A method for constructing an animal model of dilated cardiomyopathy and application thereof

Abstract

The application provides a method for constructing an animal model of dilated cardiomyopathy and application, belongs to the technical field of biological medicine and animal genetic model construction, provides a new zebrafish model of dilated cardiomyopathy, is constructed by specifically overexpressing a truncated dnajb6b gene long isoform fragment in zebrafish myocardial cells, the nucleotide sequence of the gene fragment is shown as SEQ ID NO. 1, and the method for constructing the zebrafish model of dilated cardiomyopathy and application are provided, and it is further found that 4-phenylbutyric acid is applied to the preparation of a drug for treating dilated cardiomyopathy.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and animal genetic model construction technology, specifically relating to a method for constructing and applying an animal model of dilated cardiomyopathy. Background Technology

[0002] Dilated cardiomyopathy (DC) is a common non-ischemic cardiomyopathy. Its main clinical symptoms include ventricular enlargement and impaired cardiac systolic function. Severe DC can lead to heart failure and sudden cardiac death. Statistics show that nearly 50% of sudden deaths or heart transplants in adolescents are caused by DC. In adults, DC is the second leading cause of heart failure after coronary artery disease, accounting for about one-third of all heart failure cases. It is estimated that the incidence of DC in the general population is 0.04-0.4%, affecting more than 2.5 million people worldwide, resulting in a significant medical and socioeconomic burden. Currently, clinical treatment for DC mainly focuses on symptomatic treatment to combat heart failure, with no specific intervention methods. Therefore, exploring the pathogenesis and mechanisms of hereditary DC can facilitate early diagnosis, prevention, and prediction of disease progression, and provide experimental evidence for further development of personalized treatment strategies targeting specific genes and drugs for DC.

[0003] The pathogenesis of dilated cardiomyopathy (DC) is relatively complex, mainly including primary and acquired factors. Primary DC has a strong family history and genetic susceptibility, with gene mutations being a significant cause of hereditary DC. The prevalence of hereditary DC accounts for approximately 30%-50% of all DC cases. To date, more than 50 pathogenic genes for hereditary DC have been identified. The human DNAJB6 gene encodes a B6 member of the DnaJ heat shock protein (Hsp)40 family, functioning as a molecular chaperone protein. It binds to HSP70 and plays a crucial role in maintaining protein homeostasis by preventing protein misfolding and aggregation. The role of DNAJB6 protein in neurodegenerative diseases (such as Huntington's disease) and skeletal muscle health, particularly limb-girdle muscular dystrophy type 1D (LGMD1D), is well-established. However, despite the abundant expression of the DNAJB6 gene in cardiac tissue, its function and mechanism of action in cardiac diseases remain poorly understood.

[0004] Due to the difficulty in obtaining clinical samples and ethical constraints, animal disease models play a crucial role in studying the pathological mechanisms of human diseases and in drug screening. While mice have always been the preferred animal model for studying human diseases, zebrafish, being vertebrates with up to 84% genetic similarity to humans, and possessing advantages such as small size, large numbers, and transparent embryos, have seen widespread development and application in research fields such as genetics of human diseases and drug screening. Particularly in the study of complex cardiovascular diseases, including dilated cardiomyopathy, zebrafish have a baseline heart rate of approximately 100 beats per minute, roughly equivalent to the human heart rate of 60-90 beats per minute; in contrast, mice have a heart rate of approximately 500 beats per minute, significantly different from humans. Furthermore, the action potential of zebrafish cardiac contraction is quite similar to that of humans; zebrafish also exhibit similar signaling pathways and drug metabolism pathways to humans. Therefore, in recent years, zebrafish models have demonstrated unique feasibility advantages in the genetics of cardiovascular diseases such as dilated cardiomyopathy and in drug screening and development.

[0005] Currently, the establishment of dilated cardiomyopathy (DCM) disease models in zebrafish primarily utilizes gene editing and drug-induced techniques. Gene editing mainly employs technologies such as CRISPR / Cas9 or TALEN to systemically knock out or mutate pathogenic genes associated with DCM in humans, such as titin (TTN), β-myosin heavy chain (MYH7), and BAG3 molecular chaperone regulatory genes, to simulate the pathological characteristics of hereditary DCM. Drug-induced models primarily use chemical substances, such as doxorubicin, to induce myocardial cell damage through exposure to doxorubicin (a chemotherapy drug) during the embryonic or juvenile stages, leading to ventricular dilation and decreased contractility, mimicking the secondary pathological process of non-hereditary DCM. The application of gene editing technology in zebrafish DCM disease models has mostly focused on the early embryonic stage, with limited research on adult fish; this is because DCM is typically a progressive systolic dysfunction that usually worsens with age and eventually leads to heart failure. Therefore, it is necessary to establish a dilated cardiomyopathy model in adult zebrafish. However, drug-induced dilated cardiomyopathy models are usually nonspecific, and in addition to inducing myocardial damage, they also have certain side effects on other organs. Summary of the Invention

[0006] In view of the limitations of existing technologies, which are mainly applicable to the early embryonic stage or lack specificity, this invention provides a method for constructing and applying an adult animal model of dilated cardiomyopathy with cardiomyocyte specificity.

[0007] This study, through functional analysis of the zebrafish dnajb6b homolog in dilated cardiomyopathy, discovered that specific overexpression of a truncated long isoform fragment of the dnajb6b gene in cardiomyocytes leads to a typical dilated cardiomyopathy phenotype in 3-month-old adult zebrafish, characterized by significant ventricular enlargement, myocardial damage, and impaired cardiac contractility. This established a novel adult zebrafish model of hereditary dilated cardiomyopathy. Further application of this disease model revealed that 4-phenylbutyric acid (4-PBA), a specific inhibitor of sarcoplasmic reticulum stress response, has a certain therapeutic effect.

[0008] The technical solution of the present invention is as follows:

[0009] A zebrafish model of dilated cardiomyopathy is constructed by specifically overexpressing a truncated long isoform fragment of the dnajb6b gene in zebrafish cardiomyocytes.

[0010] The nucleotide sequence of the gene fragment is shown in SEQ ID NO.1.

[0011] The sequence of SEQ ID NO.1 is as follows:

[0012] ATGGAGGAGGATTATTACCACATCCTTGGTGTCACGAAAAGCGCATCT

[0013] CCTGACGATATAAAGAAAGCGTACAGAAAACTTGCACTAAAATGGCATCCA

[0014] GACAAAAACCCCAATGACAAAGAGGAGGGCGGAGAAAAGGTTCAAAGAAA

[0015] TCTCAGAAGCATATGAAGTCCTGTCAGATGAAAACAAACGGAGAGATTATG

[0016] ATAGATATGGTAAACAAGGCCTCTCTAATAGAGGTGGCCATTACGATGATGA

[0017] ATATATGGGTGGATTCACATTCCGTAACCCAGAAGACGTCTTCAGGGAATTT

[0018] TTTGGAGGTCATGATCCATTTGCAGATTTCTTTGCTGATGACACATTTGAAG

[0019] GTTTCTTTGGTGGGGCCGTCACAGAGGTATGAGCAGGAGCAGGACAGCA

[0020] GGTCCATTCTTTCCTGGATTTTCTCCATTTGGTCCGTCCTTTTCTGGATTTGA

[0021] CACAGGGTTTTCTCCGTTCGGCCCAATGGGTGGAGGAAGCTTCAGCTCATT

[0022] TTCATCGTCTCCATTTGGTGGTGGAGGTGGGATGAGAAACTTCACCTCCAT

[0023] TTCCACATCCACCAAATTCATCAACGGAAAGAGGATCACCACTAAACG.

[0024] The method for constructing the zebrafish model of dilated cardiomyopathy described above includes the following steps:

[0025] (1) A truncated long isoform fragment of the dnajb6b gene was obtained by reverse transcription and PCR, and the nucleotide sequence of the gene fragment is shown in SEQ ID NO.1;

[0026] (2) Using molecular cloning technology, a transgenic overexpression vector plasmid was constructed that specifically overexpresses the gene fragment described in step (1) and the green fluorescent protein encoding gene in zebrafish cardiomyocytes;

[0027] (3) The transgenic overexpression vector plasmid constructed in step (2) is transferred into zebrafish by embryo microinjection. Transgenic zebrafish strains that stably overexpress the gene fusion fragment described in step (2) are obtained in the zebrafish live animal model, which is the zebrafish model of dilated cardiomyopathy.

[0028] According to a preferred embodiment of the present invention, in step (2), the method for constructing the transgenic overexpression vector plasmid includes the following steps:

[0029] ① Total RNA was extracted from the heart tissue of zebrafish Wik strain. A total cDNA library was obtained by reverse transcription (RT) using random primers. Then, dnajb6b(ΔL)-BamHI-F as shown in SEQ ID NO.2 and dnajb6b(ΔL)-Xhol-R as shown in SEQ ID NO.3 was used to amplify the cDNA by PCR to obtain dnajb6b(ΔL)cDNA as shown in SEQ ID NO.1.

[0030] The primer sequences are as follows:

[0031] dnajb6b(ΔL)-BamHI-F SEQ ID NO.2:

[0032] 5'-TAGCGGATCCGCCACCATGGAGGAGGATTATTACCACATCCTTGGTG-3';

[0033] dnajb6b(ΔL)-Xhol-R SEQ ID NO.3:

[0034] 5'-AGCTCTGAGTTGACTGTGAGAGATTTGAGCTGACCGT-3'

[0035] ② The PCR amplification fragment product of the obtained dnajb6b(ΔL) cDNA was cloned into the pENTRI1A plasmid by digestion with BamHI and XhoI restriction sites to obtain the pENTRI1A-dnajb6b(ΔL) plasmid; then the pENTRI1A-dnajb6b(ΔL) plasmid was recombined with p5E-cmlc2, p3E-EGFP-polyA and pDest-Tol2pA plasmids by Gateway LR cloning enzyme II Plus to obtain the pDest-cmlc2:dnajb6b(ΔL) transgenic overexpression plasmid.

[0036] According to a preferred embodiment of the present invention, the method for constructing the transgenic zebrafish strain in step (3) includes the following steps:

[0037] i. The transgenic overexpression vector plasmid constructed in step (2) and the transposase mRNA mixture were injected into wild-type zebrafish 1-cell stage embryos using an embryo injection device, and then cultured.

[0038] ii. Selected injected embryos expressing green fluorescent protein (EGFP) signaling were cultured into adult fish as candidate F0 generation;

[0039] iii. Cross F0 generation adult fish with wild-type zebrafish to obtain F1 generation embryos. Select embryos that are positive for green fluorescent protein to obtain stable transgenic lines. By screening, backcross F1 generation zebrafish with EGFP positive signals in their hearts with wild-type zebrafish and select embryos that are positive for green fluorescent protein to obtain stable F2 generation transgenic lines.

[0040] Further selection of wild-type zebrafish was made from the Wik strain.

[0041] According to a preferred embodiment of the present invention, in step (3), a 3-month-old transgenic zebrafish strain is selected as a zebrafish model of dilated cardiomyopathy.

[0042] The application of the zebrafish model of dilated cardiomyopathy constructed by the above method in screening drugs for the treatment of dilated cardiomyopathy.

[0043] Application of 4-phenylbutyric acid in the preparation of drugs for the treatment of dilated cardiomyopathy.

[0044] According to a preferred embodiment of the present invention, the dilated cardiomyopathy is caused by the specific overexpression of a truncated long isoform fragment of the dnajb6b gene in cardiomyocytes.

[0045] According to a preferred embodiment of the invention, the drug contains one or more pharmaceutically acceptable carriers or excipients.

[0046] More preferably, the excipient is at least one of a sustained-release agent, a filler, a binder, a wetting agent, a disintegrant, a surfactant, or a lubricant.

[0047] According to a preferred embodiment of the present invention, the dosage form of the drug is a capsule, pill, tablet, oral liquid, granule, tincture, or injection.

[0048] The beneficial effects of the present invention include at least the following:

[0049] 1. This invention is the first to discover that specific overexpression of a truncated long isoform fragment of the dnajb6b gene in cardiomyocytes can lead to dilated cardiomyopathy. This invention provides a novel hereditary adult zebrafish model of dilated cardiomyopathy, which has significant clinical guiding value for the gene diagnosis, early prevention, prediction and assessment of disease progression, and design of personalized treatment plans for dilated cardiomyopathy. It can also be used to screen drugs for the treatment of cardiomyopathy.

[0050] 2. This invention not only establishes a new animal model of dilated cardiomyopathy, but also explores in depth the pathological mechanism of dilated cardiomyopathy caused by overexpression of a truncated long isoform fragment of the dnajb6b gene, especially the two key pathological events of increased sarcoplasmic reticulum stress level and misfolded protein aggregation, providing new insights for future treatment and prevention strategies.

[0051] 3. The zebrafish dilated cardiomyopathy model provided by this invention includes multiple indicators of cardiac function, which can better illustrate the successful construction of the model.

[0052] 4. This invention has found that 4-phenylbutyric acid can improve the cardiac phenotype of dilated cardiomyopathy caused by overexpression of a truncated long isoform fragment of the dnajb6b gene, providing a new drug target for the prevention and treatment of dilated cardiomyopathy. Attached Figure Description

[0053] Figure 1The diagram shows the construction of a cDNA sequence encoding a truncated Dnajb6b long isoform protein fragment driven by a promoter specifically overexpressed in cardiomyocytes, referred to as dnajb6b(ΔL), and a control overexpression plasmid containing the wild-type full-length Dnajb6b long isoform protein cDNA sequence, referred to as dnajb6b(L).

[0054] In the figure: A is a schematic diagram of expression plasmid construction; B is a graph showing the results of Western blot analysis of the protein overexpression of a truncated Dnajb6b(ΔL) and the wild-type full-length Dnajb6b(L) control protein.

[0055] Figure 2 A schematic diagram of the somatograph results of adult zebrafish with Tg(cmlc2:dnajb6b[ΔL]-EGFP), or Tg(ΔL) transgenic design for this invention, and adult zebrafish with Tg(cmlc2:dnajb6b[L]-EGFP), or Tg(L) transgenic control design;

[0056] The image shows the heart phenotypes of wild-type zebrafish (WT), Tg(ΔL) transgenic zebrafish, and Tg(L) transgenic control zebrafish at 3 months of age under white light. The arrows indicate that the heart of the Tg(ΔL) transgenic zebrafish is visibly enlarged and protruding.

[0057] Figure 3 This is a schematic diagram showing the comparative results of echocardiographic examination of wild-type zebrafish (WT), Tg(ΔL) transgenic zebrafish and Tg(L) transgenic control zebrafish involved in this invention.

[0058] In the diagram: A represents ejection fraction (EF); B represents shortening fraction (FS).

[0059] Figure 4 Representative images of isolated hearts of 3-month-old wild-type zebrafish (WT), Tg(ΔL) transgenic zebrafish and Tg(L) transgenic control zebrafish, and normalized ventricular surface area (VSA) and body weight (BW / g) are provided for the present invention, n = 8 fish per group;

[0060] In the figure: A is a heart image, and B is the normalized ventricular surface area (VSA) and the quantification of body weight (BW / g).

[0061] Figure 5 This is a schematic diagram showing the comparative results of cardiac histology examination of 3-month-old wild-type zebrafish (WT), Tg(ΔL) transgenic zebrafish and Tg(L) transgenic control zebrafish involved in the present invention;

[0062] Figure 1 shows representative images of H&E staining and quantitative myocardial density; Figure 2 shows the results of transmission electron microscopy (TEM), confirming that Tg(ΔL) transgenic zebrafish exhibited myosarcophagus disorder and abnormal mitochondrial swelling.

[0063] Figure 6 The survival curves of wild-type zebrafish (WT), Tg(ΔL) transgenic zebrafish, and Tg(L) transgenic control zebrafish from 0 to 12 months are presented in this invention.

[0064] Figure 7 Figure A shows the expression detection of protein folding-related proteins in the heart tissue of zebrafish with dilated cardiomyopathy induced by transgenic overexpression of a truncated long isoform fragment of dnajb6b in cardiomyocytes, and Figure B shows the quantitative analysis of these proteins.

[0065] Figure 8 This invention relates to the transcriptional levels of xbp1-s and chop genes, which are genes related to sarcoplasmic reticulum stress response, in the heart tissues of zebrafish with dilated cardiomyopathy induced by transgenes that specifically overexpress a truncated long isoform fragment of dnajb6b in cardiomyocytes and the control group with Tg(L). In the figure, A is an electrophoresis image of xbp1-s and B is the result of quantitative PCR detection of chop gene transcription level.

[0066] Figure 9 This is a schematic diagram of the treatment of zebrafish Tg(ΔL) with 4-phenylbutyric acid, as per the present invention, for dilated cardiomyopathy caused by specific overexpression of a truncated long isoform fragment of dnajb6b in cardiomyocytes.

[0067] Figure 10 This is a schematic diagram showing the comparison of echocardiographic results of transgenic and wild-type zebrafish treated with 4-phenylbutyric acid for one month, as per the present invention. In the diagram, A represents ejection fraction (EF) and B represents fractional shortening (FS).

[0068] Figure 11 The present invention relates to representative images of isolated hearts of wild-type zebrafish (WT), Tg(ΔL) transgenic zebrafish, and Tg(ΔL) transgenic control zebrafish without drug treatment after one month of treatment with 4-phenylbutyric acid, as well as the normalization of ventricular surface area (VSA) and quantification of body weight (BW / g), n = 8 fish per group;

[0069] In the figure, A is a heart image, and B is the normalized ventricular surface area (VSA) and the quantification of body weight (BW / g).

[0070] Figure 12This diagram illustrates the comparative results of cardiac histology examination of wild-type control zebrafish and Tg(ΔL) transgenic zebrafish after one month of treatment with 4-phenylbutyric acid (4-phenylbutyric acid). Figure AB shows representative H&E staining images and quantitative myocardial density of cardiac tissue from 3-month-old wild-type zebrafish (WT), Tg(ΔL) transgenic zebrafish treated with 4-phenylbutyric acid (PBS), and Tg(ΔL) transgenic zebrafish after 4-phenylbutyric acid treatment. Figure C shows the results of transmission electron microscopy (TEM).

[0071] Figure 13 The survival curves of wild-type control zebrafish and Tg(ΔL) transgenic zebrafish, as described in this invention, after one month of treatment with 4-phenylbutyric acid.

[0072] Figure 14 The diagram A and quantitative diagram B show the cardiomyocyte apoptosis of wild-type control zebrafish and Tg(ΔL) transgenic zebrafish after one month of treatment with 4-phenylbutyric acid, as per the present invention. Detailed Implementation

[0073] The technical solution of the present invention will be further described below with reference to the embodiments, but the scope of protection of the present invention is not limited thereto.

[0074] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0075] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0076] Source of reagent materials:

[0077] Zebrafish source: National Zebrafish Resource Center, Wuhan;

[0078] The plasmids pENTRI1A, p5E-cmlc2, p3E-EGFP-polyA, and pDest-Tol2pA were derived from Invitrogen and Addgene, respectively.

[0079] 1. It was discovered that specific overexpression of a truncated long isoform fragment of dnajb6b, abbreviated as dnajb6b(ΔL), was found in cardiomyocytes, leading to dilated cardiomyopathy and heart failure.

[0080] To investigate the function and mechanism of action of the dnajb6b gene in dilated cardiomyopathy and heart failure, the inventors constructed a transgenic line that specifically overexpresses the dnajb6b(ΔL) isoform fragment in cardiomyocytes, driven by the cardiac myosin light chain 2 (cmlc2) promoter, and named it Tg(cmlc2:dnajb6b[ΔL]-EGFP), abbreviated as Tg(ΔL). As a control, the inventors also constructed a transgenic line that specifically overexpresses the wild-type full-length dnajb6b long isoform, abbreviated as dnajb6b(L), in cardiomyocytes, and named it Tg(cmlc2:dnajb6b[L]-EGFP), abbreviated as Tg(L).

[0081] First, Western blot results confirmed high-level expression of Dnajb6b(ΔL) and Dnajb6b(L) proteins in the heart tissue of their respective transgenic lines. Second, cardiac phenotypic analysis revealed that the Tg(ΔL) transgenic line exhibited significant ventricular enlargement and decreased cardiac function at 3 months of age. In contrast, the Tg(L) transgenic line showed no obvious abnormalities. Histological analysis using H&E staining and ultrastructural analysis using transmission electron microscopy revealed extensive myofibril damage and mitochondrial swelling in the heart tissue of the Tg(ΔL) transgenic line, while the Tg(L) transgenic control line showed no significant abnormalities. Third, at the molecular level, the inventors detected abnormal activation of the molecular marker genes nppa and nppb for dilated cardiomyopathy and heart failure in the heart tissue of the Tg(ΔL) transgenic line. In contrast, this abnormality was not detected in the Tg(L) transgenic control line. Finally, survival curve analysis showed that the Tg(ΔL) transgenic strain began to die from 4 months of age, with only about 60% of the fish surviving to 12 months. In contrast, the survival rate of the Tg(L) control strain was comparable to that of the wild-type strain.

[0082] In summary, these experimental results indicate that specific overexpression of dnajb6b(ΔL) in cardiomyocytes can lead to dilated cardiomyopathy and heart failure in adult zebrafish.

[0083] 2. It was discovered that the Dnajb6b protein regulates cardiac contraction, sarcoplasmic reticulum stress response, and protein quality control through interaction with the Grp78 protein.

[0084] To elucidate the pathogenic mechanism of dilated cardiomyopathy and heart failure caused by specific overexpression of dnajb6b(ΔL) in cardiomyocytes, the inventors hypothesized that the sustained increase in sarcoplasmic reticulum stress response levels and the accumulation of misfolded proteins in the heart tissue of the Tg(ΔL) transgenic line are the main pathological events. First, the inventors demonstrated a direct interaction between the long isoform of human DNA JB6(L) and the GRP78 protein, a molecular marker of sarcoplasmic reticulum stress response, in HEK 293T cells. Second, the inventors detected a significant upregulation of the dnajb6b(L) transcript after treatment with tunicamycin, a sarcoplasmic reticulum stress response stimulant, using in situ hybridization and quantitative RT-PCR. Third, the inventors detected significantly increased accumulation levels of Grp78, LC3II, and ubiquitinated proteins in the heart tissue of the Tg(ΔL) transgenic line. Meanwhile, at the transcriptional level, the inventors detected a significant upregulation of the expression of two molecular marker genes for sarcoplasmic reticulum stress response, including the spliceosome of xbp1-s and chop.

[0085] The above experimental results indicate that Dnajb6b is responsive to sarcoplasmic reticulum stress. The continuous accumulation of sarcoplasmic reticulum stress and misfolded protein aggregation is likely the main pathogenic mechanism by which Tg(ΔL) transgenes lead to dilated cardiomyopathy and heart failure phenotypes.

[0086] 3. It was found that the sarcoplasmic reticulum stress response inhibitor 4-phenylbutyric acid can partially salvage the symptoms of dilated cardiomyopathy and heart failure caused by cardiomyocyte-specific overexpression of dnajb6b(ΔL).

[0087] To further investigate whether the sustained increase in sarcoplasmic reticulum stress response levels and the accumulation of misfolded proteins are sufficient to lead to dilated cardiomyopathy and heart failure phenotypes in the Tg(ΔL) transgenic line, the inventors tested the potential therapeutic effects of the sarcoplasmic reticulum stress response inhibitor 4-phenylbutyric acid (4-PBA). First, the inventors optimized the therapeutic dose of 4-PBA via gavage to ensure its effective reduction of the sustained activation of the molecular marker protein Grp78, representing the sarcoplasmic reticulum stress response level, in the cardiac tissue of the Tg(ΔL) transgenic line. Subsequently, 4-PBA treatment was initiated at 2 months of age, before the appearance of obvious dilated cardiomyopathy and heart failure phenotypes in the Tg(ΔL) transgenic line. The results showed that after one month of 4-PBA treatment, the ventricular enlargement phenotype in the Tg(ΔL) transgenic line was significantly suppressed, and its cardiac function was significantly improved. At the histological and ultrastructural levels, 4-PBA treatment significantly slowed the sarcomere degeneration phenotype in the cardiac tissue of the Tg(ΔL) transgenic line. At the cellular level, 4-PBA treatment effectively reduced apoptosis, inhibited the loss of cardiomyocytes, and ultimately improved the overall survival rate of transgenic fish.

[0088] In summary, these findings indicate that the sarcoplasmic reticulum stress response inhibitor 4-phenylbutyric acid (4-PBA) can significantly treat dilated cardiomyopathy and heart failure phenotypes caused by specific overexpression of dnajb6b(ΔL) in cardiomyocytes.

[0089] Example 1

[0090] This embodiment 1 relates to a novel method for constructing a zebrafish model of dilated cardiomyopathy, which is obtained by transgenic overexpression of a truncated long isoform fragment of the dnajb6b gene in a live zebrafish animal model. The specific steps are as follows:

[0091] (1) Total RNA was extracted from the heart tissue of zebrafish Wik strain. A total cDNA library was obtained by reverse transcription (RT) using random primers. Then, dnajb6b(ΔL)cDNA was amplified by PCR using primers dnajb6b(ΔL)-BamHI-F as shown in SEQ ID NO.2 and dnajb6b(ΔL)-Xhol-R as shown in SEQ ID NO.3 to obtain dnajb6b(ΔL)cDNA as shown in SEQ ID NO.1. Full-length wild-type control cDNA of dnajb6b(L) was amplified by PCR using primers dnajb6b(L)-BamHI-F as shown in SEQ ID NO.4 and dnajb6b(L)-Xhol-R as shown in SEQ ID NO.5 to obtain dnajb6b(L)cDNA.

[0092] Primer sequences:

[0093] dnajb6b(ΔL)-BamHI-F SEQ ID NO.2:

[0094] 5'-TAGCGGATCCGCCACCATGGAGGAGGATTATTACCACATCCTTGGTG-3';

[0095] dnajb6b(ΔL)-Xhol-R SEQ ID NO.3:

[0096] 5'-AGCTCTGAGTTGACTGTGAGAGATTTGAGCTGACCGT-3';

[0097] dnajb6b(L)-BamHI-F SEQ ID NO.4:

[0098] 5'-TAGCGGATCCGCCACCATGGAGGAGGATTATTACCACATCCTTGGTG-3';

[0099] dnajb6b(L)-Xhol-R SEQ ID NO.5:

[0100] 5'-AGCTCTCGAGCATTTGCTGTCCAGTCGGAGTAACTGC-3'.

[0101] (2) The PCR amplification products of the truncated dnajb6b(ΔL) and full-length wild-type dnajb6b(L) control cDNA were then cloned into the pENTRI1A plasmid (Invitrogen) by digestion with BamHI and XhoI restriction sites, respectively, to obtain pENTRI1A-dnajb6b(ΔL) and pENTRI1A-dnajb6b(L) plasmids. Then, the pENTRI1A-dnajb6b(ΔL) or pENTRI1A-dnajb6b(L) plasmids were recombined with p5E-cmlc2, p3E-EGFP-polyA and pDest-Tol2pA plasmids using Gateway LR cloning enzyme II Plus to obtain the final pDest-cmlc2:dnajb6b(ΔL) and pDest-cmlc2:dnajb6b(L) transgenic overexpression plasmids.

[0102] (3) Preparation of injection needle: Before microinjection, a 1 mm capillary tube is made into a needle capable of microinjection using a needle puller. Extra care should be taken when making the microinjection needle to prevent the needle tip from breaking. The approximately 50 pg of the final pDest-cmlc2:dnajb6b(ΔL) or pDest-cmlc2:dnajb6b(L) control transgene overexpression recombinant plasmid obtained above is mixed with 50 pg of transposase mRNA, and after adding phenol red indicator, it is injected into the microinjection needle using an Eppendorf long pipette tip to avoid air bubbles in the injection needle.

[0103] (4) Microinjection: 50 ng of pDest-cmlc2:dnajb6b(ΔL) or pDest-cmlc2:dnajb6b(L) control transgenic overexpression recombinant plasmid and 50 pg of transposase mRNA were injected into wild-type zebrafish Wik strain 1-cell embryos using an embryo injector. At least 200 embryos were injected. The embryos injected with the recombinant plasmid and 50 pg of transposase mRNA mixture were placed in embryo culture dishes and embryo culture medium (0.292 g / L NaCl, 0.013 g / L KCl, 0.044 g / L CaCl2, 0.081 g / L MgSO4, pH 7.2) was added. At the same time, some uninjected embryos from the same batch were reserved as wild-type control group. All embryos were placed in a 28.5℃ incubator for culture.

[0104] (5) Determining the success of transgene overexpression: Embryos were anesthetized with 0.16 mg / ml tricaine solution (Argent Chemical Laboratories) 2-5 days after fertilization to stop the heartbeat. Injected embryos expressing green fluorescent protein (EGFP) signaling were screened using a Zeiss microscope and cultured as candidate F0 generation to adult fish;

[0105] (6) The F0 generation adult fish were crossed with wild-type zebrafish to obtain F1 generation embryos. Embryos that were positive for green fluorescent protein were screened, which were the stable transgenic fish lines Tg(cmlc2:dnajb6b[ΔL]-EGFP) and Tg(cmlc2:dnajb6b[L]-EGFP). By screening, zebrafish with EGFP positive signals in the hearts of about 50% of the individuals in the F1 generation were backcrossed with wild-type zebrafish, and embryos that were positive for green fluorescent protein were screened again to obtain stable F2 generation transgenic lines. The size of the overexpressed protein was confirmed to be as expected by immunoblotting. The identified stable F2 generation transgenic lines Tg(cmlc2:dnajb6b[ΔL]-EGFP) (abbreviated as Tg(ΔL) and Tg(cmlc2:dnajb6b[L]-EGFP) (abbreviated as Tg(L)) were used for subsequent experiments. Figure 1 A schematic diagram of the construction of transgenic lines and the results of Western blot experiments to verify the results.

[0106] Example 2

[0107] Example 2 involves an experimental analysis of the effect of transgenic overexpression of a truncated long isoform fragment of the dnajb6b gene on the cardiac function of zebrafish, including the following:

[0108] (1) Live heart observation at 3 months of age: Wild-type zebrafish (WT), Tg(ΔL) transgenic zebrafish, and Tg(L) transgenic control zebrafish were anesthetized with 0.02% tricaine for 5 minutes. The zebrafish were placed sideways and the heart outline was observed 1-2 cm below the gills using a 2.5x magnified Leica stereomicroscope. Photos were taken and recorded. The results are as follows: Figure 2 As shown.

[0109] from Figure 2 The white light phenotype showed that the Tg(ΔL) transgenic zebrafish exhibited significant cardiac enlargement and protrusion at 3 months of age, a phenotype not observed in wild-type zebrafish (WT) or Tg(L) transgenic control zebrafish.

[0110] (2) In vivo echocardiography at 3 months of age: Cardiac function parameters of adult zebrafish were measured and analyzed using a 50MHz (MX700) Vevo 3100 high-frequency imaging system. Acoustic gel was applied to the probe surface to provide adequate coupling with the tissue interface. 3-month-old adult zebrafish were anesthetized with 0.02% tricaine for 5 minutes and placed ventrally-upright in a sponge. The 50MHz (MX700) sensor was positioned above the zebrafish to provide sagittal imaging of the heart. B-mode images were taken with an axial imaging field of view of 8.00 mm, a lateral imaging field of view of 8.73 mm, a frame rate of 152 Hz, moderate persistence, and a focus on the center of the heart. Image quantification was performed using data packets in the VevoLAB workstation. Ventricular size was measured based on the ultrasound images, using the following parameters: ejection fraction and shortening fraction; results are as follows: Figure 3 As shown in AB.

[0111] from Figure 3 The results from AB show that the cardiac ejection fraction and shortening fraction (FS) of 3-month-old Tg(ΔL) transgenic zebrafish were significantly lower than those of wild-type zebrafish (WT) and Tg(L) transgenic control zebrafish.

[0112] (3) Measurement of ventricular surface area to body weight ratio: Zebrafish aged 3 months were anesthetized and weighed (BW). The heart of a single zebrafish was then dissected, and the ventricular surface area (VSA) was measured using a Leica stereomicroscope with millimeter-scale imaging. Results are as follows: Figure 4 As shown.

[0113] from Figure 4 It can be seen that 3-month-old Tg(ΔL) transgenic zebrafish exhibited a significant ventricular dilation phenotype, which was not observed in wild-type zebrafish (WT) or Tg(L) transgenic control zebrafish.

[0114] (4) Histology: Hearts were immediately fixed with 4% formaldehyde fixative after euthanasia at 3 months of age, embedded in paraffin, and sections were stained with hematoxylin and eosin (H&E). Images were taken using a Nikon Ni-U imaging system, and trabecular muscle density was quantitatively measured using ImageJ software. Figure 5 As shown in AB.

[0115] from Figure 5 As can be seen from AB, the heart tissue of 3-month-old Tg(ΔL) transgenic zebrafish showed a significant decrease in sarcomere density compared to wild-type zebrafish (WT) and Tg(L) transgenic control zebrafish, as indicated by H&E staining. This suggests that Tg(ΔL) transgenic zebrafish suffer from myofibril damage in the myocardium.

[0116] (5) Transmission Electron Microscopy (TEM): In the TEM study, zebrafish hearts were immediately fixed at room temperature in a fixative solution (0.1M pH 7.2 phosphate buffer containing 4% paraformaldehyde and 1% glutaraldehyde) for 1 hour, and then incubated overnight at 4°C. The fixed samples were subsequently processed and imaged using an HT7800 transmission electron microscope by Wuhan SECCO Biotechnology Co., Ltd. Results are shown below. Figure 5 As shown in C.

[0117] Figure 5 Chinese clinical studies have confirmed that 3-month-old Tg(ΔL) transgenic zebrafish exhibited abnormal mitochondrial swelling. Figure 5 The results of the AC study showed that Tg(ΔL) transgenic zebrafish exhibited abnormal morphology of myocardial fibers and mitochondria, which could affect normal heart function.

[0118] Figure 6 Survival analysis showed that Tg(ΔL) transgenic zebrafish began to die at 4 months old, with only about 60% surviving to 12 months; in contrast, the survival rate of Tg(L) transgenic control zebrafish was comparable to that of wild-type zebrafish in the same group.

[0119] The above results indicate that 3-month-old Tg(ΔL) transgenic zebrafish exhibited a dilated cardiomyopathy phenotype.

[0120] Example 3

[0121] This Example 3 describes the expression of protein folding-related proteins in zebrafish with dilated cardiomyopathy induced by specific overexpression of a truncated long isoform fragment of dnajb6b in cardiomyocytes. The steps are as follows:

[0122] Three 3-month-old wild-type zebrafish (WT), three Tg(ΔL) transgenic zebrafish, and three Tg(L) transgenic control zebrafish were euthanized by soaking in 0.032% triacetylglycerol solution for 10 minutes, and then the heart tissue was dissected. The heart tissue was washed with PBS and transferred to RIPA buffer supplemented with a mixture of protease inhibitors (Roche Diagnostic). The tissue was homogenized using a Bullet Blender (Next Advance Inc). The homogenate was centrifuged at 10,000g for 20 min at 4°C, and the supernatant was collected for protein concentration determination (502 nm). Based on the measured protein concentration, each group was adjusted to an isostatic concentration, and 30 mg of protein was loaded onto a 12% SDS-PAGE gel for separation. The separation conditions were 70V for 50 min; 120V for 2 h until bromophenol blue reached the bottom of the gel, at which point electrophoresis was stopped and the power was turned off. Transfer Procedure: First, activate the PVDF by soaking it in methanol for at least 1 minute, then transfer it to pre-cooled transfer buffer at 4°C. Simultaneously, soak 6 sheets of filter paper in the pre-cooled transfer buffer. Next, remove the electrophoresis plate, pry open the glass short plate with a pry bar, and cut off any excess from the stacking gel. Use the pry bar to transfer the separating gel into the pre-cooled transfer buffer. Lay the black negative electrode of the transfer clamp flat in the water tank containing the transfer buffer, then lay out the sandwich structure. "Sandwich Structure": (Negative Electrode) Blackboard + Sponge + 3 layers of filter paper (soaked in transfer buffer) (remove air bubbles with a glass rod) + Gel + PVDF Membrane (to avoid air bubbles between the gel and PVDF membrane, add a few drops of transfer buffer to the gel, take the PVDF membrane, let one side touch the edge of the gel first, and slowly lower it to adhere) + 3 layers of filter paper + Sponge + Whiteboard. Finally, close the clamp and place the membrane in the transfer tank (black side corresponding to the negative electrode, red side to the positive electrode). Position the sandwich structure in the transfer tank (positive and negative electrodes aligned), add the rotor and ice pack, or place it in a 4°C freezer under constant current of 400 mA in an ice-water bath for 50 minutes for transfer. After transfer, turn off the power, recover the filter paper, wet the PVDF membrane with transfer buffer, place it in a pre-cut plastic bag, and cut the target band. The molecular weight of Grp78 protein is 78 kDa, Lc3II protein is 13 kDa, Ubiquitin protein is approximately 10-250 kDa, and the internal control Actin protein is 42 kDa.Dissolve the HRP-labeled secondary antibody in 5% skim milk and block the membrane at room temperature with shaking for 1 hour. Wash the blocked PVDF membrane three times with TBST washing buffer for 5 minutes each time. Then, dilute the primary antibodies anti-Grp78 (1:2000, Novus Biologicals LLC, catalog#NBP-06274), anti-LC3 (1:3000, Cell Signaling Technology, catalog#12741), anti-β-Actin (1:5000, Santa Cruz Biotechnology, catalog#sc-1615), and anti-Ubiquitin (1:2000, Thermo Fisher Scientific, catalog#PA5-17067) with 5% BSA according to the same dilution ratio. Incubate overnight at 4°C. After recovering the primary antibody, wash the membrane four times with TBST for 10 minutes each time. Secondary antibody incubation: Dilute the HRP-labeled secondary antibody with the above 5% BSA and incubate at room temperature with shaking for 1 hour. Washing: After discarding the secondary antibody, wash the membrane four times with TBST for 10 minutes each time, and finally develop. Analyze the protein bands using Image J (see image). Figure 7 .

[0123] This invention delves into the pathological mechanism of dilated cardiomyopathy induced by the specific overexpression of a truncated long isoform fragment of the dnajb6b gene in cardiomyocytes. Given previous reports that endogenous mouse dnajb6 protein co-localizes with nuclear membrane proteins LaminA / C, and that after treatment with the sarcoplasmic reticulum stress inducer tunicamycin, it can translocate to the sarcoplasmic reticulum (SR) lumen, partially co-localizing with the sarcoplasmic reticulum protein glucose-regulated protein 78 (Grp78), the inventors focus on the pathological mechanism of protein misfolding and elevated sarcoplasmic reticulum stress levels in dilated cardiomyopathy induced by the overexpression of a truncated long isoform fragment of the dnajb6b gene. In the inventors' newly established zebrafish model of dilated cardiomyopathy, as... Figure 7 As shown in Figure AB, at 3 months of age, significantly elevated levels of aggregated proteins related to protein folding, such as Grp78, LC3II, and ubiquitinated proteins, were detected. This indicates that the accumulation of misfolded protein aggregates is one of the pathogenic mechanisms in Tg(ΔL) transgenic zebrafish.

[0124] Example 4

[0125] This Example 4 involves the transcriptional expression of genes related to sarcoplasmic reticulum stress in zebrafish with dilated cardiomyopathy induced by specific overexpression of a truncated long isoform fragment of dnajb6b in cardiomyocytes. The steps are as follows:

[0126] Three 3-month-old wild-type zebrafish (WT), three Tg(ΔL) transgenic zebrafish, and three Tg(L) transgenic control zebrafish were collected. Total RNA was extracted from the hearts of adult fish using 400 μL Trizol reagent (ThermoFisher Scientific) according to the manufacturer's instructions. The tissue was then homogenized using a Bullet Blender (Next Advance Inc). Two-fifths volume of RNase-free ddH2O (160 μL per 400 μL RNA-easy solution) was added to the homogenized tissue, and the mixture was inverted and mixed thoroughly. After standing at room temperature for 5 min, the mixture was centrifuged at 20°C, 12000g, for 15 min. After centrifugation, the solution separated into an upper aqueous phase and a dark lower precipitate (containing proteins, DNA, polysaccharides, and other impurities). The supernatant was collected into another homogenizing tube, and an equal volume of 400 μL isopropanol was added. The mixture was gently inverted and mixed thoroughly, and the mixture was incubated at room temperature for 10 min. The mixture was then centrifuged at 20°C, 12000g, for 10 min. Note: After centrifugation in this step, you will see a white, lumpy precipitate at the bottom of the centrifuge tube, which is RNA. Sometimes, the precipitate may not aggregate and disperse on the tube wall; carefully aspirate the supernatant along the liquid surface when discarding it. Remove the supernatant, add 400 μL of 75% ethanol, gently invert the tube to allow the RNA to bounce, and invert several times. Then centrifuge at 20°C, 9100g, for 3 min. Remove the ethanol, centrifuge briefly at 20°C, aspirate to remove excess water, and air dry for 3 min. Add 10 μL of DEPC to the precipitate and dissolve it by pipetting and mixing repeatedly until the RNA is completely dissolved. Perform genomic DNA removal and reverse transcription, and finally, perform real-time quantitative PCR. See the results analysis below. Figure 8 .

[0127] Figure 8 It was confirmed that, compared with wild-type zebrafish (WT) and Tg(L) transgenic control zebrafish, the transcription levels of two sarcoplasmic reticulum stress-related genes, xbp1-s and chop, were significantly increased in 3-month-old Tg(ΔL) transgenic zebrafish. This indicates that elevated sarcoplasmic reticulum stress levels are a second pathogenesis mechanism in Tg(ΔL) transgenic zebrafish.

[0128] Combining the results of Examples 3 and 4, it can be concluded that increased sarcoplasmic reticulum stress and accumulation of misfolded proteins are significant pathological events of abnormal cardiac function in Tg(ΔL) transgenic zebrafish.

[0129] Example 5

[0130] This implementation relates to the application of 4-phenylbutyric acid in improving symptoms of dilated cardiomyopathy and heart failure caused by specific overexpression of dnajb6b(ΔL) in cardiomyocytes, specifically:

[0131] Treatment of the Tg(ΔL) transgenic zebrafish constructed in Example 1 with 4-phenylbutyric acid can improve or partially salvage the zebrafish phenotypes such as ventricular enlargement, abnormal cardiac function, and decreased survival rate.

[0132] A wild-type control group, a Tg(ΔL) transgenic zebrafish control group without medication, and a Tg(ΔL) transgenic zebrafish treatment group with medication were set up. The wild-type and unmedicated control groups were administered phosphate-buffered saline (PBS) by gavage, while the treatment group was administered 4-phenylbutyric acid (4-PBA) by gavage at a dose of 200 μg / g body weight. The dosage was standardized to 2 μL per fish. Both the control and treatment groups received oral gavage five days a week for four weeks. See [link to relevant documentation]. Figure 9 Following the method described in Example 2 for detecting cardiac function in adult zebrafish, the ejection fraction, shortening fraction, ventricular size, changes in trabecular bone, survival rate, and cardiomyocyte apoptosis were observed in each group of zebrafish. Results are shown below. Figure 10 , Figure 11 , Figure 12 , Figure 13 , Figure 14 .

[0133] The results showed that, compared with the untreated control group of Tg(ΔL) transgenic zebrafish, the cardiac function of Tg(ΔL) transgenic zebrafish was significantly improved after one month of 4-phenylbutyric acid (4-PBA) treatment, with significantly increased ejection fraction (EF) and fractional shortening (FS). Ventricular dilation was also significantly reduced after 4-PBA treatment. At the histological and ultrastructural levels, 4-PBA treatment significantly slowed down the myosarcoma degeneration phenotype in the heart tissue of the Tg(ΔL) transgenic strain, and mitochondrial swelling was also alleviated after treatment. At the cellular level, 4-PBA treatment significantly inhibited the increase in cell death, as evidenced by the decrease in the TUNEL index, ultimately improving the overall survival rate of the fish. This indicates that 4-phenylbutyric acid has a therapeutic effect on dilated cardiomyopathy caused by specific overexpression of dnajb6b(ΔL) in cardiomyocytes.

[0134] This invention is the first to discover that specific overexpression of a truncated long isoform fragment of the dnajb6b gene in myocardial tissue is a primary factor leading to dilated cardiomyopathy, providing a novel zebrafish model of dilated cardiomyopathy. Furthermore, it elucidates the molecular mechanism of the dnajb6b gene in dilated cardiomyopathy and heart failure, highlighting its crucial role in maintaining protein homeostasis within cardiomyocytes. In the hearts of Tg(ΔL) transgenic zebrafish, accumulation of ubiquitinated proteins, elevated endoplasmic reticulum stress markers, and abnormal activation of autophagy were detected, highlighting the central role of the dnajb6b protein in promoting protein folding, preventing aggregation, and promoting the degradation of misfolded proteins through proteasome and autophagy pathways.

[0135] The novel dilated cardiomyopathy model established in this invention can be used to screen for drugs that can prevent / treat dilated cardiomyopathy caused by potential DNA JB6 gene mutations. Data provided by the inventors show that treatment with 4-PBA can partially alleviate the dilated cardiomyopathy phenotype in animals with specific overexpression of dnajb6b(ΔL) in cardiomyocytes and prolong their lifespan. This has significant clinical guiding value for the early prevention of dilated cardiomyopathy, the prediction and assessment of disease progression, and the design of personalized treatment plans.

Claims

1. A method for constructing a zebrafish model of dilated cardiomyopathy, characterized in that, Includes the following steps: (1) Obtain a truncated segment by reverse transcription and PCR. dnajb6b The long isoform fragment of the gene was named... dnajb6b( L) The nucleotide sequence of the gene fragment is shown in SEQ ID NO.1; (2) Using molecular cloning technology, a transgenic overexpression vector plasmid fused with the gene fragment in step (1) and the green fluorescent protein encoding gene was constructed in zebrafish cardiomyocytes; (3) The transgenic overexpression vector plasmid constructed in step (2) is transferred into zebrafish by embryo microinjection. Transgenic zebrafish strains that stably overexpress the gene fusion fragment described in step (2) are obtained in the zebrafish live animal model, which is the zebrafish model of dilated cardiomyopathy. In step (3), 3-month-old transgenic zebrafish were selected as zebrafish models of dilated cardiomyopathy.

2. The construction method as described in claim 1, characterized in that, In step (2), the method for constructing the transgenic overexpression vector plasmid includes the following steps: ① Total RNA was extracted from the heart tissue of zebrafish strain Wik, and a total cDNA library was obtained by reverse transcription using random primers. Then, primer dnajb6b ( L)-BamHI-F as shown in SEQ ID NO.2, and dnajb6b( L)-Xhol-R, as shown in SEQ ID NO.3, was obtained by PCR amplification. dnajb6b( L) The cDNA of the gene fragment is shown in SEQ ID NO.1; ② The obtained dnajb6b( L) The PCR amplification product of cDNA was cloned into the pENTRI1A plasmid by restriction enzyme digestion at BamHI and XhoI sites, yielding pENTRI1A-dnajb6b. L) plasmid; Then the pENTRI1A-dnajb6b ( The L) plasmid was recombined with p5E-cmlc2, p3E-EGFP-polyA, and pDest-Tol2pA plasmids using Gateway LR cloning enzyme II Plus to obtain the final pDest-cmlc2: dnajb6b( L) Transgenic overexpression plasmid.

3. The construction method as described in claim 1, characterized in that, In step (3), the method for constructing the transgenic zebrafish strain includes the following steps: i The transgenic overexpression vector plasmid constructed in step (2) and the transposase mRNA mixture were injected into wild-type zebrafish 1-cell stage embryos using an embryo injection device, and then cultured. ii. Selected embryos expressing green fluorescent protein signals were used as candidate F0 generation fish to grow into adult fish; iii. Cross F0 generation adult fish with wild-type zebrafish to obtain F1 generation embryos. Select embryos that are positive for green fluorescent protein to obtain stable transgenic lines. Select F2 generation transgenic lines by backcrossing F1 generation zebrafish with EGFP positive signals in their hearts with wild-type zebrafish and selecting embryos that are positive for green fluorescent protein.

4. The construction method as described in claim 3, characterized in that, Wild-type zebrafish are of the Wik strain.

5. The use of the zebrafish model of dilated cardiomyopathy constructed by the method of any one of claims 1-4 in screening drugs for the treatment of dilated cardiomyopathy. 6,4-Phenylacetic acid in the preparation of drugs for treating dilated cardiomyopathy; The dilated cardiomyopathy is caused by the specific overexpression of a truncated segment in cardiomyocytes. dnajb6b Dilated cardiomyopathy caused by a long isoform fragment of a gene, the nucleotide sequence of which is shown in SEQ ID NO.

1.

7. The application as described in claim 6, characterized in that, The drug contains one or more pharmaceutically acceptable carriers or excipients.

8. The application as described in claim 7, characterized in that, The excipient is at least one of a sustained-release agent, filler, binder, wetting agent, disintegrant, surfactant or lubricant.

9. The application as described in claim 6, characterized in that, The dosage form of the drug is capsule, pill, tablet, oral liquid, granule, tincture or injection.

Images