Bifunctional fusion proteins targeting ccr5 and gp41 and their use in the preparation of a medicament against human immunodeficiency virus

Abstract

The present application relates to a bifunctional fusion protein targeting CCR5 and gp41 and its application in the preparation of anti-human immunodeficiency virus drugs, and belongs to the technical field of biological medicine. The present application provides a bifunctional fusion protein targeting CCR5 and gp41, wherein the bifunctional fusion protein comprises: a fusion protein obtained by connecting a polypeptide 2P23 to the N terminus and / or C terminus of the light chain and / or heavy chain of an antibody PRO 140 or a PRO 140 mutant through a connecting peptide; or a fusion protein obtained by connecting a tag to the N terminus and / or C terminus of the above-mentioned fusion protein. The novel bifunctional fusion protein constructed in the present application not only overcomes the limitation that the original PRO 140 antibody is invalid for CXCR4 tropic strains, but also significantly improves the inhibitory activity and broad spectrum for CCR5 tropic strains, and has a higher drug resistance barrier.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a bifunctional fusion protein targeting CCR5 and gp41 and its application in the preparation of drugs against human immunodeficiency virus. Background Technology

[0002] Acquired Immune Deficiency Syndrome (AIDS), caused by persistent infection with the Human Immunodeficiency Virus (HIV), is an infectious disease that seriously threatens human health and social stability. Data from UNAIDS shows that more than 88 million people worldwide are living with HIV, and about half of them die from AIDS-related illnesses. Despite active international efforts, there is still no effective vaccine or cure for the infection. Current clinical treatment mainly relies on highly active antiretroviral therapy (HAART), which combines multiple drugs. However, this therapy cannot eliminate the viral reservoir; once treatment is stopped, the virus quickly rebounds in the patient's body. Furthermore, drug resistance, adverse reactions, and exorbitant treatment costs from long-term medication place a heavy burden on patients and nations. Therefore, achieving a cure or functional cure for AIDS remains a significant challenge and difficulty.

[0003] HIV infection of target cells is a complex, multi-step process, primarily involving the binding of gp120 to the target cell receptor CD4 and then to co-receptors CCR5 or CXCR4. Subsequently, gp41 initiates the fusion of the viral membrane with the cell membrane, completing the viral entry into the host cell. Entry is the first step in viral infection and a crucial step in attempts to inhibit viral replication. HIV entry inhibitors can block viral entry into host cells at an early stage, essentially "keeping the enemy out of the country." From the perspective of preventing reinfection by progeny viruses, HIV entry inhibitors can reduce or interfere with the establishment and maintenance of the viral reservoir. However, the mechanisms of action of existing antiretroviral drugs mainly target enzymes with different functions during viral replication, including nucleoside / non-nucleoside / non-nucleoside / reverse transcriptase inhibitors, integrase strand transfer inhibitors (INSTs), and protease inhibitors (PIs). Currently, only five HIV inhibitors are marketed globally, including the CD4 adhesion inhibitor ibalizimab, the CCR5 receptor chemokine inhibitor maraviroc, the viral envelope glycoprotein gp120 inhibitor fostemsavirr, and the fusion inhibitors enfuvirtide and albuvirtide targeting the gp41 fusion protein. To date, numerous cured HIV patients worldwide have been reported, all through stem cell transplantation carrying one or two CCR5 / Δ32 mutant genes. While this revolutionary technology can cure or functionally cure some HIV patients, its widespread clinical application is limited due to the extreme scarcity of donors and safety concerns. The success of this technology demonstrates that CCR5 is a key therapeutic target. Despite the tremendous efforts researchers have made over the past few decades, maraviroc remains the only clinically approved anti-HIV drug targeting CCR5. Currently, much work is focused on developing anti-CCR5 monoclonal antibodies, such as PRO 140 (Leronlimab), HGS004, and RoAb13. PRO 140 is a humanized monoclonal antibody that binds to CCR5 without affecting its downstream signaling pathways. PRO 140 was granted Fast Track designation by the U.S. Food and Drug Administration (FDA) in 2006 for clinical development, and its antiretroviral activity has been evaluated in multiple clinical studies, but development has not yet been successful. Like other approved HIV entry inhibitors, PRO 140 also suffers from issues such as drug resistance and / or viral strain selectivity; it only inhibits CCR5-tropic HIV-1 strains and is ineffective against CXCR4-tropic HIV-1 strains.

[0004] AIDS is primarily caused by HIV, which is further divided into two types: HIV-1 and HIV-2. HIV-1 is more prevalent, highly infectious, and widely distributed, accounting for 95% of infections. HIV-2 is mainly distributed in Africa, showing a localized epidemic trend. HIV-1 is highly variable, having evolved into many subtypes and recombinant viruses. Among them, HIV-1 subtypes A, B, and C are the main viruses causing the global AIDS epidemic, while in China, A / E and B / C recombinant viruses are the predominant types. In recent years, significant progress has been made in the systematic study of the three-dimensional structure analysis of HIV-1 envelope glycoproteins and host cell surface molecules, as well as their molecular interaction mechanisms. Simultaneously, innovative strategies for targeted modification of membrane fusion functional domains guided by structural bioinformatics have been continuously developed. These breakthroughs have laid the theoretical foundation and technological reserves for developing highly effective candidate drugs targeting the viral invasion stage. The inventors' team is dedicated to developing potent HIV fusion inhibitors, having designed inhibitors based on the MT hook structure, including CP32M, MT-SC23, HP23, MT-C34, MT-T2635, and 2P23, as well as lipopeptide-based inhibitors such as LP-11, LP-19, LP-40, LP-46, LP-51, LP-52, LP-80, LP-83, LP-97, and LP-98. Among these, 2P23 is a short polypeptide containing only 23 amino acid residues, possessing extremely strong target sequence binding ability and a higher genetic resistance barrier, effectively inhibiting HIV-1, HIV-2, SIV, and T20 resistant viral strains. Its lipopeptide derivative, LP-19, exhibits strong antiviral activity both in vitro and in vivo.

[0005] Due to the high mutation rate of HIV, bispecific or multispecific inhibitors targeting different HIV entry points have been widely developed to enhance the broad-spectrum effectiveness of anti-HIV drugs. Based on this strategy, the inventors previously linked peptide 2P23 with the ibalizimbab single-chain antibody to construct the bifunctional inhibitor 2P23-iMab, which simultaneously targets the viral gp41 and cellular CD4 receptor; and linked peptide 2P23 with the PRO 140 single-chain antibody to construct the bifunctional inhibitors 2P23-PRO140 and 2P23-PRO140-Fc, which simultaneously target the viral gp41 and cellular CCR5 co-receptor. These bifunctional inhibitors based on single-chain antibodies exhibit superior biological activity compared to single-target inhibitors, but suffer from severe deficiencies in in vivo stability and low drugability. This invention aims to create a bifunctional HIV inhibitor with both high activity and high stability. Summary of the Invention

[0006] To address the shortcomings of existing technologies and to solve problems such as drug resistance, viral strain selectivity, and low in vivo stability of current HIV entry inhibitors, this invention aims to design a bifunctional fusion protein that can simultaneously target CCR5 and gp41. The novel bifunctional fusion protein provided by this invention is designed to target the mechanism of HIV invasion of target cells and possesses potent and broad-spectrum antiviral activity.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] On one hand, the present invention provides a bifunctional fusion protein that simultaneously targets CCR5 and gp41, the bifunctional fusion protein comprising:

[0009] (1) A fusion protein obtained by linking polypeptide 2P23 to the N-terminus and / or C-terminus of the light chain and / or heavy chain of antibody PRO 140 or PRO 140 mutant via a linker peptide;

[0010] Or (2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the fusion protein in (1) above.

[0011] The bifunctional fusion protein that simultaneously targets CCR5 and gp41, wherein the amino acid sequence of the polypeptide 2P23 is shown in SEQ ID NO.1;

[0012] The HIV monoclonal antibody PRO 140 comprises four polypeptide chains (two light chains and two heavy chains) linked by disulfide bonds, and the amino acid sequence of the light chain of antibody PRO 140 is shown in SEQ ID NO.3;

[0013] The amino acid sequence of the antibody PRO 140 heavy chain is shown in SEQ ID NO.5.

[0014] The aforementioned bifunctional fusion protein simultaneously targets CCR5 and gp41, wherein the amino acid sequence of the linker peptide is (GGGGS). n , where n represents the number of repetitions of GGGGS, and n can be 1, 2, 3, 4, 5 or 6.

[0015] The aforementioned bifunctional fusion protein simultaneously targeting CCR5 and gp41, wherein the PRO 140 mutant comprises four polypeptide chains linked by disulfide bonds (two light chains and two heavy chains containing M428L and N434S mutations), and the PRO 140 mutant is obtained by generating M428L and N434S mutations in the Fc segment of the PRO 140 heavy chain.

[0016] The amino acid sequence of the light chain of the PRO 140 mutant is shown in SEQ ID NO.3;

[0017] The amino acid sequence of the heavy chain of the PRO 140 mutant is shown in SEQ ID NO.7.

[0018] The bifunctional fusion protein that simultaneously targets CCR5 and gp41 is described above. The tag is a His tag, and its amino acid sequence is shown in SEQ ID NO.11. Optionally, the tag can be located at the C-terminus or N-terminus of the light chain of the fusion protein in (1). The function of this tag is to facilitate the purification and detection of the fusion protein.

[0019] The bifunctional fusion protein that simultaneously targets CCR5 and gp41, wherein the signal peptide is an IgG3 signal peptide, the amino acid sequence of which is shown in SEQ ID NO.9; optionally, the signal peptide sequence is located at the N-terminus of the light chain and heavy chain of the fusion protein in (1) / (2);

[0020] Preferably, the above-mentioned bifunctional fusion protein is 2P23 linked to the N-terminus of the light chain of antibody PRO 140 or PRO 140 mutant via a linker peptide;

[0021] Example: The above-mentioned bifunctional fusion protein is 2P23-PRO140L, specifically, 2P23 is linked to the antibody via (GGGGS)3.

[0022] The N-terminus of the light chain in PRO 140;

[0023] Example: The above bifunctional fusion protein is m2P23-PRO140L, specifically, 2P23 is linked to the N-terminus of the light chain of the antibody PRO 140 mutant via (GGGGS)3;

[0024] Example: The above bifunctional fusion protein is 2P23-1-PRO140L, specifically, 2P23 is linked to the N-terminus of the light chain of antibody PRO 140 via (GGGGS)1;

[0025] Example: The above bifunctional fusion protein is 2P23-6-PRO140L, specifically, 2P23 is linked to the N-terminus of the light chain of antibody PRO 140 via (GGGGS)6;

[0026] Preferably, the above-mentioned bifunctional fusion protein is 2P23 linked to the N-terminus of the heavy chain of antibody PRO 140 or PRO 140 mutant via a linker peptide;

[0027] Example: The above bifunctional fusion protein is 2P23-PRO140H, specifically 2P23 is linked to the N-terminus of the heavy chain of antibody PRO 140 via (GGGGS)3.

[0028] Preferably, the above-mentioned bifunctional fusion protein is 2P23 linked to the N-terminus of the light chain and the N-terminus of the heavy chain of antibody PRO 140 or PRO140 mutant via linker peptides;

[0029] Example: The above bifunctional fusion protein is 2P23-PRO140HL, specifically 2P23 is linked to the N-terminus of the light chain and the N-terminus of the heavy chain of antibody PRO 140 via (GGGGS)3.

[0030] Preferably, the above-mentioned bifunctional fusion protein is 2P23 linked to the C-terminus of the light chain of antibody PRO 140 or PRO 140 mutant via a linker peptide;

[0031] Example: The above bifunctional fusion protein is PRO140L-2P23, specifically 2P23 is linked to the C-terminus of the light chain of antibody PRO 140 via (GGGGS)2;

[0032] Preferably, the above-mentioned bifunctional fusion protein is 2P23 linked to the C-terminus of the heavy chain of antibody PRO 140 or PRO 140 mutant via a linker peptide;

[0033] Example: The above bifunctional fusion protein is PRO140H-2P23, specifically 2P23 is linked to the C-terminus of the heavy chain of antibody PRO 140 via (GGGGS)2;

[0034] Preferably, the above-mentioned bifunctional fusion protein is 2P23 linked to the light chain C-terminus and heavy chain C-terminus of antibody PRO 140 or PRO140 mutant respectively via linker peptides;

[0035] Example: The above bifunctional fusion protein is PRO140HL-2P23, specifically, 2P23 is linked to the light chain C-terminus and heavy chain C-terminus of antibody PRO 140 via (GGGGS)2;

[0036] Example: The above bifunctional fusion protein is mPRO140HL-2P23, specifically, 2P23 is linked to the light chain C-terminus and heavy chain C-terminus of the antibody PRO 140 mutant via (GGGGS)2;

[0037] Preferably, the above-mentioned bifunctional fusion protein is 2P23 linked to the N-terminus of the light chain and the C-terminus of the heavy chain of antibody PRO 140 or PRO140 mutant via linker peptides.

[0038] Example: The above bifunctional fusion protein is 2P23-PRO140-2P23, specifically, 2P23 is linked to the N-terminus of the light chain of antibody PRO 140 via (GGGGS)3 and to the C-terminus of the heavy chain of antibody PRO 140 via (GGGGS)2.

[0039] In a second aspect, the present invention provides a nucleic acid molecule encoding the bifunctional fusion protein as described in any one of the claims. The nucleic acid molecule may be a DNA molecule or an RNA molecule, encoding the recombinant bifunctional fusion protein as described in the first aspect of the present invention, comprising the following elements: a 2P23 nucleic acid sequence, PRO 140 light and heavy chains or PRO 140 mutant light and heavy chain nucleic acid sequences, and a linker peptide nucleic acid sequence.

[0040] Preferably, the 2P23 nucleic acid sequence is the DNA sequence shown in SEQ ID NO.2, the PRO 140 light chain nucleic acid sequence is the DNA sequence shown in SEQ ID NO.4, the PRO 140 heavy chain nucleic acid sequence is the DNA sequence shown in SEQ ID NO.6, the PRO 140 mutant light chain nucleic acid sequence is the DNA sequence shown in SEQ ID NO.4, the PRO 140 mutant heavy chain nucleic acid sequence is the DNA sequence shown in SEQ ID NO.8, and the nucleic acid sequence of the linker peptide is (GGCGGAGGCGGAAGC). n n can take the value 1, 2, 3, 4, 5 or 6.

[0041] Thirdly, the present invention provides a recombinant expression vector comprising the aforementioned nucleic acid molecule.

[0042] Preferably, the vector may be a recombinant vector obtained by inserting a nucleic acid molecule encoding the fusion protein into a mammalian cell expression vector.

[0043] Fourthly, the present invention provides an engineered animal cell line containing the recombinant expression vector or the nucleic acid molecule integrated into the genome.

[0044] Fifthly, the present invention provides a pharmaceutical composition comprising any one of the bifunctional fusion proteins or derivatives thereof, and a pharmaceutically acceptable carrier or excipient;

[0045] Preferably, the pharmaceutical composition is a human immunodeficiency virus entry inhibitor.

[0046] In a sixth aspect, the present invention provides the use of any of the bifunctional fusion proteins, the nucleic acid molecules, the recombinant expression vectors, or the engineered animal cell lines in the preparation of functional products;

[0047] The functional product is used in a combination of one or more of the following:

[0048] a) Antiviral;

[0049] b) Prevention and / or treatment of diseases caused by viral infections;

[0050] c) Inhibit viral cell fusion;

[0051] d) Inhibit viral invasion of cells;

[0052] e) Inhibit viral replication;

[0053] Preferably, the virus includes, but is not limited to, HIV-1, HIV-2, or SIV;

[0054] Preferably, the diseases caused by the viral infection include, but are not limited to, AIDS.

[0055] Further details of this invention are described in detail below, or some may be reflected in the embodiments of this invention. Unless otherwise specified, the quantities of different components and reaction conditions used herein are to be interpreted as "approximate" or "about". Accordingly, unless otherwise specified, the numerical parameters referenced below and in the claims are approximate parameters, and different numerical parameters may be obtained under their respective experimental conditions due to different standard errors.

[0056] In practical applications, the drug of this invention can be administered directly to patients or mixed with a suitable carrier or excipient before administration to achieve the purpose of treating and / or preventing HIV infection. The carrier materials here include, but are not limited to, water-soluble carrier materials (such as polyethylene glycol, polyvinylpyrrolidone, organic acids, etc.), poorly soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), and enteric-coated carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose, etc.). Water-soluble carrier materials are preferred. Various dosage forms can be formulated using these materials, including but not limited to tablets, capsules, pellets, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, lozenges, suppositories, lyophilized powder injections, etc. These can be conventional formulations, sustained-release formulations, controlled-release formulations, and various microparticle delivery systems.

[0057] To formulate unit-dose dosage forms into tablets, a wide variety of carriers known in the art can be used. Examples of carriers include, for instance, diluents and absorbents such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, aluminum silicate, etc.; humectants and binders such as water, glycerin, polyethylene glycol, ethanol, propanol, starch paste, dextrin, syrup, honey, glucose solution, gum arabic paste, gelatin paste, sodium carboxymethyl cellulose, shellac, methyl cellulose, potassium phosphate, polyvinylpyrrolidone, etc.; and disintegrants. Examples of active ingredients include dried starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitol fatty acid esters, sodium lauryl sulfonate, methylcellulose, and ethylcellulose; disintegration inhibitors, such as sucrose, tristearate, cocoa butter, and hydrogenated oils; absorption enhancers, such as quaternary ammonium salts and sodium lauryl sulfate; and lubricants, such as talc, silica, corn starch, stearates, boric acid, liquid paraffin, and polyethylene glycol. Tablets can also be further formulated into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or bilayer and multilayer tablets.

[0058] To formulate unit-dose dosage forms into pills, a wide variety of carriers known in the art can be used. Examples of carriers include diluents and absorbents such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinylpyrrolidone, gelucire, kaolin, talc, etc.; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste, or flour paste, etc.; and disintegrants such as agar powder, dried starch, alginate, sodium dodecyl sulfate, methylcellulose, ethylcellulose, etc. To formulate unit-dose dosage forms into suppositories, a wide variety of carriers known in the art can be used. Examples of carriers include polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, semi-synthetic glycerides, etc. To formulate unit-dose dosage forms into injectable preparations, such as solutions, emulsions, lyophilized powders for injection, and suspensions, all diluents commonly used in the art can be used, such as water, ethanol, polyethylene glycol, 1,3-propanediol, ethoxylated isostearyl alcohol, polyoxyethylene isostearyl alcohol, polyoxyethylene sorbitan fatty acid esters, etc. Additionally, to prepare isotonic injections, appropriate amounts of sodium chloride, glucose, or glycerol can be added to the injectable formulation. Furthermore, conventional solubilizers, buffers, pH adjusters, etc., can also be added. Furthermore, if necessary, colorants, preservatives, flavorings, tasters, sweeteners, or other materials can be added to the pharmaceutical preparation. The above dosage forms can be administered via injection, including subcutaneous injection, intravenous injection, intramuscular injection, intraperitoneal injection, intracisional injection, or infusion; via cavities, such as rectal, vaginal, and sublingual; via the respiratory tract, such as nasal; and via mucosal administration. The preferred route of administration is injection, and the preferred route of administration is subcutaneous injection.

[0059] The dosage of the drug of the present invention depends on many factors, such as the nature and severity of the disease to be prevented or treated, the sex, age, weight and individual response of the patient or animal, the specific active ingredient used, the route of administration and the frequency of administration, etc. The above dosage can be administered in a single dose form or in several, such as two, three or four dose forms.

[0060] The drugs described in this invention can be used alone for the treatment and prevention of HIV infection, or in combination with one or more other antiviral drugs. They can be used simultaneously or intermittently to improve the overall treatment effect. These anti-HIV drugs include, but are not limited to, reverse transcriptase inhibitors, protease inhibitors, invasion inhibitors, integration inhibitors, viral capsid inhibitors, and maturation inhibitors. The aforementioned reverse transcriptase inhibitors can be nucleoside reverse transcriptase inhibitors, such as zidovudine (AZT), lamivudine (3TC), norinosine (ddI), zalcitabine (ddC), stavudine (d4T), tenofovir (TDF), abacavir (ABC), and emtricitabine (FTC), or non-nucleoside reverse transcriptase inhibitors, such as nevirapine (NVP), efavirenz (EFV), delavudine (DLV), and etravirine (ETR), or one or more thereof; the aforementioned protease inhibitors can be saquinavir (SQV-HGC), indinavir (IDV), ritonavir (RTV), arenavirvir (APV), kaletra (LPV / RTV), nelfinavir (NFV), fosanavir calcium (FPV), and reyataz. (ATV) and Prezista, etc., one or more; the above-mentioned integration inhibitors may be one or more of Raltegravir, Dolutegravir, and Elvitegravir, etc.; the above-mentioned invasion inhibitors may be Maraviroc, T-20, Fostexmavir, etc.

[0061] TAK-779, T2635, VIRIP (VIR-576), sifiviride, iboviride, soluble CD4 protein and its analogues, antibodies against the co-receptor CCR5 (such as PRO 140), monoclonal antibodies against gp120 / gp41 (such as VRC01 and 10E8), and monoclonal antibodies against receptor CD4 (such as UB-421 and TNX-355) are one or more of the above-mentioned viral capsid inhibitors, such as lenakapavir and VH4004280 (VH-280).

[0062] For any given patient, the specific effective therapeutic dose level must be determined based on a number of factors, including the disorder being treated and its severity; the activity of the specific active ingredient used; the specific composition used; the patient's age, weight, general health condition, sex, and diet; the timing, route of administration, and excretion rate of the specific active ingredient used; the duration of treatment; drugs used in combination with or concurrently with the specific active ingredient used; and similar factors known in the medical field. For example, it is practiced in the art to start the dose of the active ingredient below the level required to achieve the desired therapeutic effect and gradually increase the dose until the desired effect is achieved. Generally, the dosage of the drug of the present invention for mammals, particularly humans, can be between 0.001 and 1000 mg / kg body weight / day, for example, between 0.01 and 100 mg / kg body weight / day, or, for example, between 0.1 and 10 mg / kg body weight / day. The dosing frequency can be once a day, once every 2 days, once every 3 days, once every 4 days, once every 5 days, once every 6 days, once every 7 days, or once every 14 days, with once a week or once every 2 weeks being preferred.

[0063] Compared with the prior art, the present invention has the following beneficial effects:

[0064] 1. This invention creatively links the short peptide 2P23 to the N-terminus and / or C-terminus of the light and / or heavy chains of HIV monoclonal antibody PRO 140 or a PRO 140 mutant, obtaining a novel bifunctional fusion protein that can simultaneously target the CCR5 co-receptor in the HIV entry process and the viral fusion protein gp41. Compared to the monomeric molecules PRO 140 and 2P23, the novel bifunctional fusion protein constructed in this invention not only overcomes the limitation of the PRO 140 prototype antibody being ineffective against CXCR4-tropy strains, but also significantly improves the inhibitory activity and broad-spectrum activity against CCR5-tropy strains, while also exhibiting a higher drug resistance barrier.

[0065] 2. More importantly, compared with the 2P23-PRO140-Fc (a fusion protein obtained by linking single-chain antibodies of short peptides 2P23 and PRO140 and IgG4-Fc mutant peptides) previously developed by the inventors' team, the novel bifunctional fusion protein of this invention has significantly improved in vivo antiviral activity and in vivo stability, showing broad development prospects. Attached Figure Description

[0066] Figure 1The diagrams show design patterns for bifunctional fusion proteins with different configurations. A represents fusion proteins 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL, obtained by linking 2P23 to the N-terminus of the light chain of antibody PRO 140 via (GGGGS)3; 2P23-PRO140H, obtained by linking 2P23 to the N-terminus of both the light and heavy chains of antibody PRO 140 via (GGGGS)3; and 2P23-PRO140HL, obtained by linking 2P23 to both the N-terminus of the light and heavy chains of antibody PRO 140 via (GGGGS)3. B represents fusion proteins 2P23-0-PRO140L, 2P23-1-PRO140L, and 2P23-1-PRO140L, obtained by linking 2P23 to the N-terminus of the light chain of antibody PRO 140 via (GGGGS)0; and 2P23-PRO140HL, obtained by linking 2P23 to the N-terminus of the light chain of antibody PRO 140 via (GGGGS)1. The fusion protein 2P23-6-PRO140L obtained from the N-terminus of the light chain of antibody PRO 140, C is the fusion protein PRO140L-2P23 obtained by linking 2P23 to the C-terminus of the light chain of antibody PRO 140 via (GGGGS)2, the fusion protein PRO140H-2P23 obtained by linking 2P23 to the C-terminus of the heavy chain of antibody PRO 140 via (GGGGS)2, the fusion protein PRO140HL-2P23 obtained by linking 2P23 to the C-terminus of the light chain and the C-terminus of the heavy chain of antibody PRO 140 via (GGGGS)2 respectively, and D is the fusion protein 2P23-PRO140-2P23 obtained by linking 2P23 to the N-terminus of the light chain of antibody PRO 140 via (GGGGS)3 and to the C-terminus of the heavy chain of antibody PRO 140 via (GGGGS)2.

[0067] Figure 2 The images show SDS-PAGE and Western blot analyses of bifunctional fusion proteins with different conformations. A shows the SDS-PAGE analysis of PRO140 (control) and the fusion proteins 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL. B shows the SDS-PAGE analysis of PRO 140 (control) and the fusion proteins 2P23-0-PRO140L, 2P23-1-PRO140L, and 2P23-6-PRO140L, as well as the Western blot analysis of the fusion proteins 2P23-0-PRO140L and 2P23-1-PRO140L. C shows the SDS-PAGE analysis of PRO 140 (control) and the fusion proteins PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23. D shows the SDS-PAGE analysis of PRO 140 (control) and the fusion proteins PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23. SDS-PAGE analysis of 140 (control) and 2P23-PRO140-2P23 fusion protein;

[0068] Figure 3 The inhibitory activities of different conformations of bifunctional fusion proteins and controls against HIV-1 NL4-3 and JRFL strains are shown. A represents the inhibitory activities of PRO 140 (control), 2P23-PRO140-Fc (control), and 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL against NL4-3 and JRFL. B represents the inhibitory activities of PRO 140 (control), 2P23-PRO140-Fc (control), and 2P23-PRO140L, 2P23-1-PRO140L, and 2P23-6-PRO140L against NL4-3 and JRFL. C represents the inhibitory activities of PRO 140 (control), 2P23-PRO140-Fc (control), and 2P23-PRO140L, 2P23-1-PRO140L, and 2P23-6-PRO140L against NL4-3 and JRFL. The inhibitory activities of PRO 140 (control), 2P23-PRO140-Fc (control), PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23 on NL4-3 and JRFL were compared, with D representing the inhibitory activities of PRO 140 (control), 2P23-PRO140-Fc (control), 2P23-PRO140L, PRO140HL-2P23, and 2P23-PRO140-2P23 on NL4-3 and JRFL.

[0069] Figure 4 The in vitro stability of the novel bifunctional fusion protein and the control;

[0070] Figure 5 The antiviral activity and stability of the novel bifunctional fusion protein and its control in rat serum were evaluated. In this study, A represents the inhibitory activity of rat serum containing PRO 140 (control), 2P23-PRO140-Fc (control), 2P23-PRO140L, and PRO140HL-2P23 against NL4-3, and B represents the inhibitory activity of rat serum containing PRO 140 (control), 2P23-PRO140L, and PRO140HL-2P23 against SF162.

[0071] Figure 6 SDS-PAGE analysis of the long-acting bifunctional fusion protein and its inhibitory activity against NL4-3 and JRFL are shown. In this diagram, A is the SDS-PAGE analysis of the m2P23-PRO140L and mPRO140HL-2P23 fusion proteins, and B is the inhibitory activity of m2P23-PRO140L, PRO140HL-2P23 and the long-acting proteins m2P23-PRO140L and mPRO140HL-2P23 against NL4-3 and JRFL.

[0072] Figure 7This study investigated the antiviral activity and stability of the long-acting bifunctional fusion protein in rat serum. Specifically, A represents the inhibitory activity of rat serum containing 2P23-PRO140L (control) and m2P23-PRO140L against NL4-3, and B represents the inhibitory activity of rat serum containing PRO140HL-2P23 (control) and mPRO140HL-2P23 against NL4-3. Detailed Implementation

[0073] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention. The embodiments provided below can serve as a guide for those skilled in the art to make further improvements and do not constitute a limitation on the present invention in any way. Those skilled in the art can refer to the content of this document and appropriately improve the relevant parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included within the scope of the present invention. The method of the present invention has been described through preferred embodiments, and those skilled in the art can obviously modify or appropriately change and combine the compounds and preparation methods described herein without departing from the content, spirit and scope of the present invention to realize and apply the technology of the present invention.

[0074] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0075] Example 1: Design and preparation of a novel bifunctional fusion protein

[0076] In this embodiment, the 2P23 and PRO 140 prototype antibodies were combined to design several novel bifunctional fusion proteins with different configurations. After expression and purification, the antiviral activity of the proteins was verified.

[0077] 1. Experimental Materials and Methods

[0078] (1) Design of novel bifunctional fusion proteins:

[0079] First, 2P23 was linked to the N-terminus of the light and / or heavy chains of antibody PRO 140 via a linker peptide (GGGGS)3, resulting in the design of three N-terminal fused bifunctional fusion proteins: 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL. Figure 1 A);

[0080] To investigate the effect of linker peptide length on the activity of fusion proteins, this embodiment also designed a method to link 2P23 to the N-terminus of the light chain of antibody PRO 140 via linker peptides (GGGGS)0, (GGGGS)1, and (GGGGS)6, respectively, to obtain fusion proteins 2P23-0-PRO140L, 2P23-1-PRO140H, and 2P23-6-PRO140HL. Figure 1 B);

[0081] In this embodiment, 2P23 is further linked to the C-terminus of the light and / or heavy chains of antibody PRO 140 via a linker peptide (GGGGS)2, resulting in the design of three C-terminal fusion proteins: PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23. Figure 1 C);

[0082] In this embodiment, 2P23 is also linked to the N-terminus of the light chain of antibody PRO 140 via linker peptide (GGGGS)3 and to the C-terminus of the heavy chain of antibody PRO 140 via (GGGGS)2, thus designing a 2P23-PRO140-2P23 bifunctional fusion protein. Figure 1 D).

[0083] (2) Construction of bifunctional fusion protein expression vector:

[0084] First, following the order from upstream to downstream, the IgG3 signal peptide gene sequence (as shown in SEQ ID NO.10, AAACATCTGTGGTTCTTCCTCCTCCTAGTGGCAGCTCCCAGATGGGTCCTGTCCAAGCTT), the 2P23 gene sequence (as shown in SEQ ID NO.2, GAGAGTGACCTGGGAGGAGTGGGAGAAGAAGGTGGAGGAGCTGGAGAAGAAGATCGAGGAGCTGCTGAAG), and the linker peptide gene sequence ((GGCGGAGGCGGAAGC)) are sequenced. n The PRO 140 antibody light chain gene sequence (as shown in SEQ ID NO. 4) and the His tag gene sequence (as shown in SEQ ID NO. 12, CACCATCACCATCACCAT) were linked together and artificially synthesized (by Genscript Biotech Co., Ltd.). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as pcDNA3.4-2P23-PRO140L expression vector.

[0085] The IgG3 signal peptide gene sequence (as shown in SEQ ID NO. 10), the 2P23 gene sequence (as shown in SEQ ID NO. 2), and the linker peptide gene sequence ((GGCGGAGGCGGAAGC)) are sequenced in the order from upstream to downstream. n The PRO 140 antibody heavy chain gene sequence (as shown in SEQ ID NO.6) was linked together and artificially synthesized (by Genscript Biotech Co., Ltd.). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector and designated as pcDNA3.4-2P23-PRO140H expression vector.

[0086] The IgG3 signal peptide gene sequence (as shown in SEQ ID NO. 10), the 2P23 gene sequence (as shown in SEQ ID NO. 2), the PRO 140 antibody light chain gene sequence (as shown in SEQ ID NO. 4), and the His tag gene sequence (as shown in SEQ ID NO. 12) were linked together in an upstream-to-downstream order and artificially synthesized (by Genscript Biotech Inc.). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as pcDNA3.4-2P23-0-PRO140L expression vector.

[0087] The IgG3 signal peptide gene sequence (as shown in SEQ ID NO. 10), the 2P23 gene sequence (as shown in SEQ ID NO. 2), and the linker peptide gene sequence ((GGCGGAGGCGGAAGC)) are sequenced in the order from upstream to downstream. n The PRO 140 antibody light chain gene sequence (as shown in SEQ ID NO.4) and the His tag gene sequence (as shown in SEQ ID NO.12) were linked together and artificially synthesized (by Genscript Biotech Co., Ltd.). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector and designated as pcDNA3.4-2P23-1-PRO140L expression vector.

[0088] The IgG3 signal peptide gene sequence (as shown in SEQ ID NO. 10), the 2P23 gene sequence (as shown in SEQ ID NO. 2), and the linker peptide gene sequence ((GGCGGAGGCGGAAGC)) are sequenced in the order from upstream to downstream. nThe PRO 140 antibody light chain gene sequence (as shown in SEQ ID NO.4) and the His tag gene sequence (as shown in SEQ ID NO.12) were linked together and artificially synthesized (by Genscript Biotech Co., Ltd.). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector and designated as pcDNA3.4-2P23-6-PRO140L expression vector.

[0089] The IgG3 signal peptide gene sequence (as shown in SEQ ID NO. 10), the PRO 140 antibody light chain gene sequence (as shown in SEQ ID NO. 4), and the linker peptide gene sequence ((GGCGGAGGCGGAAGC)) are sequenced in the order from upstream to downstream. n The n=2) 2P23 gene sequence (as shown in SEQ ID NO.2) and His tag gene sequence (as shown in SEQ ID NO.12) were linked together and artificially synthesized (by Genscript Biotech Co., Ltd.). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector and named pcDNA3.4-PRO140L-2P23 expression vector.

[0090] The IgG3 signal peptide gene sequence (as shown in SEQ ID NO. 10), the PRO 140 antibody heavy chain gene sequence (as shown in SEQ ID NO. 6), and the linker peptide gene sequence ((GGCGGAGGCGGAAGC)) are sequenced in the order from upstream to downstream. n The n=2) and 2P23 gene sequences (as shown in SEQ ID NO.2) were linked together and artificially synthesized (synthesized by Genscript Biotech Co., Ltd.). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as pcDNA3.4-PRO140H-2P23 expression vector.

[0091] Simultaneously, the IgG3 signal peptide gene sequence (as shown in SEQ ID NO.10), the PRO 140 antibody light chain gene sequence (as shown in SEQ ID NO.4), and the His tag gene sequence (as shown in SEQ ID NO.12) were linked together in an upstream-to-downstream order and artificially synthesized (by Genscript Biotech Co., Ltd.). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as pcDNA3.4-PRO140L expression vector.

[0092] The IgG3 signal peptide gene sequence (as shown in SEQ ID NO.10) and the PRO 140 antibody heavy chain gene sequence (as shown in SEQ ID NO.6) were linked together in an upstream-to-downstream order and artificially synthesized (by Genscript Biotech Co., Ltd.). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector and designated as pcDNA3.4-PRO140H expression vector.

[0093] During vector construction, the addition of the IgG3 signal peptide to the N-terminus of each sequence promotes protein synthesis and extracellular secretion; the addition of the His tag sequence to the C-terminus facilitates protein purification and detection. Specifically, the amino acid sequence of the PRO 140 antibody light chain is shown in SEQ ID NO. 3; the amino acid sequence of the PRO 140 antibody heavy chain is shown in SEQ ID NO. 5; the amino acid sequence of the IgG3 signal peptide is shown in SEQ ID NO. 9; and the amino acid sequence of the His tag is shown in SEQ ID NO. 11.

[0094] (3) Expression and purification of bifunctional fusion proteins:

[0095] Based on the dual plasmid co-transfection system, the recombinant protein expression plasmid obtained in step 2 was transfected into HEK293T cells using PEI transfection reagent at a light chain to heavy chain plasmid mass ratio of 1:1. After 48 hours, the cell culture supernatant was collected, and the protein was purified using Protein A affinity chromatography. The purity of the fusion protein was detected by SDS-PAGE, and the specificity of the fusion protein was detected by Western blot using an anti-His monoclonal antibody. The specific transfection combination was as follows:

[0096] ① pcDNA3.4-PRO140L+pcDNA3.4-PRO140H,

[0097] ② pcDNA3.4-2P23-PRO140L+pcDNA3.4-PRO140H;

[0098] ③ pcDNA3.4-PRO140L+pcDNA3.4-2P23-PRO140H;

[0099] ④ pcDNA3.4-2P23-PRO140L+pcDNA3.4-2P23-PRO140H;

[0100] ⑤ pcDNA3.4-2P23-0-PRO140L+pcDNA3.4-PRO140H;

[0101] ⑥pcDNA3.4-2P23-1-PRO140L+pcDNA3.4-PRO140H;

[0102] ⑦ pcDNA3.4-2P23-6-PRO140L+pcDNA3.4-PRO140H;

[0103] ⑧ pcDNA3.4-PRO140L-2P23+pcDNA3.4-PRO140H;

[0104] ⑨ pcDNA3.4-PRO140L+pcDNA3.4-PRO140H-2P23;

[0105] ⑩ pcDNA3.4-PRO140L-2P23+pcDNA3.4-PRO140H-2P23;

[0106] ⑪ pcDNA3.4-2P23-PRO140L+pcDNA3.4-PRO140H-2P23;

[0107] The above ① expresses the PRO 140 antibody (control); ②, ③, and ④ express the N-terminal fusion proteins 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL, respectively; ⑤, ⑥, and ⑦ express the N-terminal fusion proteins 2P23-0-PRO140L, 2P23-1-PRO140H, and 2P23-6-PRO140HL, respectively, with linker peptides of different lengths; ⑧, ⑨, and ⑩ express the C-terminal fusion proteins PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23, respectively; and ⑪ expresses the N-terminal and C-terminal dual fusion protein 2P23-PRO140-2P23.

[0108] The results are as follows Figure 2 As shown in Figure A, after SDS-PAGE electrophoresis combined with Coomassie brilliant blue staining, the three N-terminal fusion proteins 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL, as well as the control PRO 140, all effectively expressed the target fusion protein. Both the light and heavy chains showed single electrophoretic bands, indicating that three bifunctional fusion proteins with well-defined molecular conformations were successfully obtained.

[0109] SDS-PAGE electrophoresis results of N-terminal fusion proteins of light chains with linker peptides of different lengths are as follows: Figure 2As shown in Figure B, when the linker peptide structure is missing (2P23-0-PRO140L), the light chain band is significantly absent in the electrophoretic pattern, and the intensity of the heavy chain protein band is also significantly weaker than that of other groups. Western blot quantitative analysis showed that the expression level of the light chain in this group was significantly lower than that in other experimental groups, indicating that 2P23-0-PRO140L was not successfully expressed. This may be because the absence of the linker peptide leads to abnormal antibody assembly or spatial conformational instability, thus affecting the integrity of the protein structure. 2P23-1-PRO140L and 2P23-6-PRO140L can be expressed normally, and high-purity proteins can be obtained.

[0110] like Figure 2 As shown in Figure C, high-purity target proteins of the three C-terminal fusion proteins PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23 were obtained by SDS-PAGE electrophoresis combined with Coomassie Brilliant Blue staining, confirming that the three fusion proteins were successfully expressed.

[0111] like Figure 2 As shown in D, the 2P23-PRO140-2P23 fusion protein was obtained with high purity after SDS-PAGE electrophoresis and Coomassie Brilliant Blue staining, confirming the successful expression of 2P23-PRO140-2P23.

[0112] Example 2: Detection of antiviral activity of a novel bifunctional fusion protein

[0113] This embodiment uses an HIV-1 pseudovirus inhibition assay to detect the antiviral activity of the N-terminal fusion proteins 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL prepared in Example 1; the N-terminal fusion proteins 2P23-0-PRO140L, 2P23-1-PRO140H, and 2P23-6-PRO140HL with linker peptides of different lengths; and the C-terminal fusion proteins PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23. PRO 140 prepared in Example 1 and 2P23-PRO140-Fc (whose amino acid sequence is shown in SEQ ID NO. 13 and nucleic acid sequence is shown in SEQ ID NO. 14) previously developed and retained in the laboratory were used as controls. The viruses used were HIV-1 NL4-3 or JRFL pseudoviruses, prepared in our laboratory; the target cells TZM-bl were products of the National Experimental Cell Resource Sharing Service Platform.

[0114] 1. Experimental Materials and Methods

[0115] (1) Preparation of HIV-1 pseudovirus: plasmids expressing HIV-1 NL4-3 or JRFL strain envelope protein (Env) were co-transfected with HIV-1 backbone plasmid pSG3∆env into HEK293T cells; transfected cells were cultured in a 37℃, 5% CO2 cell culture incubator for 48 hours, and then the supernatant was collected, filtered and the filtrate was collected, which is the pseudovirus solution containing NL4-3 or JRFL, titrated and stored at -80℃ for later use.

[0116] (2) Dilute the drug to the initial concentration using DMEM medium, and then serially dilute the inhibitor 3-fold in a 96-well cell culture plate to obtain the drug dilution. Nine dilutions were set for each test drug.

[0117] (3) In a 96-well cell culture plate, drug dilution buffer (50 µL / well) was added to the drug wells, and DMEM medium (50 µL / well) was added to the control wells, with 3 replicates for each well. Then 100 TCID45 was added. 50 The viral solution (adjusted to 50 µL / well) was incubated at room temperature for 30 minutes.

[0118] (4) Resuspend the pre-cultured target cells TZM-bl in DMEM medium and adjust the cell concentration to 10 × 10⁻⁶. 4 Cells were added at a concentration of 100 µL / well, followed by the addition of DEAE-dextran to a final concentration of 15 µg / mL. Finally, cells (100 µL / well) were added to 96-well plates containing the virus & inhibitor complex and incubated at 37°C in a 5% CO2 incubator for 48 hours.

[0119] (5) Discard the cell culture supernatant, add 30 µL of cell lysis buffer (Promega, catalog number E1531) to each well, lyse at room temperature for 15 minutes, then add luciferase detection substrate reagent (Promega, catalog number E1501), measure the relative fluorescence units (RLU) using a microplate photometer, construct an inhibition rate curve, and calculate the half-maximal inhibitory concentration (IC50) of the drug. 50 ).

[0120] 2. Experimental Results and Analysis

[0121] like Figure 3 As shown, PRO 140 exhibits viral tropism selectivity and has no inhibitory effect on the CXCR4-tropy virus strain NL4-3 in this experimental system, nor on the CCR5-tropy virus strain JRFL. 50 The value is 5.884 nM. The 2P23-PRO140-Fc IC suppresses NL4-3 and JRFL. 50 The values ​​are 0.078 nM and 1.276 nM, respectively.

[0122] Three novel N-terminal fusion proteins, 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL, all exhibited significant antiviral effects, inhibiting the IC50 of NL4-3. 50 The values ​​were 0.009 nM, 0.046 nM, and 0.699 nM, respectively, and the IC50 values ​​for suppressing JRFL were [values ​​missing]. 50 The values ​​were 0.048 nM, 3.411 nM, and 2.139 nM, respectively. Among them, the light chain N-terminal fusion protein 2P23-PRO140L exhibited the strongest antiviral activity. Figure 3 A).

[0123] The N-terminal fusion proteins 2P23-PRO140L, 2P23-1-PRO140H, and 2P23-6-PRO140HL, containing (GGGGS)3, (GGGGS)1, and (GGGGS)6 linkers respectively, inhibit the IC50 of NL4-3. 50 The values ​​were 0.009 nM, 0.032 nM, and 0.006 nM, respectively, and the IC50 values ​​for suppressing JRFL were [values ​​missing]. 50 The values ​​were 0.049 nM, 0.138 nM, and 0.038 nM, respectively. Among them, 2P23-1-PRO140L had the weakest activity, while 2P23-PRO140L and 2P23-6-PRO140HL had activities that were approximately 3 to 5 times higher than it. Figure 3 B).

[0124] The three C-terminal fusion proteins PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23 also exhibited significant antiviral effects, inhibiting the IC50 of NL4-3. 50 The values ​​were 0.03 nM, 0.015 nM, and 0.005 nM, respectively, and the IC50 values ​​for suppressing JRFL were [values ​​missing]. 50 The values ​​were 3.556 nM, 0.562 nM, and 0.122 nM, respectively, among which the double-stranded C-terminal fusion protein PRO140HL-2P23 exhibited the strongest antiviral activity. Figure 3 C).

[0125] The N-terminal and C-terminal dual fusion protein 2P23-PRO140-2P23 also exhibited significant antiviral effects, inhibiting the IC50 of NL4-3. 50 The value is 0.013 nM, which suppresses JRFL IC. 50 The value is 0.149 nM ( Figure 3 D).

[0126] In summary, the dual-target fusion protein formed by linking the 2P23 peptide to the N-terminus and / or C-terminus of the PRO 140 antibody overcomes the limitation of PRO 140's ineffectiveness against CXCR4-tropy strains and also significantly improves its inhibitory activity against CCR5-tropy strains compared to PRO 140. Multiple conformations of the fusion protein exhibit significantly enhanced antiviral activity compared to 2P23-PRO140-Fc. Specifically, the light chain N-terminal fusion protein 2P23-PRO140L shows 9-27 times higher activity than 2P23-PRO140-Fc, the double-chain C-terminal fusion protein PRO140HL-2P23 shows 3-16 times higher activity than 2P23-PRO140-Fc, and the N-terminal and C-terminal dual fusion protein 2P23-PRO140-2P23 shows 6-9 times higher activity than 2P23-PRO140-Fc, demonstrating broad development prospects. After comprehensive consideration, 2P23-PRO140L and PRO140HL-2P23, which have good antiviral activity, were selected as representative bifunctional fusion proteins for further evaluation.

[0127] Example 3: A novel bifunctional fusion protein exhibits broad-spectrum inhibitory activity against HIV-1, HIV-2, and SIV.

[0128] This embodiment further evaluates the antiviral activity of the above-mentioned superior bifunctional fusion proteins 2P23-PRO140L and PRO140HL-2P23 against different subtypes of HIV-1, HIV-2 and SIV strains through virus inhibition experiments and fusion inhibition experiments based on a DSP system.

[0129] 1. Experimental Materials and Methods

[0130] (1) Virus inhibition experiment:

[0131] The test drugs were the bifunctional fusion proteins 2P23-PRO140L and PRO140HL-2P23 prepared in Example 1, and PRO 140 prepared in Example 1 and 2P23-PRO140-Fc and 2P23 peptides (the amino acid sequences of which are shown in SEQ ID NO.1, EMTWEEWEKKVEELEKKIEELLK) prepared in previous laboratory development were used as controls. The HIV-1 pseudoviruses used are shown in Tables 1 and 2, and the SIV pseudovirus used was SIV. 239 and SIV PBJ The HIV-2 replicating virus used is HIV-2. ROD and HIV-2 ST The target cells, TZM-bl, were prepared in our laboratory. These cells are a product of the National Experimental Cell Resource Sharing Service Platform. The specific experimental steps are as follows:

[0132] Virus preparation: HEK293T cells were co-transfected with plasmids expressing HIV-1 or SIV envelope protein (Env) and HIV-1 backbone plasmid pSG3∆env; HEK293T cells were transfected with molecular clone plasmids encoding HIV-2 strain ROD or ST; the transfected cells were cultured in a 37°C, 5% CO2 cell culture incubator for 48 hours, and then the supernatant was collected, filtered and the filtrate was collected as the virus solution, titrated and stored at -80°C for later use.

[0133] After obtaining the viral fluid, the experimental steps are the same as steps (2)-(5) in Example 2.

[0134] (2) Fusion suppression experiment based on DSP system:

[0135] The test drugs were the bifunctional fusion proteins 2P23-PRO140L and PRO140HL-2P23 prepared in Example 1, and PRO 140 prepared in Example 1 and the 2P23 peptide retained in the laboratory were used as controls. Plasmids expressing different HIV-1 Env subtypes were preserved in our laboratory; the pDSP8-11 fluorescent reporter plasmid and plasmids stably expressing CXCR4 / CCR5 and DSP were also used. 8-11 The target cells, 293FT, were provided by Professor Zene Matsuda of the University of Tokyo, Japan, and are routinely used and preserved in our laboratory; 293T cells were purchased from the American Type Culture Collection. The specific experimental procedures are as follows:

[0136] ① Seed 293T cells (effective cells) into 96-well plates for culture (approximately 1.5 × 10⁻⁶ cells). 4 (each / well), while stably expressing CXCR4 / CCR5 and DSP. 8-11 Target cells 293FT (approximately 1.5 × 10⁻⁶) 4 The cells (number per mL) were seeded into a 10 cm cell culture dish and cultured at 37°C with 5% CO2.

[0137] ② After culturing for 16 hours, the HIV-1 Env expression plasmid was combined with DSP. 1-7 The plasmid was co-transfected 1:1 into 293T effector cells.

[0138] ③ 24 hours after transfection, the drug was diluted to the initial concentration in DMEM medium and added to the effector cells in a 96-well plate at 3-fold serial dilutions (50 µL / well), with 9 dilution gradients and 3 replicates. DMEM medium was used as a control for cells without drug addition. The culture plates were incubated at 37°C in a 5% CO2 cell culture incubator for 1 hour.

[0139] ④ Resuspend the 293FT cells and adjust the cell concentration to approximately 30 × 10⁻⁶. 4Add EnduRen live cell substrate (Promega) at a ratio of 1:4000 to a volume of 1 / mL, mix well, and incubate at 37°C and 5% CO2 for 30 minutes.

[0140] ⑤ Add 100 μL of 293FT cells to each well of HIV-1 effector cells, centrifuge at 300 g for 1 minute to ensure sufficient contact between effector cells and target cells, incubate at 37°C for 1 hour, then measure luciferase activity (relative fluorescence unit, RLU), construct an inhibition rate curve, and calculate the half-maximal inhibitory concentration (IC50) of the drug. 50 ).

[0141] 2. Experimental Results and Analysis

[0142] 1) In this embodiment, the antiviral activity of 2P23-PRO140L and PRO140HL-2P23 was first evaluated using 12 internationally representative HIV-1 pseudoviruses, with 2P23, PRO 140, and 2P23-PRO140-Fc used as controls. The results are shown in Table 1. The two novel bifunctional fusion proteins, 2P23-PRO140L and PRO140HL-2P23, effectively inhibited the 12 HIV-1 pseudoviruses and exhibited significantly superior antiviral activity compared to the control molecules. Specifically, the average IC50 of 2P23-PRO140L was significantly higher than that of the control molecules. 50 The value is 0.044 nM, compared to 2P23 (IC). 50 =2.383 nM), PRO 140 (IC) 50 =7.28 nM) and 2P23-PRO140-Fc (IC 50 The activity of PRO140HL-2P23 was increased by 54-fold, 165-fold, and 4-fold, respectively, at 0.185 nM; the average IC50 of PRO140HL-2P23 was... 50 The value is 0.09 nM, which is 26 times, 81 times and 2 times higher than 2P23, PRO 140 and 2P23-PRO140-Fc, respectively.

[0143] Table 1. Inhibitory activity of novel bifunctional fusion protein and control against pseudoviruses of representative international HIV-1 strains.

[0144]

[0145] 2) In this embodiment, the antiviral activity of 2P23-PRO140L and PRO140HL-2P23 was further evaluated using 21 circulating HIV-1 strains (covering subtypes B, C, and major genotypes such as CRF01_AE and CRF07_BC recombinant subtypes). The results are shown in Table 2. The average IC50 values ​​of 2P23-PRO140L, PRO140HL-2P23, and the control drugs 2P23 and PRO 140 were...50 The values ​​were 0.045 nM, 0.114 nM, 2.830 nM, and 4.974 nM, respectively. Among them, 2P23-PRO140L exhibited the best antiviral activity, which was 63-fold and 111-fold higher than 2P23 and PRO 140, respectively. PRO140HL-2P23 also showed strong activity, which was 25-fold and 44-fold higher than 2P23 and PRO 140, respectively. It is worth noting that the two bifunctional fusion proteins have significantly better broad-spectrum activity than PRO 140, and both showed subtype-independent strong antiviral activity against the CXCR4-tropy strain CNE107 and the CCR5-tropy strain CNE49, which is highly resistant to PRO 140.

[0146] Table 2. Inhibitory activity of novel bifunctional fusion protein and control against 21 different HIV-1 pseudoviruses.

[0147]

[0148] 3) The inhibitory activities of 2P23-PRO140L, PRO140HL-2P23, and the control drugs 2P23 and PRO 140 against five representative HIV-1 Env-mediated intercellular fusions are shown in Table 3. PRO 140 showed no inhibitory effect on cell-cell fusion mediated by the CXCR4 tropism strain NL4-3 Env at concentrations up to 500 nM, and the average inhibitory activity against the other four HIV-1 Env-mediated cell-cell fusions was 7.565 nM. Both bifunctional fusion proteins showed significant inhibitory activity against all five HIV-1 Env-mediated intercellular fusions, with an average IC50 value of [missing information]. 50 The values ​​were 0.027 nM and 0.037 nM, respectively, which were 41-fold and 36-fold higher than the inhibitory activity of PRO 140, and 18-fold and 16-fold higher than the inhibitory activity of 2P23.

[0149] Table 3. Inhibitory activity of novel bifunctional fusion protein and control against HIV-1 Env-mediated cell fusion

[0150]

[0151] 4) Regarding inhibitory activity against HIV-2 strains (Table 4), the control drug PRO 140 showed inhibitory activity against HIV-2 at up to 500 nM. ROD It has no inhibitory activity, but 2P23-PRO140L can effectively inhibit HIV-2. ROD IC 50 The value was 0.309 nM, while PRO140HL-2P23 was effective against HIV-2. ROD The inhibitory activity of HIV-2 was significantly reduced. STThe strain and both bifunctional fusion proteins exhibited effective inhibitory activity, with an IC50 value of [missing information]. 50 The values ​​were 0.534 nM and 0.457 nM, respectively. Compared with 2P23 and PRO 140, the activities of 2P23-PRO140L were increased by approximately 26-fold and 2-fold, respectively, and the activities of PRO140HL-2P23 were increased by 31-fold and 3-fold, respectively.

[0152] Regarding the inhibitory activity against SIV strains (Table 4), the bifunctional fusion protein also showed significantly enhanced activity. 2P23-PRO140L inhibits SIV. 239 and SIV PBJ IC 50 The values ​​were 0.02 nM and 0.087 nM, respectively, which were 79-214 times higher than 2P23 and 262-1160 times higher than PRO 140; the activity of PRO140HL-2P23 in inhibiting the two SIV pseudoviruses was slightly reduced, IC50... 50 The values ​​were 0.228 nM and 1.691 nM, respectively, but they also showed a significant improvement over 2P23 and PRO 140.

[0153] Table 4. Inhibitory activity of novel bifunctional fusion protein and control against HIV-2 and SIV strains

[0154]

[0155] Example 4: Novel bifunctional fusion protein maintains effective inhibitory activity against drug-resistant HIV-1 strains

[0156] The antiviral activity of the bifunctional fusion proteins 2P23-PRO140L and PRO140HL-2P23 and the control drugs PRO 140 and 2P23 was evaluated using the sham virus inhibition experiment in Example 2 above.

[0157] The results are shown in Table 5. Due to the viral selectivity of PRO 140, it had no inhibitory effect on NL4-3 and its mutant strains in this experimental system; 2P23 could effectively inhibit the wild-type NL4-3 strain, while its activity against 2P23-resistant strains decreased to varying degrees, with an average IC50 of [missing value]. 50 The value was 12.874 nM, with an average resistance fold of 29.94-fold. Specifically, 2P23 showed 59.39-fold resistance to the L57R mutant and an even greater 245.38-fold resistance to the L57R / E136G mutant. In stark contrast, the bifunctional fusion protein exhibited significant inhibitory activity against the 2P23-resistant strain, with 2P23-PRO140L showing an average IC50 value of 12.874 nM against the resistant strain. 50 The value was 0.013 nM, the resistance factor was only 1.4 times, and the average IC50 of PRO140HL-2P23 was [missing value].50 The value was 0.012 nM, and the resistance fold was only 2.46 times, indicating that both bifunctional fusion proteins were sensitive to all 2P23 resistance mutations and maintained a high level of activity. In particular, against the highly resistant 2P23 mutant strain L57R / E136G, the activities of the two bifunctional fusion proteins were increased by 45875 times and 24538 times compared to 2P23, respectively. Furthermore, the sensitivity to the L57R / E136G mutant strain was actually higher than that of the wild-type strain, indicating that the bifunctional fusion proteins 2P23-PRO140L and PRO140HL-2P23 are effective inhibitors against 2P23 resistance mutants.

[0158] Table 5. Inhibitory activity of novel bifunctional fusion protein and control against 2P23 drug-resistant mutants.

[0159]

[0160] Example 5: In vitro stability of a novel bifunctional fusion protein

[0161] To further verify the drug-likeness of the bifunctional fusion protein of the present invention, in this embodiment, 2P23-PRO140L, PRO140HL-2P23 and control PRO 140 were placed at 4°C, 25°C and 37°C for a long period of time, incubated with human serum and digested with trypsin, and then their stability was determined by detecting changes in the antiviral activity of the drug.

[0162] 1. Experimental Materials and Methods

[0163] (1) Temperature stability experiment: The drug was adjusted to the required concentration with phosphate-buffered saline (PBS) and stored at 4℃, 25℃ and 37℃ for 0, 7, 14, 21, 28, 35 and 42 days, respectively. The inhibitory effect of different samples on TZM-bl cells infected by NL4-3 strain was detected by the pseudovirus inhibition experiment in Example 2, and the IC50 was calculated. 50 value.

[0164] (2) Human serum stability experiment: The drug was adjusted to the required concentration with phosphate-buffered saline (PBS), and human serum was added to it to a final concentration of 20%. After mixing, the mixture was incubated at 37°C for 0, 15, 30, 60, 90, 120, 180, 240 and 360 min respectively. Samples were collected after incubation. The inhibitory effect of different samples on TZM-bl cells infected with NL4-3 strain was detected by the pseudovirus inhibition experiment in Example 2, and the IC50 was calculated. 50 value.

[0165] (3) Digestion with trypsin: The drug and trypsin (Sigma-Aldrich product, catalog number T4799) were mixed at a ratio of 20:1 (final concentrations of 2 mg / mL and 0.1 mg / mL, respectively), and incubated at 37°C for 0, 15, 30, 60, 90, 120, 180, 240 and 360 min, respectively. The inhibitory effect of different samples on TZM-bl cells infected with NL4-3 strain was detected by the pseudovirus inhibition experiment in Example 2, and the IC50 was calculated. 50 value.

[0166] 2. Experimental Results and Analysis

[0167] like Figure 4 As shown, after being placed at different temperatures (4℃, 25℃ and 37℃) for 42 days, the antiviral activity of 2P23-PRO140L, PRO140HL-2P23 and the control drug PRO 140 did not change significantly, and they showed good temperature stability characteristics within 42 days. Longer-term temperature stability needs to be further studied.

[0168] 2P23-PRO140L, PRO140HL-2P23, and the control drug PRO140 all maintained stable antiviral activity after incubation with human serum samples at 37°C. Figure 4 After trypsin digestion, PRO 140 exhibited high resistance, while 2P23-PRO140L showed an approximately 10-fold decrease in activity after 60 min of trypsin digestion, subsequently maintaining an activity level comparable to PRO 140. PRO140HL-2P23 showed an approximately 10-fold decrease in activity at the beginning of trypsin digestion, subsequently maintaining an activity level comparable to PRO140, and its subsequent activity change trend was basically consistent with that of PRO 140. Figure 4 ).

[0169] Example 6: Antiviral activity of a novel bifunctional fusion protein in rats

[0170] To evaluate the antiviral activity of the bifunctional fusion protein in rats, 18 SD rats were randomly divided into an experimental group and a control group (n=6). 2P23-PRO140L, PRO140HL-2P23, and the control drug PRO 140 were administered subcutaneously to the SD rats. Samples were collected at different time points before administration (0 h) and after administration (1 h, 4 h, 8 h, 12 h, 24 h, 2 d, 4 d, 5 d, 7 d, 10 d, and 14 d). The inhibitory effect of rat serum on TZM-bl cells infected with NL4-3 and SF162 strains was detected in vitro using the pseudovirus inhibition experiment described in Example 2. The serum dilution factor required to achieve a 50% inhibition effect on the virus was calculated.

[0171] This embodiment first tested the inhibitory activity of NL4-3 in rat serum before and after administration of 2P23-PRO140L, PRO140HL-2P23, and the control drug PRO 140, and compared the results with those of 2P23-PRO140-Fc. The results are as follows: Figure 5 As shown in Figure A, PRO140 exhibits viral tropism selection characteristics, and its serum showed no inhibitory activity against NL4-3 in this experimental system. The plasma concentration of 2P23-PRO140-Fc began to take effect 8 hours after administration, peaking at 24 hours (with a mean serum dilution of 1025-fold). It maintained some antiviral activity 96 hours after administration, but decreased to a lower level after 120 hours. In contrast, the novel bifunctional fusion protein 2P23-PRO140L rapidly reached high serum drug concentrations 4 hours after administration (with a mean serum dilution of 383-fold); peak serum drug concentration was reached at 48 hours (with a mean serum dilution of 26874-fold); and even after 240 hours (10 days) of administration, serum maintained high inhibitory activity (with a mean dilution of 2588-fold); however, serum antiviral activity decreased to a lower level after 336 hours (14 days). The serum drug concentration of PRO140HL-2P23 peaked 24-48 h after administration, corresponding to a serum dilution of 43088-44155 times. Its serum antiviral activity persisted until 240 h (10 days), corresponding to a serum dilution of 1344 times. After 336 h (14 days) of administration, the serum antiviral activity decreased to a low level. In summary, the two novel bifunctional fusion proteins exhibited significantly higher antiviral activity and stability in rats than 2P23-PRO140-Fc, suggesting better in vivo antiviral activity and longer drug half-life.

[0172] This example also tested the inhibitory activity of SF162 in rat serum before and after administration of 2P23-PRO140L, PRO140HL-2P23, and the control drug PRO 140. The results are as follows... Figure 5As shown in Figure B, the serum drug concentration of PRO 140 peaked 48 h after administration, with an average serum dilution of 242-fold; the serum antiviral activity of PRO 140 persisted for up to 240 h (10 days). 2P23-PRO140L rapidly reached a high serum drug concentration 4 h after administration, corresponding to an average serum dilution of 266-fold; the peak serum drug concentration was reached at 48 h, with an average serum dilution of 4099-fold; even after 240 h (10 days) of administration, serum maintained highly effective inhibitory activity, with an average dilution of 675-fold; after 336 h (14 days) of administration, serum antiviral activity decreased to a lower level. The serum drug concentration of PRO140HL-2P23 peaked 24 h after administration, corresponding to an average serum dilution of 2523-fold; its serum antiviral activity persisted for up to 240 h (10 days), corresponding to an average serum dilution of 103-fold. The results showed that the two bifunctional fusion proteins had significantly higher antiviral activity than PRO 140 in rats, and their in vivo stability was similar to that of PRO 140, suggesting that they have good in vivo antiviral activity and drug half-life.

[0173] Example 7: Construction and expression of a novel bifunctional fusion protein with long-lasting modification

[0174] The M428L / N434S (LS) mutation in the Fc segment of the IgG antibody can improve the affinity of the modified IgG for FcRn and prolong the terminal half-life of the antibody. Based on the good antiviral activity and stability exhibited by the novel bifunctional fusion proteins 2P23-PRO140L and PRO140HL-2P23, this embodiment introduces the M428L and N434S double mutation into the Fc segment of the PRO 140 antibody heavy chain to further optimize the bifunctional fusion protein, thereby modifying 2P23-PRO140L and PRO140HL-2P23 for long-term efficacy. The specific construction method is as follows:

[0175] The IgG3 signal peptide gene sequence (as shown in SEQ ID NO.10) and the PRO 140 antibody heavy chain mutant gene sequence (mPRO140H, as shown in SEQ ID NO.8) were linked together in an upstream-to-downstream order and artificially synthesized (by Genscript Biotech Inc.). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector and designated as the pcDNA3.4-mPRO140H expression vector.

[0176] The sequences of the IgG3 signal peptide gene (as shown in SEQ ID NO. 10), the PRO 140 antibody heavy chain mutant gene (as shown in SEQ ID NO. 8), and the linker peptide gene ((GGCGGAGGCGGAAGC)) are ordered from upstream to downstream. nThe n=2) and 2P23 gene sequences (as shown in SEQ ID NO.2) were linked together and artificially synthesized (synthesized by Genscript Biotech Co., Ltd.). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as pcDNA3.4-mPRO140H-2P23 expression vector.

[0177] During vector construction, the addition of IgG3 signal peptide to the N-terminus of each sequence promotes protein synthesis and secretion outside the cell.

[0178] Based on a dual plasmid co-transfection system, transfection was performed using the following combinations: ① pcDNA3.4-2P23-PRO140L + pcDNA3.4-mPRO140H; ② pcDNA3.4-PRO140L-2P23 + pcDNA3.4-mPRO140H-2P23. ① and ② expressed the N-terminal fusion protein m2P23-PRO140L with double mutations of M428L and N434S in the heavy chain, and the C-terminal fusion protein mPRO140HL-2P23 with double mutations of M428L and N434S in the heavy chain, respectively. The proteins were then purified and identified using the method described in Example 1. The amino acid sequence of the PRO 140 antibody heavy chain mutant gene is shown in SEQ ID NO. 7.

[0179] The results are as follows Figure 6 As shown in Figure A, after SDS-PAGE electrophoresis combined with Coomassie brilliant blue staining, both fusion proteins effectively expressed the target fusion protein, and both the light and heavy chains showed single electrophoretic bands, indicating that a bifunctional fusion protein with a well-defined molecular conformation was successfully obtained.

[0180] Figure 6 B shows that the long-acting modified bifunctional fusion proteins m2P23-PRO140L and mPRO140HL-2P23 inhibit the IC50 of NL4-3. 50 The values ​​were 0.005 nM and 0.003 nM, respectively, indicating that the IC50 suppression of JRFL was... 50 The values ​​were 0.0255 nM and 0.1083 nM, respectively. The antiviral activity of the bifunctional fusion protein after long-acting modification was comparable to that of its prototype proteins 2P23-PRO140L and PRO140HL-2P23.

[0181] Example 11: Antiviral activity of a novel bifunctional fusion protein modified for long-lasting effects in rats

[0182] To evaluate the antiviral activity of the modified bifunctional fusion protein in rats, 12 SD rats were randomly divided into two groups (n=6). m2P23-PRO140L and mPRO140HL-2P23 were administered subcutaneously to the SD rats at a dose of 3 mg / kg. Samples were collected at different time points before administration (0 h) and after administration (1 h, 4 h, 8 h, 12 h, 24 h, 2 d, 4 d, 5 d, 7 d, 10 d, 14 d, 18 d, 21 d, 25 d, 28 d). The inhibitory effect of rat serum on NL4-3-infected TZM-bl cells before and after administration was detected in vitro using the pseudovirus inhibition assay described in Example 2, and compared with the results of its prototype proteins 2P23-PRO140L and PRO140HL-2P23.

[0183] The results are as follows Figure 7 As shown in Figure A, the serum antiviral activity of 2P23-PRO140L decreased to a low level after 336 h (14 days) of drug administration, corresponding to a serum dilution of 78-fold. In contrast, the serum antiviral activity of m2P23-PRO140L remained high after 336 h (14 days) of drug administration, corresponding to an average serum dilution of 200-fold; however, the serum antiviral activity only decreased to a low level after 432 h (18 days) of drug administration, corresponding to a serum dilution of 97-fold.

[0184] Figure 7 B shows that the serum antiviral activity of PRO140HL-2P23 decreased to a low level 336 h (14 days) after administration, corresponding to a serum dilution of 94-fold. In contrast, mPRO140HL-2P23 maintained high antiviral activity in serum 336 h (14 days) after administration, corresponding to an average serum dilution of 616-fold; its serum antiviral activity persisted until 432 h (18 days), and only decreased to a low level 504 h (21 days) after administration.

[0185] The results of the above study show that, compared with the original protein, the long-acting bifunctional fusion proteins m2P23-PRO140L and mPRO140HL-2P23 exhibit significantly enhanced stability in rat models and can maintain more durable antiviral activity, indicating that both fusion proteins have the characteristic of prolonged drug half-life.

Claims

1. A bifunctional fusion protein simultaneously targeting CCR5 and gp41, characterized in that, The bifunctional fusion protein comprises (1) a fusion protein obtained by connecting a polypeptide 2P23 to the N-terminus and / or C-terminus of the light chain and / or heavy chain of antibody PRO 140 or a PRO 140 mutant through a connecting peptide; or (2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the fusion protein of (1) above; The amino acid sequence of the polypeptide 2P23 is shown in SEQ ID NO. 1; The amino acid sequence of the light chain of antibody PRO 140 is shown in SEQ ID NO. 3; The amino acid sequence of the heavy chain of antibody PRO 140 is shown in SEQ ID NO. 5; The PRO 140 mutant is obtained by generating M428L and N434S mutations in the Fc segment of the heavy chain of PRO 140; The amino acid sequence of the light chain of the PRO 140 mutant is shown in SEQ ID NO. 3; The amino acid sequence of the heavy chain of the PRO 140 mutant is shown in SEQ ID NO.

7.

2. The bifunctional fusion protein simultaneously targeting CCR5 and gp41 according to claim 1, wherein, The amino acid sequence of the connecting peptide is (GGGGS) n , n has a value of 1, 2, 3, 4, 5 or 6.

3. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the bifunctional fusion protein of any one of claims 1-2.

4. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleic acid molecule of claim 3.

5. An engineered animal cell line, characterized in that, The animal cell line contains the recombinant expression vector of claim 4 or the nucleic acid molecule of claim 3 integrated in the genome.

6. A pharmaceutical composition, characterized by, The pharmaceutical composition comprises the bifunctional fusion protein of any one of claims 1-2, and a pharmaceutically acceptable carrier or excipient; The pharmaceutical composition is a human immunodeficiency virus entry inhibitor.

7. Use of the bifunctional fusion protein of any one of claims 1-2, the nucleic acid molecule of claim 3, the recombinant expression vector of claim 4, or the engineered animal cell line of claim 5 in the manufacture of a functional product; The functional product is used in combination of any one or more of: a) antiviral; b) prevention and / or treatment of diseases caused by viral infection; c) inhibition of virus cell fusion; d) inhibition of virus invasion of cells; e) inhibition of virus replication; The virus is HIV-1, HIV-2 or SIV; The disease caused by viral infection is AIDS.

Images