weight solubility-enhancing short peptide P17, which can not only enable the soluble expression of the nanobody, but also does not affect the antibody activity, and can be directly used after one-step affinity chromatography purification. At the same time, in order to enhance the ability of the rabies virus nanobody to enter the central nervous system and neutralize the virus intracellularly, the present invention fuses different cell-penetrating peptides (T7, PepH3, An2, TAT and RVG29) to the C-terminus, and expresses and purifies them through the prokaryotic expression engineering bacterium Shuffle T7. Through cell immunofluorescence, virus neutralization test, infiltration injection and intravenous injection treatment of infected mice after exposure, the therapeutic effects of different recombinant nanobody fusion proteins are comprehensively evaluated.

[0051] Example 1

[0052] 1. Sequence information

[0053] Using the humanized recombinant nanobody RV-hNb07 (GAAGTACAGCTACAAGCTAGTGGTGGAGGGTTCGTGCAACCGGGTGGCAGCTTGCGCCTGAGCTGTGCGGCGAGCGGTCGTACCCTGTCTTCCTATCGTATGGGTTGGTTTCGTCAGGCACCGGGTAAAGAGCGCGAATTTGTGAGCGCGATTTCTTGGAACGGCCGTAGCACCTACTACGCAGACAGCGTTAAAGGTCGCTTCACCATCAGCCGTGATAATTCCAAGAACACCGTCTATCTGCAAATGAACTCGTTGAGAGCTGAGGACACCGCGACGTATTACTGCGCCGCGGCTCTGATCGGCGGCTATTACAGCGATGTTGACGCCTGGTCCTACTGGGGTCAGGGCACTCAGGTTACGGTGTCATCC) with high virus neutralization ability in CN118440190A as the object of modification, a solubilizing peptide P17 and different cell-penetrating peptides were fused at its C-terminus, and the recombinant humanized rabies virus nanobody fusion proteins were named 213E6-P17-T7, 213E6-P17-PepH3, 213E6-P17-An2, 213E6-P17-TAT, 213E6-P17-RVG29( Figure 1 ), and their amino acid and nucleotide sequences are as follows (the underlined part is P17, and the wavy line part is the cell-penetrating peptide):

[0054] Nucleotide sequence of 213E6-P17-T7:

[0055]

[0056] Amino acid sequence of 213E6-P17-T7:

[0057]

[0058] Nucleotide sequence of 213E6-P17-PepH3:

[0059]

[0060] Amino acid sequence of 213E6-P17-PepH3:

[0061]

[0062] 213E6-P17-An2 DNA nucleotide sequence:

[0063]

[0064] 213E6-P17-An2 amino acid sequence:

[0065]

[0066]

[0067] 213E6-P17-TAT nucleotide sequence:

[0068]

[0069] 213E6-P17-TAT amino acid sequence:

[0070]

[0071] 213E6-P17-RVG29 nucleotide sequence:

[0072]

[0073] 213E6-P17-RVG29 amino acid sequence:

[0074]

[0075] 2. Construction of recombinant plasmids

[0076] The above nucleotide sequences were synthesized by Genewiz Biotechnology Co., Ltd., and NdeI and Hind III restriction sites were designed at both ends of the sequences. Then, they were inserted into the pET28a vector (provided by Genewiz Biotechnology Co., Ltd.) through the Nde I and Hind III restriction sites according to the conventional method. Finally, the recombinant expression vectors pET28a-213E6-P17-T7, pET28a-213E6-P17-PepH3, pET28a-213E6-P17-An2, pET28a-213E6-P17-TAT, and pET28a-213E6-P17-RVG29 were successfully constructed.

[0077] 3. Expression and purification of recombinant nanobodies

[0078] 3.1 Expression of recombinant nanobodies

[0079] (1) The above recombinant plasmids were respectively transformed into SHuffle T7 competent cells (preserved by the Laboratory of Veterinary Microbiology, College of Veterinary Medicine, South China Agricultural University, available commercially) according to the conventional method. Single colonies were picked and inoculated into 1 mL of LB liquid medium (containing 50 μg / mL kanamycin), and placed in a constant temperature shaker at 30 °C and 200 r / min for 6 - 8 h to obtain the primary seed solution.

[0080] (2) 140 μL of the primary seed solution was inoculated into 7 mL of LB medium (containing 50 μg / mL kanamycin), and continued to be cultured in a constant temperature shaker at 30 °C and 200 r / min for 12 - 16 h to obtain the secondary seed solution.

[0081] (3) 5 mL of the cultured secondary seed solution was added to 500 mL of TB medium (containing 50 μL / mL kanamycin), and cultured in a constant temperature shaker at 30 °C and 200 r / min for 5 h. The OD value was measured. After shaking until the OD 600 reached 0.6 - 0.7, 5 mL of 0.1 mol / L IPTG was added, and induced expression was carried out for 24 h.

[0082] (4) The induced bacterial solution was taken out and poured into a 50 mL centrifuge tube, and centrifuged at 6000 r / min for 20 min at 4 °C. The supernatant was discarded until the bacterial solution centrifugation was completed.

[0083] (5) The accumulated precipitate of 250 mL collected in each tube was resuspended with 30 mL of PBS to prepare a suspension.

[0084] (6) Placed on ice, the power of the ultrasonic cell disruptor was set to 50%, and ultrasonicated for 30 min until the suspension was clear and transparent.

[0085] (7) After ultrasonic disruption, centrifuged at 6000 r / min for 20 min at 4 °C, and the supernatant was filtered through a 0.22 μm filter for subsequent purification.

[0086] 3.2 Purification of recombinant nanobody

[0087] (1) Purification of protein by nickel ion resin affinity chromatography: First, rinse the bottom sieve plate of the chromatography column (Ni NTA Beads gravity column, product number: SA004GC05, purchased from Renhe Biotechnology Co., Ltd.) with ddH2O to ensure that there are no air bubbles on the bottom sieve plate of the column. Tighten the outlet plug at the bottom of the column and close the outlet. Use a pipette to aspirate the column material into the affinity chromatography column and wait for it to solidify before use. The purification process needs to be carried out in a 4°C mini-refrigerator. Turn on the switch, let the residual liquid flow out, and wash it 3 times with ultrapure water, 10 mL each time. Solution I (7.3 g of Na2HPO4·12H2O, 14.65 g of NaCl, 0.57 g of NaH2PO4 are added to 500 mL of ultrapure water, and the pH value is adjusted to 7.4 - 7.6) is used to balance the column to enable better binding with the protein. Wash it three times, 7 mL each time. Transfer the protein sample supernatant to the affinity chromatography column and collect the liquid flowing out of the chromatography column with a 50 mL EP tube until the protein sample is completely transferred. The remaining liquid can be used for a second loading to avoid wasting the protein sample that fails to bind to the column. After loading, elute it three times with 25 mL of 20 mmol imidazole and elute the non-specifically bound protein three times with 25 mL of 40 mmol imidazole. Then elute it with 2 mL of 100 mmol imidazole, and collect the eluate with a sterilized EP tube; elute it with 3 mL of 200 mmol imidazole, and collect the eluate with a sterilized EP tube; elute it with 4 mL of 260 mmol imidazole, and collect the eluate with a sterilized EP tube; elute it with 1 mL of 500 mmol imidazole, and collect the eluate with a sterilized EP tube. Finally, clean the chromatography column. First, use Solution II (17 g of imidazole is dissolved in 500 mL of Solution I), 5 mL each time, and elute it 3 times; then use ultrapure water, 10 mL each time, and elute it 3 times; finally, use 20% (v / v) alcohol, 5 mL each time, and elute it 3 times. Close the outlet and add 3 mL of 20% (v / v) alcohol and store it in a 4°C refrigerator.

[0088] (2) SDS-PAGE electrophoresis analysis: Prepare a 1.0 mm thick protein gel according to the instructions of the SDS-PAGE Gel Rapid Preparation One-Step Kit (separating gel concentration 10%) (Shanghai Yaen Biopharmaceutical Technology Co., Ltd.). Take 40 μL each of the bacterial solution before protein induction, the bacterial solution after induction, the precipitate after sonication, the supernatant, and the eluate collected during purification into a 1.5 mL EP tube. Add 10 μL of 5× protein loading buffer and dilute to 1×, then mix well by shaking. Boil in a preheated metal bath at 100 °C for 10 min. Place the prepared gel in the electrophoresis tank, add 1× electrophoresis buffer, and sequentially add the prepared samples and protein marker into each well of the gel. Set the power supply to a constant voltage of 80 V for 30 min. After the samples have run through the upper gel and stabilized into a straight line, reset the parameters to a constant voltage of 120 V for 80 min. Stain the electrophoresed gel with Coomassie Brilliant Blue staining solution for 20 min, decolorize it 3 times with decolorizing solution, 30 min each time, until clear and transparent bands can be seen, and observe and record the results.

[0089] (3) Dialysis and concentration determination of purified protein:

[0090] Identified by SDS-PAGE electrophoresis, add the protein with higher purity and concentration eluted with imidazole into the activated dialysis bag. Place the dialysis bag in a beaker containing sterilized PBS buffer (pH 7.6 - 8.0), and perform dialysis on a magnetic stirrer for 24 h, changing the PBS every 8 h.

[0091] Thaw and shake well the ready-to-use BSA standards ① - ⑧ that have been diluted in the BCA Protein Quantification Kit (Shanghai Yaen Biopharmaceutical Technology Co., Ltd.). Repeat 3 groups for each concentration, add 20 μL each to a 96-well plate. Take 20 μL each of the samples to be tested (the protein solution after dialysis above) and add them to a 96-well plate, repeat 3 groups. Each sample can be diluted with PBS buffer to make multiple gradients. Add 200 μL of working chromogenic solution (operation requires protection from light) to the standards and samples to be tested, mix well, and incubate at 37 °C in the dark for 30 min. Measure with an enzyme-linked immunosorbent assay (ELISA) reader, draw a standard curve, and determine the concentration of the samples to be tested.

[0092] Filter the protein solution after dialysis with a 0.22 μm filter, aliquot it into 1.5 mL EP tubes, seal with a sealing film, and store in a 4 °C refrigerator.

[0093] Figure 2 It is the SDS-PAGE electrophoresis identification result diagram of the purified recombinant nanobodies 213E6-P17-T7, 213E6-P17-PepH3, 213E6-P17-An2, 213E6-P17-TAT, 213E6-P17-RVG29. It can be seen from the figure that the protein concentration corresponding to the 260 mmol imidazole eluate is higher.

[0094] In addition, according to the instructions of the BCA kit, a standard curve was fitted using the measured values of the standards, and the R2 value of the standard curve was 0.99831 < 1, indicating high reliability. Substituting the concentration of the protein to be measured into the formula, the concentrations of the purified proteins 213E6-P17-T7, 213E6-P17-PepH3, 213E6-P17-An2, 213E6-P17-RVG29, and 213E6-P17-TAT were obtained as 2.126 mg / mL, 1.998 mg / mL, 2.435 mg / mL, 2.275 mg / mL, and 0.779 mg / mL, respectively.

[0095] Example 2

[0096] 1. Determination of the neutralizing titer of recombinant nanobody

[0097] (1) Passage the cultured BHK-21 cells (baby hamster kidney cells, preserved in the Veterinary Microbiology Laboratory of the College of Veterinary Medicine, South China Agricultural University) into a 10 mm culture dish. When the cells grow to confluence at 37 °C, seed the cells into 4 96-well plates. Three plates are used as sample detection plates, with 4 rows × 12 columns as a sample area. Each plate can be used as two sample areas, and two proteins can be detected; one plate is used as a standard plate: the standard plate is divided into a standard serum (0.5 IU) control area (4 rows × 8 columns), a 1 IU (positive control) area (4 rows × 8 columns), a virus titer detection area (4 rows × 6 columns), a negative control (PBS) area (4 rows × 1 column), and a cell control area (4 rows × 1 column). After dividing the well plates into areas, add 150 μL of DMEM medium to each well in the virus titer detection area, and add 100 μL of DMEM medium to each of the remaining wells.

[0098] (2) Take 1 tube of 30 IU / mL human rabies immunoglobulin BRP standard serum (purchased from Shanghai BiYou Biotechnology Co., Ltd.) from -80 °C and place it on ice to melt. Dilute it with DMEM medium to a standard serum with a neutralizing titer of 0.5 IU / mL, and also dilute it with the medium to a standard serum of 1 IU / mL as a positive control. Add 50 μL of the 0.5 IU / mL standard serum and the sample to be tested to the 4 wells in the first column of the standard serum control area and each sample detection area, respectively. After thoroughly mixing the contents of each well in the first column of each area (150 μL) with a multi-channel pipette, aspirate 50 μL and transfer it into the wells of the second column. After changing the pipette tip, thoroughly mix the contents of each well in the second column (150 μL), aspirate 50 μL and transfer it into the wells of the third column, and so on... until the 12th column (the standard serum reference area is the 8th column). After thoroughly mixing the contents of each well with a pipette gun, aspirate 50 μL and discard it. At this point, the contents of each well are 100 μL, and the serum dilution factors for columns 1 to 12 are 3, 9, 27, 81, 243, 729... The number of repetitions is 4 rows.

[0099] (3) In a biosafety cabinet, dilute the cultured virus CVS-11 (preserved by the Veterinary Microbiology Laboratory of the College of Veterinary Medicine, South China Agricultural University) with DMEM medium to a final virus titer of 100 TCID 50 / 50 μL. After thorough mixing, add 50 μL of the virus dilution to each well in the sample detection area, each well in the standard serum control area, and the first column of wells in the virus titer detection area. After thoroughly mixing the contents of the first column of wells in the virus titer detection area with a multi-channel pipette, aspirate 50 μL and transfer it to each well in the second column. After changing the pipette tip, thoroughly mix the contents of the second column of wells (200 μL), aspirate 50 μL and transfer it to each well in the third column, and so on... until the sixth column. After thoroughly mixing the contents of each well, aspirate and discard 50 μL. At this point, the contents of each well are 150 μL, and the virus dilution factors for columns 1-6 are 1, 4, 16, 64, 256, and 1024 respectively, with a repetition number of 4 rows. Place the 4 well plates in an incubator at 37 °C for the neutralization process and incubate for 60-90 min.

[0100] (4) Take confluent monolayer BHK-21 cells, after trypsin digestion, suspend them in DMEM medium containing 20% serum by volume percentage, and add 50 μL (about 2×10 4 cells) to each detection well with a multi-channel pipette. Incubate in an incubator at 37 °C and 5% CO2 for about 48 h.

[0101] (5) Then discard the medium, add pre-cooled acetone at 80% by volume percentage and fix at -20 °C for 30 min. After aspirating the acetone, wash three times with PBS, add the diluted FITC-labeled rabies virus N protein monoclonal antibody (FITC Anti-Rabies Monoclonal Globulin, purchased from Fujirebio Diagnostics, USA), incubate overnight at 4 °C, wash three times with PBS, and observe under a fluorescence microscope. Prepare a recording paper according to the design of the culture plate. Any well with no less than 1 fluorescent cell is recorded as "+", otherwise it is recorded as "-".

[0102] (6) Referring to the recorded table, enter the two parameters for the retest of the virus titer at the corresponding positions in the computer FAVN automatic calculation software: the maximum dilution factor with all wells in a column being "+", and the number of "+" wells that appear after this multiple. The software automatically calculates the TCID of every 50 μL of this virus working solution 50Number; two parameters for inputting standard reference serum and the serum to be tested: the maximum dilution multiple of the entire column of "-" and the number of "-" that appears after that multiple. The software automatically calculates the neutralization titer of the serum to be tested. When the neutralization titer is less than 0.5 IU / mL, it indicates that the neutralizing antibodies in the protein are not sufficient to protect animals from a rabies-intensity attack; when the neutralization titer is greater than or equal to 0.5 IU / mL, it indicates that the neutralizing antibodies in the protein can provide effective resistance when animals are attacked by rabies virulent virus. When the virus working solution is at 30 - 300 TCID 50 / 50 μL, the detection result of 1 IU is close to 1 IU, and when the BHK-21 cells and DMEM medium used are free of virus contamination, the neutralization titer of the serum to be tested can be regarded as valid, otherwise, the test should be repeated. TCID 50 The calculation formula of is: lgTCID 50 = L + D(S - 0.5), where L is the logarithm of the lowest dilution of the serum, D is the dilution factor, and S is the sum of the protection ratios.

[0103] To evaluate the effect of recombinant nanobody in neutralizing the virus, referring to the FAVN experimental method, the determination of the neutralization titer was carried out. Four replicates were performed for each dilution of the antibody, and the neutralization titer of the recombinant nanobody was calculated through the results of direct immunofluorescence (Table 1).

[0104] Table 1 Determination of the neutralization titer of recombinant nanobody

[0105] Name of recombinant nanobody Neutralization titer (IU / μg) 213E6-P17-T7 1.37 213E6-P17-PepH3 1.35 213E6-P17-An2 0.80 213E6-P17-RVG29 0.68 213E6-P17-TAT 0.47

[0106] 2. Detection of the penetration of recombinant nanobody fusion protein through the blood-brain barrier by intravenous injection

[0107] (1) Five-week-old SPF Kunming female mice (purchased from Zhuhai Besttone Biotechnology Co., Ltd.) were used, with 3 mice in each group. Each mouse was intravenously injected with 200 μg of the purified recombinant nanobody fusion protein from Example 1 through the tail vein. The mice were subjected to cardiac perfusion at 4 h, 8 h, and 24 h after injection. 10% (w / v) chloral hydrate prepared was used as an anesthetic, and 100 μL was intraperitoneally injected. After the mice were under general anesthesia, the heart of the mice was exposed using sterile scissors and forceps, the right auricle was cut open, a sterile injection needle was inserted into the left ventricle, a syringe was connected to the injection needle, and PBS was slowly perfused. At this time, the blood would slowly flow out until the outflowing liquid became clear, the liver changed from dark red to grayish white, and the color of the limbs and tail of the mice changed from light red to colorless, then the perfusion could be stopped.

[0108] (2) Use sterile scissors and forceps to take out half of the mouse brain and place it in a 2 mL EP tube. Load the grinding rod into the grinder and grind the mouse brain thoroughly on ice. Pipette 1 mL of pre-prepared RIPA protein lysis buffer (Shanghai Yaen Biopharmaceutical Co., Ltd., product number: PC101) containing 1% protease inhibitor (Shanghai Yaen Biopharmaceutical Co., Ltd., product number: GRF101) by mass percentage into the well-ground mouse brain. Use a pipette to mix the mouse brain and RIPA protein lysis buffer thoroughly and then place it on ice for 30 min; centrifuge at 12,000 r / min for 10 min in a 4 °C centrifuge; after centrifugation, transfer the supernatant to a new 1.5 mL EP tube, aliquot, and store at -80 °C.

[0109] (3) When in use, quantify the supernatant of the brain tissue using a BCA protein quantification kit, dilute it to a concentration of 2 mg / mL with PBS, add reducing protein loading buffer, boil in a metal bath at 100 °C for 10 min, and store at -20 °C. Subsequently, Western blot verification can be performed.

[0110] Since all 5 recombinant proteins carry His tags, use the HRP-labeled anti-6×His antibody (Wuhan Sanying Biotechnology Co., Ltd.) as the primary antibody for Western blot detection. As Figure 3 The results showed that 4 h after intravenous injection of the recombinant nanobody fusion protein, all 5 recombinant nanobodies could be detected in the mouse brain, and gradually increased within 8 h, and degraded to a lower level after 24 h. This indicates that all 5 recombinant nanobody fusion proteins can effectively penetrate the BBB and enter the brain through tail vein injection. The protein content in the brain first gradually increases over time and then gradually decreases within 24 h.

[0111] 3. In vitro neutralization and protection assay of recombinant nanobodies at the mouse level

[0112] Use 5-week-old female KM mice (purchased from Zhuhai BestBio Technology Co., Ltd.) as the research object. At the mouse level, explore the neutralizing effect of the induced recombinant nanobodies on rabies virus. The specific method is as follows: Divide the mice into 7 groups (6 mice in each group), namely the virus challenge control group, experimental groups (213E6-P17-T7, 213E6-P17-PepH3, 213E6-P17-An2, 213E6-P17-RVG29, 213E6-P17-TAT), and the human rabies immunoglobulin (HRIG, purchased from Hualan Biological Engineering Inc.) group. Mix 10 IU of the recombinant nanobody, HRIG with CVS-11 (2×10 5Mix well with FFU), neutralize and incubate at room temperature for 1 h. Inject the incubated recombinant nanobody and virus mixture intramuscularly into each group of mice. The challenge control group was injected intramuscularly with rabies virus solution. Observe the mental state and morbidity of the mice every day and record their body weights.

[0113] The results showed ( Figure 4 ), all the mice in the challenge control group became ill and died, and no mice in all the recombinant nanobody groups and the HRIG group showed morbidity, and the survival rate reached 100%. From the perspective of the body weight change rate, after the 9th day, except for the challenge group, the body weights of the mice in the experimental groups also gradually showed an upward trend. Thus, it can be shown that the 5 recombinant nanobody fusion proteins can effectively neutralize the rabies virus CVS-11 in vitro, thereby protecting the infected mice by 100%.

[0114] 4. Passive immunization effect of recombinant nanobody fusion protein

[0115] To investigate the passive immunotherapy effect of the five induced proteins on infected mice and whether the fusion cell-penetrating peptide can improve the passive immunization effect of nanobodies, 5-week-old KM mice were divided into 8 groups with 8 mice in each group. Among them, 7 groups were experimental groups: 213E6-P17-T7 group, 213E6-P17-PepH3 group, 213E6-P17-An2 group, 213E6-P17-RVG29 group, 213E6-P17-TAT group, 213E6-EGFP-P17 group (without fusion cell-penetrating peptide, based on RVG-hNb07-EGFP (the nucleotide sequence has been disclosed in CN118440190A), only P17 was introduced, and the specific preparation method was the same as in Example 1), HRIG group, and the other 1 group was the challenge control group. Use a hair clipper to shave the back hair of the mice, make wounds on the back with sterile needles. The number, shape and range of the holes on the back of each mouse are the same. Apply 200 μL of CVS-11 (2×10 5 FFU) to the back wound of each mouse. 1 h after the wound was infected with the virus, infiltrate and inject 100 IU of the 5 recombinant nanobody fusion proteins, the non-fusion cell-penetrating peptide nanobody 213E6-EGFP-P17 and HRIG at the infected wound of the mice, and observe and record the body weights and mental states of the mice every day.

[0116] As Figure 5As shown, the mice in the negative group were normal and none of them died from the disease. In the challenge control group, mice started to die on the 11th day, and the survival rate was 37.5%. In the experimental group, one mouse in the 213E6-P17-TAT group died from the disease on the 7th day, and one mouse in the 213E6-P17-PepH3 group died on the 12th day. The survival rate of both groups was 87.5%. Compared with the challenge control group, the survival rates of both groups were increased to a certain extent, and the time of death in the 213E6-P17-PepH3 group was delayed. The survival rates of mice in the 213E6-P17-T7 group, 213E6-P17-An2 group, 213E6-P17-RVG29 group and HRIG group all reached 100%. In the 213E6-EGFP-P17 group without the fused penetratin, one mouse died from the disease on the 12th day and one on the 13th day, and the survival rate was 75%. As Figure 5 shown, except for the negative group, the body weights of mice in the experimental groups decreased slightly in the first two days, which might be due to the acupuncture wounds. The body weights of mice in the challenge group showed a downward trend in the first 10 days, and the degree of change was large. The body weights of mice in the experimental groups and the positive group showed a downward trend in the first 6 days, but it was relatively gentle, and then showed an upward trend. The experimental results proved that the fusion of cell-penetrating peptides could effectively improve the passive immunization effect of recombinant nanobodies, and the best effects were observed in the 213E6-P17-T7, 213E6-P17-An2 and 213E6-P17-RVG29 groups.

[0117] 5. Therapeutic effect of recombinant nanobody fusion protein by tail vein injection on infected mice

[0118] Using 5-week-old female KM mice as the research subjects, the therapeutic effects of five induced-expressed proteins on infected mice and whether the fused cell-penetrating peptides could better cross the barrier to achieve the therapeutic effect were explored. The experimental groups were set as follows: 213E6-P17-T7 group, 213E6-P17-PepH3 group, 213E6-P17-An2 group, 213E6-P17-RVG29 group, 213E6-P17-TAT group, 213E6-EGFP-P17 group (without fused cell-penetrating peptide), HRIG group, challenge control group and negative control group. This experiment was divided into 26 groups, with 8 mice in each group. Except for the negative control group, all mice in each group were intramuscularly injected with 2×10 5 FFU of CVS-11. The experimental groups were intravenously injected with 100 IU of recombinant nanobody fusion protein or HRIG into the tail veins of mice on the 3rd, 4th, 5th and 6th days respectively, and the body weight changes of mice were recorded daily and the status of mice was observed.

[0119] (1) Therapeutic effect on the 3rd day after infection

[0120] Intravenous drug treatment was performed on the 3rd day after infection. The results were as Figure 6As shown in the figure, in the 213E6-P17-T7 group, 1 mouse became ill and died on the 12th and 15th days after virus challenge, and the survival rate reached 75%; in the 213E6-P17-PepH3 group, 1 mouse became ill and died on the 14th, 15th, and 19th days respectively, and the survival rate reached 62.5%; in the 213E6-P17-An2 group, 2 mice became ill and died on the 13th day and 3 mice on the 14th day, and the survival rate was 37.5%; in the 213E6-P17-RVG29 group, 1 mouse became ill and died on the 14th day, and the survival rate reached 87.5%; in the 213E6-P17-TAT group, 1 mouse became ill and died on the 10th day, 1 on the 12th day, 3 on the 14th day, 1 on the 15th day and 1 on the 18th day, and the final survival rate was only 12.5%; in the HRIG group, 1 mouse became ill and died on the 11th, 13th, 14th, and 21st days respectively, and the survival rate was 50%; in the 213E6-EGFP-P17 group, 2, 1, 2, 2, and 1 mice became ill and died on the 10th, 11th, 13th, 15th, and 16th days respectively, and the final survival rate was 0; in the virus challenge control group, 1 mouse became ill and died on the 9th day, 2 on the 10th and 11th days respectively, and 1 on the 12th, 13th, and 14th days respectively, and the final survival rate was 0. Compared with the virus challenge control group, except for the 213E6-EGFP-P17 group, the recombinant nanobody fusion proteins and HRIG in the experimental groups all had certain therapeutic effects on the infected mice. Among them, the therapeutic effects of the 213E6-P17-T7, 213E6-P17-PepH3, and 213E6-P17-RVG29 recombinant proteins were better than that of HRIG, and the therapeutic effect of the 213E6-P17-TAT group was relatively poor. The survival rate of 213E6-EGFP-P17 was 0, but judging from the illness and death of the mice, it delayed the illness and death time of the infected mice to a certain extent. From the perspective of body weight changes, except for the negative group, all virus challenge groups showed a continuous downward trend in body weight from the 3rd to the 13th day. Among them, the body weight of the 213E6-P17-T7 group and the 213E6-P17-RVG29 group decreased relatively slowly and then gradually increased. The virus challenge control group and the 213E6-EGFP-P17 group showed a downward trend after 3 days, and the degree of body weight loss was relatively large.

[0121] From the above results, it can be concluded that the 5 recombinant nanobody fusion proteins had certain therapeutic effects on the infected mice, and the therapeutic effects of 3 groups of proteins (213E6-P17-T7, 213E6-P17-PepH3, 213E6-P17-RVG29) were better than that of HRIG to a certain extent. After fusing with cell-penetrating peptides, the therapeutic effect of the nanobody on the infected mice was improved to a certain extent. According to the illness and death of the mice in the virus challenge group and the experimental groups, it can also be seen that the recombinant nanobody fusion proteins delayed the illness and death time of the infected mice to a certain extent.

[0122] (2) Therapeutic effect on the 4th day after infection

[0123] Intravenous administration treatment was carried out on the 4th day after infection, and the results were as Figure 7 shown. In the 213E6-P17-PepH3 group, 1, 1, and 2 mice died of the disease on the 11th, 12th, and 13th days respectively, and the survival rate was 50%; in the 213E6-P17-An2 group, 1 mouse died of the disease on the 7th day and 2 mice died of the disease on the 11th day, and the survival rate reached 62.5%; in the 213E6-P17-RVG29 group, 1, 1, 1, and 2 mice died of the disease on the 11th, 12th, 13th, and 14th days respectively, and the final survival rate was 37.5%; in the 213E6-P17-T7 group, 1, 2, 1, 1, and 1 mice died of the disease on the 10th, 11th, 13th, 14th, and 15th days respectively, and the survival rate was 25%; in the 213E6-P17-TAT group, 1, 4, and 2 mice died of the disease on the 10th, 12th, and 13th days respectively, and the survival rate was 12.5%; in the HRIG group, 2, 1, and 1 mice died of the disease on the 13th, 14th, and 22nd days respectively, and the survival rate was 50%. Compared with the virus challenge group, all experimental groups had certain therapeutic effects. Among them, the therapeutic effect of 213E6-P17-An2 was the best, with a survival rate of 62.5%, which was higher than that of the HRIG group. The therapeutic effect of the 213E6-P17-PepH3 group was equivalent to that of the HRIG group, with a survival rate of 50%. The 213E6-P17-T7 and 213E6-P17-RVG29 groups had certain therapeutic effects compared with the virus challenge control group, but compared with the 3rd day, the survival rate decreased. The therapeutic effect of the 213E6-P17-TAT group was poor. Since 213E6-EGFP-P17 had no therapeutic effect on the 3rd day after infection, no treatment test was carried out after the 4th day. According to the body weight change, except for the negative group and the 213E6-P17-An2 group, the body weights of other groups showed a downward trend from the 4th day to the 12th day. However, compared with the virus challenge control group, the downward trend of the experimental groups was relatively slow, and after the 13th day, the body weights of the mice gradually recovered. The body weight decline period of the 213E6-P17-An2 group of mice was shorter, relatively gentle, and the body weight increased faster.

[0124] The above results indicate that when the 5 groups of recombinant nanobody fusion proteins were used to treat infected mice on the 4th day, there were still certain therapeutic effects. Moreover, the therapeutic effect of the 213E6-P17-An2 group was better than that of the HRIG group, and the therapeutic effect of the 213E6-P17-PepH3 group was equivalent to that of the HRIG group.

[0125] (3) Therapeutic effect on the 5th day after infection

[0126] Treatment was carried out on the 5th day after infection, and the results were as Figure 8As shown in the figure, in the 213E6-P17-T7 group, 3, 2, and 2 mice died of the disease on the 12th, 13th, and 15th days respectively, and the survival rate was 12.5%; in the 213E6-P17-PepH3 group, 1, 1, 2, and 1 mice developed the disease on the 14th, 15th, 16th, and 17th days respectively, and the survival rate was 37.5%; in the 213E6-P17-An2 group, 1, 1, 1, and 1 mice died of the disease on the 14th, 15th, 16th, and 17th days respectively, and the survival rate was 50%; in the 213E6-P17-RVG29 group, 1, 1, 1, 2, and 1 mice died of the disease on the 12th, 14th, 15th, 16th, and 17th days respectively, and the survival rate was 25%; in the 213E6-P17-TAT group, 1, 1, 2, 1, and 1 mice died of the disease on the 12th, 13th, 15th, 16th, and 18th days respectively, and the survival rate was 25%; in the HRIG group, 1, 1, 1, and 2 mice died of the disease on the 12th, 13th, 14th, and 15th days respectively, and the survival rate was 37.5%. One mouse in each of the 213E6-P17-T7 group, 213E6-P17-An2 group, 213E6-P17-RVG29 group, 213E6-P17-TAT group and HRIG group showed symptoms of the disease and weight loss, but did not die until the 30th day of observation, and the weight was also slowly increasing. To sum up, the therapeutic effect of 213E6-P17-An2 was the best (50%), better than HRIG, and the survival rates of 213E6-P17-PepH3 and HRIG were equivalent, both at 37.5%. The survival rates of the 213E6-P17-RVG29 group and the 213E6-P17-TAT group were relatively reduced, both at 25%.

[0127] The changes in the body weight of the treated mice on the 5th day are as Figure 8 shown. Except for the negative group, the body weights of the mice in other groups showed a downward trend from the 3rd day to the 13th day. Among them, the downward trend of the virus-challenged control group was more obvious. Compared with the virus-challenged group, the downward trend of the experimental group was relatively gentle. Among them, the body weight decline of the 213E6-P17-An2 and 213E6-P17-PepH3 groups was the gentlest. And except for the virus-challenged control group, the body weights of the mice in other groups gradually showed an upward trend on the 13th day.

[0128] From the above results, it can be seen that when the 5 recombinant nanobody fusion proteins were used to treat mice on the 5th day, there was still a certain therapeutic effect, and to a certain extent, it also delayed the time of mouse morbidity and death. Some mice in the experimental group showed symptoms of the disease and weight loss, but no mice died during the observation period, and the weight slowly increased after stabilization, indicating that after treatment with the injected protein, although symptoms appeared, a certain amount of antibodies were produced in the body to block and neutralize the virus.

[0129] (4) Therapeutic effect on the 6th day after infection

[0130] The treatment results on the 6th day after infection are as Figure 9 shown. In the 213E6-P17-T7 group, 3, 3, and 2 mice died of the disease on the 12th, 13th, and 15th days respectively, and the survival rate was 0; in the 213E6-P17-PepH3 group, 1, 2, 2, and 1 mouse died of the disease on the 12th, 13th, 14th, and 15th days respectively, and the survival rate was 25%; in the 213E6-P17-An2 group, 1, 1, 2, 1, 1, and 1 mouse died of the disease on the 9th, 12th, 13th, 14th, 15th, and 16th days respectively, and the survival rate was 12.5%; in the 213E6-P17-RVG29 group, 1, 3, 2, and 1 mouse died of the disease on the 11th, 13th, 14th, and 15th days respectively, and the survival rate was 12.5%; in the 213E6-P17-TAT group, 1, 1, 3, 1, and 1 mouse died of the disease on the 10th, 11th, 12th, 13th, and 16th days respectively, and the survival rate was 12.5%; in the HRIG group, 1, 4, 2, and 1 mouse died of the disease on the 12th, 13th, 14th, and 15th days respectively, and the survival rate was 0. Among them, one mouse in each of the 213E6-P17-PepH3 group and the 213E6-P17-TAT group showed symptoms of the disease and weight loss, but did not die when observed until the 30th day, and the weight was also slowly increasing. According to the results, when treating the infected mice on the 6th day, the treatment effect of 213E6-P17-PepH3 was the best, and the survival rate was still 25%. The 213E6-P17-An2, 213E6-P17-RVG29, and 213E6-P17-TAT groups had a slight treatment effect, and the survival rates were all 12.5%. HRIG and 213E6-P17-T7 had no treatment effect at all, and the survival rate was 0. The weight changes of the infected mice treated on the 6th day are as Figure 9 shown. Except for the negative group, the body weights of the mice in other groups showed a downward trend from the 3rd day to the 11th day. Among them, the degree of decrease in the challenge control group was more obvious. Although the survival rate of 213E6-P17-T7 was 0, the downward trend of the body weight of the mice was smaller than that of the challenge control group. The body weights of the mice in the 213E6-P17-PepH3, 213E6-P17-An2, and 213E6-P17-RVG29 groups gradually increased after the 14th day.

[0131] Based on the disease onset and death conditions, time, and weight change rate of the mice, it can be seen that the treatment effect on the infected mice on the 6th day is worse than that on the 3rd, 4th, and 5th days. However, 213E6-P17-PepH3, 213E6-P17-An2, 213E6-P17-RVG29, and 213E6-P17-TAT still have a slight treatment effect, and are better than HRIG, and to a certain extent, also delay the disease onset and death time of the infected mice.

[0132] Table 2 Survival rates of mice after treatment with recombinant nanobodies by tail vein injection after infection

[0133]

[0134] Note: "-" indicates not measured.

[0135] In summary, as shown in Table 2, on the 3rd, 4th, 5th, and 6th days, recombinant nanobodies were injected into the tail veins of infected mice for treatment. All the mice in the challenge control group developed the disease and died, while there was a certain therapeutic effect in the treatment groups.

[0136] The therapeutic effect of 213E6-P17-T7 was the best on the 3rd day, but the therapeutic effect deteriorated with the delay of the treatment time, and the effect was unstable. The survival rate decreased significantly on the 4th day of treatment.

[0137] Although the survival rate of 213E6-P17-PepH3 on the 3rd day of treatment was lower than that of 213E6-P17-T7, with the delay of the treatment time, the therapeutic effect of the PepH3 group was relatively stable, and the therapeutic effects on the 3rd and 6th days were better than those of HRIG, and the therapeutic effects on the 4th and 5th days were the same as those of HRIG.

[0138] There may be factors such as errors in the 213E6-P17-An2 group during the treatment on the 3rd day, resulting in a low survival rate. However, on the 4th and 5th days, it had better therapeutic effects compared with other recombinant proteins, and the therapeutic effect was also better than that of HRIG.

[0139] The therapeutic effect of 213E6-P17-RVG29 was the best on the 3rd day, and the survival rate was relatively high. The therapeutic effects of both the 213E6-P17-RVG29 group and the PepH3 group were relatively stable, and the overall therapeutic effect was slightly better than that of HRIG.

[0140] Compared with other groups, the therapeutic effect of TAT in the 213E6-P17-TAT group was relatively poor. However, compared with the challenge control group, and analyzed from the death and disease onset conditions and the weight change rate, the 213E6-P17-TAT treatment group also delayed the onset and death time of infected mice to a certain extent, which had a certain therapeutic significance.

[0141] The therapeutic effects of 213E6-P17-PepH3 and 213E6-P17-RVG29 were relatively stable. The overall therapeutic effects of 213E6-P17-PepH3, 213E6-P17-An2, and 213E6-P17-RVG29 were better than that of HRIG. 213E6-P17-T7 had a certain therapeutic effect on infected mice on the 3rd and 4th days. The survival rate of the 213E6-EGFP-P17 group was 0 when treated on the 3rd day, which indicated that the nanobody fusion cell-penetrating peptide was helpful for the nanobody to penetrate the cell membrane, cross the barrier, reach the infection site, and achieve the therapeutic effect.

[0142] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A recombinant rabies virus nanobody that combines a solubilizing short peptide and a cell-penetrating peptide, characterized in that Comprising a humanized rabies virus nanobody, with a solubilization-promoting tag peptide P17 and a cell-penetrating peptide fused to its C-terminus; The cell-penetrating peptide is preferably at least one of T7, An2, PepH3, RVG29, and TAT; The amino acid sequence of the recombinant rabies virus nanobody fused with the solubilization-promoting short peptide and the cell-penetrating peptide is shown as at least one of SEQ ID No.1-5.

2. The recombinant rabies virus nanobody according to claim 1, wherein: The nucleotide sequence of the gene encoding the recombinant rabies virus nanobody fused with the solubilization-promoting short peptide and the cell-penetrating peptide is shown as at least one of SEQ ID No.6-10.

3. Use of the recombinant rabies virus nanobody fused with the solubilization-promoting short peptide and the cell-penetrating peptide according to claim 1 or 2 in the preparation of rabies prevention and treatment and / or passive immunization products.

4. A recombinant expression vector, characterized in that The recombinant vector contains the gene encoding the recombinant rabies virus nanobody fused with the solubilization-promoting short peptide and the cell-penetrating peptide as described in claim 2.

5. The recombinant expression vector according to claim 4, wherein: The expression vector is pET28a.

6. A biomaterial expressing a recombinant rabies virus nanobody that fuses a solubility-enhancing short peptide and a cell-penetrating peptide, characterized in that It is obtained by transferring the recombinant vector as described in claim 4 or 5 into an expression system.

7. The biological material according to claim 6, wherein: The expression system is bacteria or fungi; the bacteria is Escherichia coli SHuffle T7.

8. Use of the recombinant vector according to claim 4 or 5, and the biological material according to claim 6 or 7 in the preparation of rabies prevention and treatment and / or passive immunization products.

9. The preparation method of the recombinant rabies virus nanobody integrating the fusion solubilizing peptide and the cell-penetrating peptide according to claim 1 or 2, characterized in that Comprising the following steps: Inducing the expression and purifying the biological material expressing the recombinant rabies virus nanobody fused with the solubilization-promoting short peptide and the cell-penetrating peptide as described in claim 6 or 7 to obtain a humanized recombinant rabies virus nanobody.

10. The preparation method of the recombinant rabies virus nanobody integrating a fusion lysis-promoting short peptide and a cell-penetrating peptide, characterized in that Comprising the following steps: (1) Transferring the recombinant expression vector as described in claim 4 or 5 into SHuffle T7 competent cells to obtain a strain expressing the recombinant rabies virus nanobody fused with the solubilization-promoting short peptide and the cell-penetrating peptide; (2) Expand the strain obtained in step (1) until the OD 600 reaches 0.6 - 0.7, then add IPTG to induce expression; (3) Centrifuging and resuspending the bacterial liquid after induced expression in step (2), then sonicating and centrifuging, and filtering the supernatant; (4) Purifying the supernatant filtered in step (3) by nickel ion resin affinity chromatography to obtain the recombinant rabies virus nanobody fused with the solubilization-promoting short peptide and the cell-penetrating peptide.

Images