Gene modification system capable of being used for knocking out pig TRIM29 gene, cell strain and application

Abstract

The invention discloses a gene modification system capable of being used for knocking out a pig TRIM29 gene, a TRIM29 gene modified cell strain prepared by adopting the system, and application of the system in preparation of a TRIM29 gene modified pig or preparation of a PRV (pseudorabies virus) resistant pig or cultivation of a new anti-PRV pig variety. By means of the system, the TRIM29 gene modified cell strain capable of being stably inherited can be efficiently screened out, the TRIM29 gene in the cell strain has a biisometric displacement mutation genotype behind a GACCTCAGCTACTCTAAGCA sequence site, and the genotype can be stably inherited. A TRIM29 gene modified pig can be prepared by utilizing the gene modification system or the TRIM29 gene modified cell strain, the gene modified pig has improved I-type interferon level, has relatively strong disease resistance to PRV (porcine reproductive and respiratory syndrome), also has disease resistance to various I-type IFN sensitive viruses, is a broad-spectrum disease-resistant pig, and has good application prospects. Good market competitiveness and application prospects are realized.

Description

Technical Field

[0001] The present invention relates to the technical fields of animal genetic engineering and animal bio-breeding, and particularly relates to a gene modification system, a cell line and an application that can be used to knock out the porcine TRIM29 gene. Background Art

[0002] Pseudorabies is an important virus affecting the pig industry, which is caused by the infection of pigs with the Pseudorabies virus (hereinafter referred to as PRV). PRV is a herpes virus (Suidherpes virus 1) that mainly infects pigs. After PRV infects pigs, symptoms such as dyspnea and listlessness generally appear; in fattening pigs, symptoms such as growth stagnation and slow weight gain will occur, seriously affecting their economic benefits; in sows, reproductive disorders such as abortion will occur; in piglets, symptoms such as vomiting and diarrhea will occur, especially PRV infection has a relatively high mortality rate in piglets. PRV is one of the most serious infectious diseases affecting the healthy development of the pig industry in China, with frequent outbreaks, causing huge losses to the pig industry in China. In the 1960s, PRV infection was first detected in China. Since the 1990s, most pig farms in China have adopted the method of injecting the Bartha-K61 vaccine strain into pigs to control PRV. During this process, the vaccine prevention and control measures have indeed achieved remarkable results, and the epidemic has been significantly controlled for a long time, and even purified in some pig farms. However, in 2011, due to the mutation of the PRV strain, the virulence of the virus increased and the cross-protection of the vaccine weakened, and outbreaks of PRV still occurred in a large number of pig farms fully immunized with PRV vaccines, and the prevalence of PRV worsened again. The current PRV prevention and control situation is still complex and severe, which is one of the key difficulties and pain points in pig production.

[0003] Adopting the strategy of genetic breeding to transform specific genomic loci of pigs, improving the resistance of pigs to PRV or various pathogen infections from the genetic essence, and cultivating new pig breeds with improved natural disease resistance have the advantages of convenience, high efficiency and low cost. It is an important alternative strategy for vaccine and biosecurity prevention and control, and also a key means for future livestock and poultry bio-breeding. Exploring the gene loci of the interaction between the virus and the host and modifying the corresponding gene loci are the keys to disease-resistant bio-breeding.

[0004] Therefore, it is urgent to study a new gene locus and edit or modify this locus to prepare gene-modified pigs that can resist PRV, so that they have disease resistance to PRV. Summary of the Invention

[0005] The object of the present invention is to provide a gene editing system for knocking out the porcine TRIM29 gene, a cell line prepared by this system and its applications, and to prepare gene-edited pigs resistant to pseudorabies virus using this gene editing system or cell line, so as to solve the above problems.

[0006] According to the first aspect of the present invention, there is provided a gene editing system for knocking out the TRIM29 gene, which system comprises a gRNA nucleotide sequence or an expression vector containing the gRNA nucleotide sequence and a Cas9 expression vector or Cas9 protein, and the gRNA nucleotide sequence is as shown in SEQ ID No:1. Thus, by directly injecting porcine fertilized eggs with this system, gene-edited pigs with the TRIM29 gene knocked out can be prepared. Such gene-edited pigs have significant disease resistance to PRV, can naturally resist pseudorabies virus or alleviate the symptoms after infection, thereby greatly reducing the use of anti-PRV drugs, reducing drug residues, disease resistance costs and infection risks, improving the antiviral ability of pigs, and enhancing the immunity and market competitiveness of pigs.

[0007] According to the second aspect of the present invention, there is provided a TRIM29 gene-edited cell line, wherein the TRIM29 gene in the cell line is knocked out, and the TRIM29 gene in the cell line forms a double-equivalent frameshift mutation genotype after the sequence site of GACCTCCAGCTACTTCAAGCA. The double-equivalent frameshift mutation means that one strand of the double-stranded DNA lacks 1 base and the other strand adds 1 base after the said sequence site. Thus, by using this cell line as the nuclear donor cell for nuclear transfer and performing somatic cell cloning, gene-edited pigs with the TRIM29 gene knocked out can be prepared. Such gene-edited pigs have strong disease resistance to PRV, can naturally resist pseudorabies virus or alleviate the disease symptoms and mortality after infection, improve the natural immunity and antiviral ability of pigs, and can reduce the costs and burdens of corresponding vaccines, drugs and biosafety prevention and control. The disease-resistant pigs cultivated by this method will have good market competitiveness and play a positive role in enhancing the economic benefits of the aquaculture industry.

[0008] In some embodiments, the cell line is a TRIM29 gene-edited porcine fibroblast cell line TRIM29 KO, and the preservation number of the TRIM29 gene-edited porcine fibroblast cell line TRIM29 KO is GDMCC No:65878.

[0009] In some embodiments, the cell line is prepared using the above-mentioned gene editing system.

[0010] According to the third aspect of the present invention, a method for preparing a TRIM29 gene-modified pig is provided. This method involves injecting the gene modification system into the fertilized eggs of pigs, and then transplanting the fertilized eggs into the uterus of a surrogate sow. When the piglets are born, TRIM29 gene-modified pigs can be obtained. Thus, by using this method, there is no need to screen positive cell lines and perform somatic cell cloning. This method is more simple and easy to operate. Moreover, the prepared TRIM29 gene-modified pigs have significant resistance to PRV. And because the TRIM29 gene is knocked out, these gene-modified pigs may be resistant to a variety of IFN-sensitive viruses, and they are a kind of pigs with broad-spectrum disease resistance.

[0011] According to the fourth aspect of the present invention, a method for preparing a TRIM29 gene-modified pig is provided. This method involves using the cell line as the nuclear donor cell for nuclear transfer in somatic cell cloning to obtain TRIM29 gene-modified pigs. Thus, because the cell line can be stably inherited, the success rate of obtaining TRIM29 gene-modified positive pigs by using this method is higher. And these gene-modified pigs have significant resistance to PRV. Also, because the TRIM29 gene is knocked out, these gene-modified pigs may be resistant to a variety of IFN-sensitive viruses, and they are a kind of pigs with broad-spectrum disease resistance.

[0012] According to the fifth aspect of the present invention, an application of the gene modification system in preparing pigs resistant to pseudorabies virus or cultivating new varieties of pigs resistant to PRV is provided. Thus, the pigs resistant to pseudorabies virus or the new varieties of pigs resistant to PRV obtained through this application have significant resistance to PRV. And because the TRIM29 gene is knocked out, these gene-modified pigs may be resistant to a variety of IFN-sensitive viruses, and they are a kind of pigs with broad-spectrum disease resistance or new varieties of pigs with broad-spectrum disease resistance.

[0013] According to the sixth aspect of the present invention, an application of the gene modification system in preparing a TRIM29 gene-modified cell line is provided. By using this system, a TRIM29 gene-modified cell line can be obtained. This cell line can be used as the nuclear donor cell for somatic cell cloning to prepare TRIM29 gene-modified cloned pigs. This cell line can also be used as research material for antiviral research on pigs and the like.

[0014] According to the seventh aspect of the present invention, an application of the cell line in preparing pig antiviral products is provided. Thus, this cell line can be used as research material for preparing products against porcine pseudorabies virus or for the research and preparation of other antiviral products.

[0015] According to the eighth aspect of the present invention, there is provided the use of the described cell line in the preparation of pseudorabies virus-resistant pigs or the cultivation of new varieties of PRV-resistant pigs. Thus, the pseudorabies virus-resistant pigs or new varieties of PRV-resistant pigs obtained through this application have significant disease resistance to PRV. Moreover, since the TRIM29 gene is knocked out, these gene-modified pigs may be resistant to a variety of IFN-sensitive viruses, and are a kind of broad-spectrum disease-resistant pigs or new varieties of broad-spectrum disease-resistant pigs. In addition, the success rate of obtaining positive pigs in this application is high, and the genotype of the prepared positive pigs can be stably inherited, so that new varieties of pseudorabies virus-resistant pigs can be cultivated.

[0016] Advantages of this application: This application discloses a gene editing system that can be used to knock out the TRIM29 gene, a TRIM29 gene-edited cell line TRIM29 KO prepared by using this system, and the application of this system in the preparation of TRIM29 gene-edited pigs, the preparation of pseudorabies virus-resistant pigs, or the cultivation of new varieties of pseudorabies virus-resistant pigs. Through this system, a stably inheritable TRIM29 gene-edited cell line TRIM29 KO can be efficiently screened out. In the cell line TRIM29 KO, the TRIM29 gene has a double-equivalent frameshift mutation genotype after the sequence site of GACCTCCAGCTACTTCAAGCA, and this genotype can be stably inherited. Using this gene editing system or the TRIM29 gene-edited cell line TRIM29 KO, TRIM29 gene-edited positive pigs can be prepared. These positive pigs have significant disease resistance to PRV. Moreover, since the TRIM29 gene is knocked out, these gene-modified pigs may be resistant to a variety of IFN-sensitive viruses, and are a kind of broad-spectrum disease-resistant pigs. By breeding these positive pigs, new varieties of pseudorabies virus-resistant pigs can be obtained. The new variety of pigs has significant disease resistance to PRV, can naturally resist pseudorabies virus or alleviate the symptoms after infection. Thus, the use of anti-PRV virus drugs can be greatly reduced, drug residues, disease resistance costs, and infection risks can be reduced, the antiviral ability of this new variety of pigs can be improved, and the immunity and market competitiveness of this new variety of pigs can be enhanced. Description of the drawings

[0017] Figure 1 It is a diagram showing the structure of the TRIM29 gene and information on gene editing sites; Figure 2 It is a picture of a TRIM29 gene-edited positive pig; Figure 3 It is a diagram showing the detection results of the expression level of the target protein of a TRIM29 gene-edited positive pig; Figure 4 It is a death curve diagram of experimental pigs (TRIM29 gene-edited pigs) and control group pigs in a PRV infection experiment; Figure 5It is a graph showing the body temperature changes of TRIM29 gene - modified pigs and control pigs in the PRV infection experiment; among them, KO represents TRIM29 gene - modified pigs, WT represents control pigs, and the values in the graph represent the p - values of the statistical difference analysis between groups. p < 0.05 indicates a significant difference; Figure 6 It is a graph showing the detection results of the virus - shedding levels of TRIM29 gene - modified pigs and control pigs in the PRV infection experiment: among them, KO represents TRIM29 gene - modified pigs, WT represents control pigs, and the values in the graph represent the p - values of the statistical difference analysis between groups. p < 0.05 indicates a significant difference; Figure 7 It is a graph showing the detection results of the viral loads in various organs of TRIM29 gene - modified pigs and control pigs in the PRV infection experiment: among them, KO represents TRIM29 gene - modified pigs, WT represents control pigs, and the values in the graph represent the p - values of the statistical difference analysis between groups. p < 0.05 indicates a significant difference; Figure 8 It is a graph showing the detection results of the PRV antibody levels after virus challenge of TRIM29 gene - modified pigs and control pigs in the PRV infection experiment: among them, KO represents TRIM29 gene - modified pigs, WT represents control pigs. The left graph shows the detection results of gB (gb) antibodies, and the right graph shows the detection results of gE (ge) antibodies. The values in the graph represent the p - values of the statistical difference analysis between groups. p < 0.05 indicates a significant difference; Figure 9 It is a graph showing the detection results of the IFN - I levels after virus challenge of TRIM29 gene - modified pigs and control pigs in the PRV infection experiment: among them, KO represents TRIM29 gene - modified pigs, WT represents control pigs. The left graph shows the detection results of IFNɑ, and the right graph shows the detection results of IFNβ. The values in the graph represent the p - values of the statistical difference analysis between groups. p < 0.05 indicates a significant difference. Detailed implementation manners

[0018] The invention will be further described in detail below with reference to the accompanying drawings.

[0019] Example 1: Preparation of a gene - editing system for knocking out the TRIM29 gene and a positive cell line of TRIM29 gene - modified cells.

[0020] (1) Synthesize TRIM29 gRNA.

[0021] The position of the gRNA target on the TRIM29 genome is as Figure 1As shown, the sequence gacctccagctacttcagca in exon 1 region of porcine TRIM29 gene was selected as the target to construct the guide RNA (gRNA) of the CRISPR / Cas targeting system, and the synthesized gRNA was denoted as TRIM29 gRNA. The full-length nucleotide sequence of this TRIM29 gRNA is (shown in SEQ ID No:1): gaccuccagcuacuucagcaGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU, where the lowercase letters are the complementary sequences for recognizing the TRIM29 targeting site, and the uppercase letters are the gRNA backbone sequences. Since the synthesized sequence is RNA while the previously described target sequence is DNA, the corresponding T was replaced with U during gRNA synthesis.

[0022] (2) Cell transfection and screening of positive cells with TRIM29 gene modification.

[0023] Primary isolated porcine fibroblasts ( pig fibroblast cells ) were cultured to a confluence of over 80%. After digestion and centrifugation to remove the cell culture medium, the cells were resuspended in PBS, and a mixture of TRIM29 gRNA (sequence as shown in SEQ ID No:1) and Cas9 protein (M0667M, NEB) (in other methods, a Cas9 expression vector that can express Cas9 protein can also be used) was added to the cells (in other methods, the TRIM29 gRNA sequence can also be constructed into an expression vector and co-transfected with the Cas9 expression vector or Cas9 protein into the cells), and then electroporation transfection was carried out. After electroporation, the cells were seeded into 10 10-cm culture dishes, with about 1000 cells in each dish, and cultured in a culture medium of DMEM + 15% FBS in an incubator at 37°C and 5% CO2. Monoclonal colonies of appropriate size formed 10 days after transfection. At this time, single-cell clones were picked into 48-well plates. When the cells in the 48 wells were all confluent, about 1 / 10 of the cells were taken for genotype detection, and the remaining 9 / 10 of the cells were passaged to 24 wells to continue culturing into cell lines. The cells used for genotype detection were centrifuged to remove the culture medium, 10 μl of cell lysis solution (4 mg / ml proteinase K + 0.5% NP40 dissolved in sterile water) was added to resuspend the cells, and the cells were lysed at 56°C for 30 min, and then proteinase K was inactivated at 98°C for 10 min. 1 μl of the lysate was directly used as a template for PCR detection.

[0024] After sequencing detection, the positive cell lines obtained by screening have a genotype with a double frameshift mutation. Specifically, in the sequence of the TRIM29 gene, one base is deleted and one base is added after the gRNA target (GACCTCCAGCTACTCAGCA), resulting in a double frameshift mutation. The sequencing results are: GACCTCCAGCTACTCAGCA (-1bp) or GACCTCCAGCTACTTCAAGCA (+1bp). In the double-stranded DNA of the positive cell, both complementary DNA chains have produced frameshift mutations (one chain in the double-stranded DNA lacks one base and the other chain adds one base). The screened positive cell line was named TRIM29 gene-modified porcine fibroblast cell line TRIM29 KO and preserved. The taxonomic name is Sus sus, Sus scrofa ( Sus scrofa ), the preservation unit is Guangdong Provincial Microbiological Culture Collection Center, the preservation address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, the preservation date is February 13, 2025, and the preservation number is GDMCC No: 65878.

[0025] Example 2: Preparation of TRIM29 gene-modified pigs.

[0026] The positive cell line obtained in Example 1 (TRIM29 gene modified porcine fibroblast cell line TRIM29 KO) was used as the nuclear donor cell for nuclear transplantation and implanted into the enucleated in vitro matured porcine oocytes. After electric fusion and activation, reconstructed embryos were formed. The reconstructed embryos were surgically implanted into the uterus of recipient sows in estrus at the same time for pregnancy. About 200 reconstructed embryos were transplanted into each recipient. The first B-ultrasound test was performed 30 days after the operation to check whether there was pregnancy, and B-ultrasound was performed regularly thereafter to monitor the pregnancy status. The embryo transplantation status and the birth status of the cloned pigs are shown in Table 1, and the photos of the TRIM29 gene modified positive pigs are shown in Figure 2 The ear skin tissue of cloned pigs was collected to detect the expression of TRIM29 gene. Western blot experiments confirmed that TRIM29 protein was not expressed in TRIM29 gene-modified positive cloned pigs, indicating that the TRIM29 gene was knocked out in the TRIM29 gene-modified positive cloned pigs. The TRIM29 gene-modified pigs were successfully prepared (results as shown in Figure 3 shown).

[0027] Table 1. Summary of gene knockout pig clone preparation Porcine breed of donor cell source Genetically modified type of donor cell Number of transplanted cloned embryos Pregnancy status Number of offspring Number of survivors Large White TRIM29 (-1 / +1) 220 Yes 4 2 Large White TRIM29 (-1 / +1) 220 No Large White TRIM29 (-1 / +1) 220 Yes 7 6 Large White TRIM29 (-1 / +1) 204 Yes 5 4 Large White TRIM29 (-1 / +1) 200 No Large White TRIM29 (-1 / +1) 200 Yes 7 7 Large White TRIM29 (-1 / +1) 200 Yes 8 7 Large White TRIM29 (-1 / +1) 200 No Large White TRIM29 (-1 / +1) 181 No Large White TRIM29 (-1 / +1) 181 No By breeding and expanding TRIM29 gene-modified positive cloned pigs, a new breed of TRIM29 gene-modified positive pigs can be obtained. This new breed of pigs has significant resistance to PRV and may be resistant to a variety of type I IFN-sensitive viruses. It is a broad-spectrum disease-resistant pig breed.

[0028] Example 3: Detection test of disease resistance of TRIM29 gene-modified pigs.

[0029] Six 5-month-old TRIM29 gene-modified pigs and 15 control Large White pigs were selected, placed in a shielded challenge test field, mixed-fed, and allowed to eat and drink freely. Serum samples of the test pigs were collected before challenge to ensure that PRV antigens and antibodies (gB and gE) were negative. The challenge was performed by nasal spray infection with the virus solution. The test period was 9 days, and each pig was infected with 8×10 8 doses of PRV virus (the virus strain PRV isolate GD-YH was preserved, classified and named as porcine alphaherpesvirus Varicellovirus suidalpha 1, The preservation unit is the General Microbiology Center of the China Committee for Culture Collection of Microorganisms. The preservation address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The preservation date is February 17, 2025, and the preservation number is CGMCC No. 46376). After infection, the disease phenotypes of the test pigs were recorded daily, and their body temperatures were measured; throat swabs were collected on days 2, 4, 6, and 8 after infection to detect PRV excretion; sera of each pig were collected on days 7 and 9 after challenge to detect the PRV antibody levels. The viral load was quantified by probe-based quantitative PCR to determine the number of virus copies; antibodies were detected by blocking ELISA to measure the levels of gB and gE antibodies in the sera. The experiment was stopped on day 9, at which time all the control group pigs had died or were in a moribund state. At this time, sera, lungs, brains, and tonsils of all the experimental pigs were collected, fixed with paraformaldehyde and stored at -80 °C respectively, and the collected samples were tested for PRV viral load, IFNɑ, and IFNβ levels. The viral load was quantified by probe-based quantitative PCR to determine the number of virus copies; serum IFNɑ and IFNβ were detected using ELISA kits.

[0030] The results of the body temperature changes of the pigs after challenge are as Figure 5 shown: KO represents TRIM29 gene-modified pigs, and WT represents control group pigs. The results show that the clinical symptoms of TRIM29 gene-modified pigs are milder and the fever temperature is lower, while the clinical symptoms of the control pigs are generally more severe, manifested as high fever. The results of the death situation of the pigs after challenge are as Figure 4 shown: KO represents TRIM29 gene-modified pigs, and WT represents control group pigs. The results show that the mortality rate of TRIM29 gene-modified pigs is lower than that of the control group. The results of the virus excretion levels of the pigs after challenge are as Figure 6 shown: KO represents TRIM29 gene-modified pigs, and WT represents control group pigs. The results show that the virus excretion levels of TRIM29 gene-modified pigs are significantly lower than those of the control group of wild-type Large White pigs on days 2, 4, 6, and 8 (p<0.05). The results of the viral loads in various organs of the pigs after challenge are as Figure 7As shown in [Figure X]: KO represents TRIM29 gene-modified pigs, and WT represents control pigs. The results show that the PRV viral load in the brain, lungs, and tonsils of TRIM29 gene-modified pigs is significantly higher than that of control pigs (p < 0.05). Detection of the serum PRV antibody level shows results as Figure 8 As shown in [Figure X]: KO represents TRIM29 gene-modified pigs, and WT represents control pigs, Figure 8 In the left figure of [Figure X], it represents the expression level of gB antibody. The results show that the gB antibody level in gene-modified pigs is significantly lower than that of control pigs (p < 0.05); while Figure 8 In the right figure of [Figure X], it represents the expression level of gE antibody. The results show that the gE antibody level in gene-modified pigs is significantly lower than that of control pigs (p < 0.05). The detection results of IFNɑ and IFNβ in the serum are as Figure 9 As shown in [Figure X]: KO represents TRIM29 gene-modified pigs, and WT represents control pigs, Figure 9 In the left figure of [Figure X], it represents the expression level of IFNɑ. The results show that the serum IFNɑ expression level in gene-modified pigs is significantly higher than that of control pigs (p < 0.05); Figure 9 In the right figure of [Figure X], it represents the expression level of IFNβ. The results show that the serum IFNβ expression level in gene-modified pigs is significantly higher than that of control pigs (p < 0.05), confirming that TRIM29 has a high level of type I IFN response. The deletion of TRIM29 can significantly improve the disease resistance of gene-modified pigs.

[0031] The above results show that TRIM29 gene-modified pigs have significant disease resistance to PRV. Due to the knockout of the TRIM29 gene, these gene-modified pigs may be resistant to a variety of IFN-sensitive viruses and are a broad-spectrum disease-resistant pig breed.

[0032] Example 4: Preparation of TRIM29 gene-modified positive pigs and cultivation of new breeds.

[0033] In addition to the preparation method in Example 2, the synthesized gRNA nucleotide sequence or the expression vector containing the gRNA nucleotide sequence in Example 1 and the Cas9 expression vector or Cas9 protein can also be injected into the fertilized eggs of pigs, and then the fertilized eggs are transplanted into the uterus of surrogate sows. After the piglets are born, the genotypes of the piglets after the GACCTCCAGCTACTTCAAGCA sequence site or the protein expression of the TRIM29 gene are detected. The positive pigs with the TRIM29 gene knocked out are retained for expansion and breeding, and thus a new breed of TRIM29 gene-modified positive pigs can be obtained. This new breed of pigs has significant disease resistance to PRV and may be resistant to a variety of IFN-sensitive viruses, and is a broad-spectrum disease-resistant pig breed.

[0034] In summary, the present invention prepared cloned positive pigs with TRIM29 gene modification by using gene editing and animal cloning protocols. The cloned positive pigs lack TRIM29 gene expression throughout the body, and the deletion of this gene has no significant impact on the normal physiological functions of animals. Under virus infection conditions, the IFN-I innate immune system of these gene-modified pigs has a more sensitive response, secreting more IFN-I in response to virus infection. Therefore, it has a stronger virus clearance effect in the early stage of virus invasion into the host, reduces the infectivity of the virus to pigs, and improves the survival rate of pigs under virus infection conditions. Through the PRV high-dose challenge test, compared with control pigs of the same breed and age, the TRIM29 gene-modified pigs have significant disease resistance to PRV. Since the TRIM29 gene of these gene-modified pigs is knocked out, they may be resistant to a variety of IFN-sensitive viruses and are a broad-spectrum disease-resistant pig.

Claims

1. A gene editing system that can be used to knockout the porcine TRIM29 gene, wherein, The system includes a gRNA nucleotide sequence or an expression vector containing the gRNA nucleotide sequence and a Cas9 expression vector or Cas9 protein, and the gRNA nucleotide sequence is as shown in SEQ ID No:

1.

2. A TRIM29 gene-modified cell line, wherein, The TRIM29 gene in the cell line is knocked out, and a double-equivalent frameshift mutation genotype is formed at the sequence site of GACCTCCAGCTACTTCAAGCA in the cell line. The double-equivalent frameshift mutation means that one strand of the double-stranded DNA deletes 1 base and the other strand adds 1 base after the sequence site.

3. The cell line according to claim 2, wherein The cell line is the TRIM29 gene-modified porcine fibroblast cell line TRIM29 KO, and the preservation number of the TRIM29 gene-modified porcine fibroblast cell line TRIM29 KO is GDMCC No: 65878.

4. The cell line according to claim 2 or 3, wherein, The cell line is prepared by using the gene modification system described in claim 1.

5. A method for preparing a TRIM29 gene-modified pig, wherein, The method is to inject the gene modification system described in claim 1 into the fertilized eggs of pigs, and then transplant the fertilized eggs into the uterus of a surrogate sow. The TRIM29 gene-modified pigs can be prepared when the piglets are born.

6. A method for preparing a TRIM29 gene-modified pig, wherein, The method can prepare TRIM29 gene-modified pigs by performing somatic cell cloning with the cell line described in claim 2 or 3 as the nuclear donor cell for nuclear transfer.

7. Use of the gene modification system described in claim 1 in the preparation of pseudorabies virus-resistant pigs or the cultivation of new varieties of PRV-resistant pigs.

8. Use of the gene modification system described in claim 1 in the preparation of TRIM29 gene-modified cell lines.

9. Use of the cell line described in claim 3 or 4 in the preparation of porcine antiviral products.

10. Use of the cell line described in claim 3 or 4 in the preparation of pseudorabies virus-resistant pigs or the cultivation of new varieties of PRV-resistant pigs.

Images