Spy transposon system and gene transfer method mediated by Spy transposon system

Abstract

The invention belongs to the field of animal gene engineering, and relates to a Spy transposon system and a gene transfer method mediated by the Spy transposon system, the Spy transposon system comprises cgSpy and cvSpy transposon and transposase; through cell verification, the cgSpy and cvSpy vector systems can effectively mediate gene transfer, and have great application potential in transgenic animal preparation and gene therapy.

Description

Technical Field

[0001] The present invention belongs to the field of animal genetic engineering, and relates to a Spy transposon system and a gene transfer method mediated thereby. At the same time, the present invention also discloses a method for constructing a transgenic donor plasmid, a eukaryotic expression of a transposase and an in vitro transcription-assisted plasmid involved in the method, and its applications in the preparation of transgenic animals, the study of gene functions and human gene therapy. Background Art

[0002] In recent years, studies have shown that transposons are widely distributed in the genomes of organisms, can transpose, and are decisive factors for genome expansion, having important effects on the genomic structure and evolution of organisms. Transposons are the largest component in mammals. Annotated by bioinformatics methods, it can be found that transposons account for 48.49% of the human genome, 48.79% of chimpanzees, 41.73% of mice, etc. The proportion in birds is relatively small, such as only about 10% of the genome in chickens. While the proportion in corn is the largest, accounting for about 80%. Therefore, the study of transposable components at the genomic level has become a research hotspot in the post-genomic era. Gene transfer is an important current biotechnology means, which can mediate the stable integration of foreign genes into the host chromosome, so it has important application values in the fields of studying gene functions, preparing transgenic organisms and human gene therapy.

[0003] A transposon refers to a DNA sequence that can move and jump freely, and plays an important role in genome evolution, species differentiation and the formation of varieties (lines). Transposons can be divided into two categories according to the transposition mechanism. The first type of transposon (Class I), also known as retrotransposon, transposes through the "copy and paste" mechanism, in which the RNA intermediate is reverse transcribed into cDNA as a copy and integrated into the genome. The second type of transposon (Class II), also known as DNA transposon, does not produce RNA intermediates, and is usually in the form of DNA to DNA, that is, transposes in the "cut and paste" manner, or in the helical state, replicates through the DNA intermediate in the "peel and paste" replication mechanism.

[0004] Spy transposons are a group of transposons that transpose in a "cut and paste" manner and have been identified in the silkworm genome. Like PIF / Harbinger, ISL2EU, Pangu, NuwaI, and NuwaII, Spy transposons are evolutionarily related and are classified into the same superfamily called "PHIS". This superfamily exhibits high polymorphism in terms of target sequences, coding capabilities, and conserved motifs of transposases. In addition, Spy transposons differ from most known DNA transposons in that they strongly prefer to insert into the AAATTT motif and there is no target site duplication (TSDs) upon insertion. Compared with established transposons such as PS, ZB, SB, PB, and Tol2, these unique characteristics may provide different potential applications in gene therapy and transgenesis.

[0005] The use of transposons for human gene therapy mainly includes stages such as target gene cloning, gene transfer, target cell selection, and clinical trial observation. Among them, gene transfer is the key step in gene therapy, and the advantage of DNA transposon-mediated gene transfer in gene therapy is high efficiency and safety. So far, transposons have become the most commonly used non-viral vectors in gene therapy. In addition, transposons can also be used to prepare mutants, conduct gene trapping, and be applied to functional genomics research.

[0006] Although some DNA transposons have been used as tools for gene transfer, they have defects such as low transfer efficiency and cannot meet the requirements of gene transfer. Therefore, on the basis of optimizing existing transposons, the exploration of transposons with autonomous activity should continue. Summary of the Invention

[0007] In order to overcome the above defects, the present invention provides a Spy transposon system and a gene transfer method mediated thereby. By using bioinformatics methods, a highly active transposon in the Spy family is discovered and molecular reconstruction is carried out to obtain the transposon target site duplication (TSD), terminal inverted repeat (TIR), non-coding domain, and transposase sequence. Then, cgSpy and cvSpy transposon donor plasmids and helper plasmids expressing the corresponding transposases are constructed, and they are respectively assembled into a set of gene transfer systems, named cgSpy and cvSpy transposon systems. The purpose of the present invention is to provide an efficient gene transfer method mediated by the cgSpy and cvSpy transposon systems to improve the efficiency of transgenic preparation in animals such as mice and zebrafish, and it can be effectively applied to research fields such as cell gene transfection and integration, human gene therapy, and gene trapping.

[0008] The technical solutions provided by the present invention are as follows:

[0009] A Spy transposon system, comprising cgSpy and cvSpy transposons and a corresponding transposase; the sequences of the cgSpy and cvSpy transposons are as shown in SEQ ID No.5 and SEQ ID No.6; the sequence of the transposase is as shown in SEQ ID No.3 and SEQ ID No.4.

[0010] Furthermore, the cgSpy transposon comprises 464bp terminal inverted repeats and 3bp target site duplications; the cvSpy transposon comprises 3bp target site duplications, 24bp terminal inverted repeats, a 1502bp left non-coding domain and an 1187bp right non-coding domain.

[0011] Furthermore, the sequence of the donor plasmid is as shown in SEQ ID No.7 - 10.

[0012] The present invention also provides a gene transfer system, comprising cgSpy and cvSpy transposons and a corresponding transposase; the sequences of the cgSpy and cvSpy transposons are as shown in SEQ ID No.5 and SEQ ID No.6; the transposase is an amino acid sequence, a DNA sequence encoding the transposase, or an mRNA sequence encoding the transposase.

[0013] The present invention also provides a pharmaceutical composition, comprising the above-mentioned Spy transposon system and a pharmaceutically acceptable carrier, excipient or solvent.

[0014] The present invention also provides a kit, comprising the above-mentioned Spy transposon system.

[0015] The present invention also provides a gene transfer method, comprising the following steps: contacting cells with the above-mentioned gene transfer system, so as to introduce an exogenous nucleic acid sequence into the cells.

[0016] The cgSpy and cvSpy transposon systems of the present invention mainly consist of cgSpy and cvSpy transposon donor plasmids and corresponding transposase helper plasmids. The transposon systems are from the Japanese plasterer bee (scientific name: Colletes gigas, abbreviated as cg) and the eastern oyster (scientific name: Crassostrea viginica, abbreviated as cv), belonging to the Spy family of the PHIS transposon superfamily, named cgSpy and cvSpy. The cgSpy and cvSpy transposon systems respectively include: (a) the transposable elements of the transposons; (b) the transposases that recognize the transposable elements.

[0017] The cgSpy and cvSpy transposon systems include a wild-type transposase or an enhanced transposase. The amino acid sequences of the wild-type cgSpy and cvSpy transposases are shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleic acid sequences are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0018] The cgSpy transposon system includes a 467bp transposable element of the transposon, namely a 464bp terminal inverted repeat (TIR) and a 3bp target site duplication (TSD), as shown in SEQ ID No.5; the cvSpy transposon system includes a 3bp target site duplication (TSD), a 24bp terminal inverted repeat (TIR), a 1502bp left non-coding domain, and an 1187bp right non-coding domain, as shown in SEQ ID No.6.

[0019] The present invention also provides a gene transfer system, including the transposable element TIR of the above-mentioned cgSpy and cvSpy transposon systems and their matching transposases. The transposase can be an amino acid sequence, or a DNA sequence encoding the transposase, or an mRNA sequence encoding the transposase.

[0020] The present invention also provides a method for introducing an exogenous nucleic acid sequence into a cell, including: contacting the cell with the above-mentioned gene transfer system, thereby introducing the exogenous nucleic acid sequence into the cell.

[0021] The present invention also provides a pharmaceutical composition, including: (a) a transposon transposable element, containing the nucleic acid sequences of the transposable elements of the transposons in cgSpy and cvSpy, as shown in SEQ ID NO.5 and SEQ ID NO.6; (b) a transposase, which is the cgSpy and cvSpy transposases matching the transposon in (a) and can recognize the cgSpy and cvSpy transposon transposable elements in (a), as shown in SEQ ID NO.3 and SEQ ID NO.4; and (c) a pharmaceutically acceptable carrier, excipient or solvent.

[0022] The present invention also provides a kit, including: (a) a transposon, which contains the transposable elements of the cgSpy and cvSpy transposons, as shown in SEQ ID NO.5 and SEQ ID NO.6; and their matching transposase sequences, as shown in SEQ ID NO.3 and SEQ ID NO.4; and (b) instructions for introducing a nucleic acid sequence into a cell.

[0023] The present invention also provides an isolated cell, comprising the cells prepared by the above method.

[0024] The present invention also provides the application of the above transposase, transposon element, transposon system, gene transfer method, pharmaceutical composition, kit or cell in any one of the following (1)-(6):

[0025] (1) Application in the preparation of a drug or reagent for integrating a target gene expression cassette into the genome of a host cell;

[0026] (2) Application in the preparation of a tool for integrating a target gene expression cassette into the genome of a host cell;

[0027] (3) Application in the preparation of transgenic plants, transgenic animals, and transgenic cells;

[0028] (4) Application in the preparation of a drug or preparation for genome research, gene therapy, cell therapy, or stem cell induction and post-induction differentiation;

[0029] (5) Application in the preparation of a tool for genome research, gene therapy, cell therapy, or stem cell induction and post-induction differentiation;

[0030] (6) Application in the preparation of a kit, engineered immune cell, or pharmaceutical composition.

[0031] The transgenic donor plasmids (PLB-cgSpy-PGK-NEO-PolyA, PLB-cvSpy-PGK-NEO-PolyA, PLB-cgSpy-CD19-CAR, PLB-cgSpy-DT-GFP) described in the present invention include the terminal sequences on both sides of the corresponding cgSpy and cvSpy transposons, a multiple cloning insertion site, and the multiple cloning insertion site (AvrII (KpnI) / MluI restriction enzyme sites) can insert the target gene cassette to be transferred. The sequences of the donor plasmids (PLB-cgSpy-PGK-NEO-PolyA, PLB-cvSpy-PGK-NEO-PolyA, PLB-cgSpy-CD19-CAR, PLB-cgSpy-DT-GFP) are shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10. The target gene can be inserted into the transgenic donor plasmid through any one of the above multiple cloning insertion sites. Inserting the target gene into the transgenic donor plasmid means that the target gene is inserted between the Spy 5’TIR and Spy 3’TIR.

[0032] The cgSpy and cvSpy transposons described in the present invention are derived from their molecular reconstruction in the corresponding species. The lengths of the inverted terminal repeats (TIRs) at the ends of the cgSpy transposon are 464 bp / 464 bp respectively, and the lengths of the target site duplications (TSDs) are 3 bp / 3 bp respectively; the lengths of the inverted terminal repeats (TIRs) at the ends of the cvSpy transposon are 24 bp / 24 bp respectively, the lengths of the target site duplications (TSDs) are 3 bp / 3 bp respectively, and the non-coding regions are 1502 bp / 1187 bp respectively.

[0033] The target gene cassette described in the present invention can be a reporter gene expression cassette, or other foreign gene expression cassettes, or gene trap elements.

[0034] The Spy transposase (i.e., Spy CDS) sequence described in the present invention was obtained by molecular reconstruction of the transposon using bioinformatics analysis methods and chemically synthesized, as shown in SEQ ID No. 3 and SEQ ID No. 4.

[0035] The eukaryotic expression plasmid of Spy transposase (pCAG-Spy) described in the present invention consists of CMV enhancer, chicken β-actin promoter, chimeric intron, Spy transposase CDS sequence and rabbit beta-globin poly(A); the length of the cgSpy transposase is 2070 nucleotide sequences, and the length of the cvSpy transposase is 2076 nucleotide sequences. This vector can autonomously express transposase. The sequences of this vector are shown in SEQ ID No. 3 and SEQ ID No. 4.

[0036] Beneficial effects

[0037] The present invention uses bioinformatics means to mine and study the Spy family transposons in the animal kingdom. At the same time, through analysis such as insertion age, it is found that there may be highly active transposons cgSpy and cvSpy in Colletes gigas and Crassostrea viginica. Based on phylogenetic comparative studies, molecular reconstruction is carried out to obtain key elements such as target site duplication (TSD) and terminal inverted repeat (TIR) of the cgSpy and cvSpy transposons, as well as the sequences of transposases, and a set of gene transfer vector systems are constructed. After cell verification, this cgSpy and cvSpy vector system can effectively mediate gene transfer and has great application potential in the preparation of transgenic animals and gene therapy.

[0038] The gene transfer method based on the Spy transposon system provided by the present invention can efficiently mediate gene transfer after verification at the cell level and can be applied to multiple biotechnology fields; by using the method given in the present invention, the target gene cassette can be effectively inserted into the host genome to improve the gene transfer efficiency; the method of the present invention can also be used to mediate human gene therapy, etc. Brief Description of the Drawings

[0039] Figure 1 It is the plasmid map of pCAG-cgSpy;

[0040] Figure 2 It is the plasmid map of pCAG-cvSpy;

[0041] Figure 3 It is the plasmid map of PLB-cgSpy;

[0042] Figure 4 It is the plasmid map of PLB-cvSpy;

[0043] Figure 5 It is the plasmid map of PLB-cgSpy-PGK-NEO-PolyA;

[0044] Figure 6 It is the plasmid map of PLB-cvSpy-PGK-NEO-PolyA;

[0045] Figure 7 It is the plasmid map of PLB-cgSpy-CD19-CAR;

[0046] Figure 8 It is the plasmid map of PLB-cgSpy-DT-GFP;

[0047] Figure 9For the G418 resistance screening of cgSpy in Hela cells;

[0048] Figure 10 For the G418 resistance screening of cvSpy in Hela cells;

[0049] Figure 11 For the flow cytometry screening results of human primary T cells. Specific implementation manners

[0050] To better illustrate the present invention and facilitate understanding of the technical solution of the present invention, the typical but non-limiting embodiments of the present invention are as follows:

[0051] The experimental methods mentioned in the following embodiments are all conventional methods unless otherwise specified.

[0052] I. Construction of Spy transposase expression vector

[0053] 1. Synthesis of cgSpy transposase-assisted plasmid vector

[0054] The consensus sequence of the CDS of the constructed transposase was codon-optimized using the idtdna website, and the CDS sequence was synthesized by Genewiz. A T7 promoter (TAATACGACTCACTATAGGG) and a kozak box (GCCACC) were added before the expression frame, and then it was ligated into the pCAG vector containing the CAG promoter reserved in the company before, and named pCAG-cgSpy respectively. The plasmid map is as Figure 1 shown. The transposase sequence vector sequence is shown in SEQ ID No.3. pCAG-cgSpy includes CMVEnhancer 5-384, chickenβ-actin promoter 386-662, chimeric intron 663-1679, T7promoter 1761-1780, Kozak sequence 1788-1793, cgSpy CDS 1794-3863, rabbit beta-globin poly(A)3873-4409, ori 5178-5766, Ampicillin Resistance gene 5937-6797.

[0055] 2. Synthesis of cvSpy transposase-assisted plasmid vector

[0056] The consensus sequence of the CDS of the constructed transposase was codon-optimized using the idtdna website, and the CDS sequence was synthesized by Genewiz. A T7 promoter (TAATACGACTCACTATAGGG) and a Kozak box (GCCACC) were added before the expression cassette, and then it was ligated into the pCAG vector containing the CAG promoter that was previously reserved in the company, named pCAG-cvSpy respectively. The plasmid map is as Figure 2 shown. The transposase sequence vector sequence is shown in SEQ ID No.4. pCAG-cvSpy includes CMVEnhancer 5-384, chickenβ-actin promoter 386-662, chimeric intron 663-1679, T7promoter 1761-1780, Kozak sequence 1788-1793, cvSpy CDS1794-3868, rabbit beta-globin poly(A)3879-4415, ori 5184-5772, Ampicillin Resistance gene 5943-6803.

[0057] II. Construction of the transposon expression vector

[0058] 1. Construction of the cgSpy donor plasmid vector

[0059] 1.1 Synthesis of the two terminal regions on both sides of cgSpy

[0060] Analyses such as the insertion age of the cgSpy transposon in its corresponding species in the Spy family were carried out, and molecular reconstruction was performed based on phylogenetic comparative studies. Highly conserved 5' and 3' TIRs were determined, with lengths of 467bp / 467bp respectively. This sequence was added with restriction enzyme sites (AvrII / MluI), and the TIR sequence was synthesized by Genewiz and cloned into the PLB framework. The sequence is shown in SEQ ID No.5, and the plasmid map is as Figure 3 shown. The PLB-cgSpy vector sequence is shown in SEQ ID No.5. PLB-cgSpy includes cgSpy 5’TSD 384-386; cgSpy 5’TIR 387-850; cgSpy 3’TIR 863-1326; cgSpy 3’TSD 1327-1329; ColE Origin 1959-2839; Ampicillin Resistance gene2903-3560. The bases at positions 851-862 are the AvrII and MluI restriction enzyme sites for inserting the target gene.

[0061] 1.2 Construction of Transposon Vector PLB-cgSpy-PGK-NEO-PolyA

[0062] The PGK-NEO-bGHpA-TA cloning vector (the PGK-NEO-bGHpA-TA cloning vector is a vector stored in this laboratory) was digested with restriction endonucleases AvrII and MluI, and the 1659 bp PGK-NEO-bGHpA expression cassette (used as the target gene cassette) was recovered by gel cutting. The PLB-cgSpy vector was digested with AvrII and MluI respectively, and the 3950 bp vector framework was recovered. The expression cassette was ligated to the vector, and the competent cells Top10 were transformed. Single colonies were picked and cultured in LB liquid medium containing Amp. Plasmids were extracted for electrophoresis and restriction enzyme digestion identification. Those with the correct size were screened and sent to Genewiz for sequencing. The plasmid map is as shown in Figure 5 SEQ ID No.7.

[0063] 1.3 Construction of Transposon Vector PLB-cgSpy-CD19-CAR

[0064] The framework PLB-cgSpy-PGK-polyA was amplified by PCR (the cloning template was PLB-cgSpy-PGK-NEO-polyA), and 4729 bp was recovered by gel cutting. CD19-CAR was amplified (the cloning template was Plv3-U6-RACK1 (human)-shRNA1-CopGFP-Puro), and 2677 bp was recovered by gel cutting. The Novoprotein C112 product was used to ligate the framework PLB-cgSpy-PGK-polyA and the insert CD19-CAR. The competent cells Top10 were transformed. Single colonies were picked and cultured in LB liquid medium containing Amp. Plasmids were extracted for electrophoresis and restriction enzyme digestion identification. Those with the correct size were screened and sent to Genewiz for sequencing. The plasmid map is as shown in Figure 7 SEQ ID No.9.

[0065] 1.4 Construction of Transposon Vector PLB-cgSpy-DT-GFP

[0066] The DT-GFP cloning vector (the DT-GFP-TA cloning vector is a vector stored in this laboratory) was digested with restriction endonucleases AvrII and MluI, and the 1842 bp DT-GFP expression cassette (used as the target gene cassette) was recovered by gel cutting. The PLB-cgSpy vector was digested with AvrII and MluI respectively, and the 3950 bp vector framework was recovered. The expression cassette was ligated to the vector, and the competent cells Top10 were transformed. Single colonies were picked and cultured in LB liquid medium containing Amp. Plasmids were extracted for electrophoresis and restriction enzyme digestion identification. Those with the correct size were screened and sent to Genewiz for sequencing. The plasmid map is as shown in Figure 8 SEQ ID No.10.

[0067] 2. Construction of cvSpy Donor Plasmid Vector

[0068] 2.1 Synthesis of the Terminal Regions on Both Sides of cvSpy

[0069] Analyses such as the insertion age of the cvSpy transposon in the Spy family were performed in its corresponding species, and molecular reconstruction was carried out based on phylogenetic comparative studies. The lengths of the inverted terminal repeats (TIR) at the two ends of the cvSpy transposon were 24 bp / 24 bp respectively, the lengths of the target site duplications (TSD) were 3 bp / 3 bp respectively, and the non-coding regions were 1502 bp / 1187 bp respectively. Restriction enzyme sites (KpnI / MluI) were added in the middle of this sequence. The TIR sequence was synthesized by Genewiz and cloned into the PLB framework. The sequence is shown in SEQ ID No.6, and the plasmid map is as shown in Figure 4 shown. The sequence of the PLB-cgSpy vector is as shown in SEQ ID No.6. PLB-cvSpy includes cvSpy 5’TSD 384-386; cvSpy 5’TIR 387-410; cvSpy 5’UTR 411-1912; cvSpy 3’UTR 1925-3111; cvSpy 3’TIR 3111-3135; 3’TSD 3136-3138; ColE Origin 3762-4642; Ampicillin Resistance gene 4706-5363. The bases at positions 1913-1924 are the cleavage sites of KpnI and MluI for inserting the target gene.

[0070] 2.2 Construction of the Transposon Vector PLB-cvSpy-PGK-NEO-PolyA

[0071] The PGK-NEO-bGHpA-TA cloning vector (the PGK-NEO-bGHpA-TA cloning vector is a vector stored in this laboratory) was digested with the restriction enzymes KpnI and MluI, and the 1659-bp PGK-NEO-bGHpA expression cassette (which serves as the target gene cassette) was recovered by gel cutting. The PLB-cvSpy vector was digested with AvrII and MluI respectively, and the 5753-bp vector framework was recovered. The expression cassette was ligated to the vector, and the competent cells Top10 were transformed. Single colonies were picked and cultured in the Amp-containing liquid medium LB. The plasmid was extracted for electrophoresis and enzyme digestion identification. Those with the correct size were screened and sent to Genewiz for sequencing. The plasmid map is as shown in Figure 6 shown, SEQ ID No.8.

[0072] Example 1. Effective gene transfer in human HeLa cells

[0073] 1. Recovery and culture of cryopreserved cells

[0074] The transposon vector and the transposase vector plasmid were extracted using an OMEGA endotoxin-free plasmid extraction kit (purchased from OMEGA), and the final concentration of the product was adjusted to 500 ng / ul for cell transfection.

[0075] A cryopreservation tube containing human cervical cancer cells (Hela) (cells stored in this laboratory) was taken out from liquid nitrogen and immediately placed in a 37°C water bath and shaken; the cell suspension was transferred into a sterile centrifuge tube, 5 mL of culture medium was added, and gently blown evenly; the cell suspension was centrifuged at 1000 rpm for 5 min, and the supernatant was discarded; 1 mL of complete medium was added to the centrifuge tube containing the cell pellet, gently blown evenly, the cell suspension was transferred into a cell culture flask, and an appropriate amount of complete medium was added for culture.

[0076] 2. Cell transfection and screening

[0077] 2.1 Transfection and screening of cgSpy cells

[0078] Human cervical cancer cells Hela were divided into 6 groups and transfected separately. The first group: PLB-cgSpy-PGK-NEO-PolyA and pCAG-cgSpy; the second group: PLB-cgSpy-PGK-NEO-PolyA and pCAG; the third group: PLB-PB-PGK-NEO-PolyA and pCAG-PB; the fourth group: PLB-PB-PGK-NEO-PolyA and pCAG; the fifth group: PLB-SB-PGK-NEO-PolyA and pCAG-SB; the sixth group: PLB-SB-PGK-NEO-PolyA and pCAG. Each group had three replicates.

[0079] About 12 - 16 h before transfection, plate at 3×10 5Seed Hela cells at a density of

[0080] 2.2 cvSpy cell transfection and screening

[0081] Divide human cervical cancer cells Hela into 4 groups and transfect each group separately. The first group: PLB-cvSpy-PGK-NEO-PolyA and pCAG-cvSpy; the second group: PLB-cvSpy-PGK-NEO-PolyA and pCAG; the third group: PLB-PB-PGK-NEO-PolyA and pCAG-PB; the fourth group: PLB-PB-PGK-NEO-PolyA and pCAG. Each group has three replicates.

[0082] Approximately 12 - 16 h before transfection, plate 5 Seed Hela cells at a density of

[0083] 3. Identification of positive clones of transfected cells

[0084] 3.1 Identification of positive clones of cgSpy-transfected cells

[0085] For the first, third, and fifth groups as experimental groups, and the second, fourth, and sixth groups as control groups. After screening with G418-resistant culture medium for 14 days, Giemsa staining was performed for counting.

[0086] Results showed that: the number of positive cell clones in the cgSpy transposon experimental group was 170, the number of positive cell clones in the PB transposon experimental group was 310, and the number of positive cell clones in the SB transposon experimental group was 270. The number of positive cell clones in the corresponding control groups was 0. The activity of cgSpy was about 54.84% of PB and about 62.96% of SB, as Figure 9 shown. The results indicated that the cgSpy transposon system could efficiently mediate the transfection and integration of the neomycin resistance gene in Hela cells, that is, the cgSpy transposon system could efficiently mediate the transfer of foreign genes as confirmed by the resistance gene.

[0087] 3.2 Identification of positive clones of cvSpy-transfected cells

[0088] For the first and third groups as experimental groups, and the second and fourth groups as control groups. After screening with G418-resistant culture medium for 14 days, Giemsa staining was performed for counting.

[0089] Results showed that: the number of positive cell clones in the cvSpy transposon experimental group was 456, the number of positive cell clones in the PB transposon experimental group was 870. The number of positive cell clones in the corresponding control groups was 0. The activity of cvSpy was about 52.41% of the activity of PB, as Figure 10 shown. The results indicated that the cvSpy transposon system could efficiently mediate the transfection and integration of the neomycin resistance gene in Hela cells, that is, the cvSpy transposon system could efficiently mediate the transfer of foreign genes as confirmed by the resistance gene.

[0090] Example 2. Efficient gene transfer of cgSpy in human primary T cells

[0091] 1. Isolation of primary T cells

[0092] Human peripheral blood mononuclear cells (hbmc) from healthy blood donors who gave informed consent were obtained from Milestone Biotechnologies (Shanghai, China). According to EasySep TMInstructions for the Human T Cell Isolation Kit (StemCell, Canada). Primary human T cells were isolated from hPBMCs using the negative selection method. T cells were cultured in ImmunoCult-XF T Cell Expansion Medium (StemCell, Canada) containing 50 ng / mL recombinant human IL-2 (R&D Systems, USA). T cells were activated with ImmunoCult Hu CD3 / CD28 T Cell Act (StemCell, Canada) for 2 days. On day 2, CD3 / CD28 T Cell Act was removed, and the activated T cells were washed twice with sterile PBS, and prepared for electroporation using Neon TM Transfection System (ThermoFisher Scientific, USA). During transfection, 1×106 activated T cells were suspended in 100 μL of T buffer using the Neon Transfection Kit (ThermoFisher Scientific, USA), then premixed with the specified amount of DNA / mRNA and transferred to a bubble-free electroporation cuvette. The electroporation parameters were set as: primary T cells (2300 V, 3 ms, 4 pulses). Untreated (UT) cells were used as a negative control. After electroporation, the cells were returned to the expansion medium, maintaining a concentration of 1×10 6 T cells / mL.

[0093] 2. Flow cytometry

[0094] [[ID=IO]]To evaluate the efficiency of transgene mediated by the cgSpy or PB transposon system, the transposon plasmid carrying the EGFP expression cassette was premixed with the indicated concentration of transposon mRNA and electroporated into Jurkat cells. After 14 days of expansion, EGFP expression was detected using a Beckman Coulter Cytoflex S flow cytometer (Beckman Coulter, USA) to verify the transgene integration efficiency. To verify the expression of CD19-CAR on primary human T cells, we electroporated the transposon tir-modified CD19-CAR plasmid DNA and transposase mRNA at a ratio of 2:2 into activated CD3+ T cells, that is, 2 μg of DNA and 2 μg of mRNA were transfected into 1×10 6 cells respectively. 11 days after electroporation, 2×10 5 human T cells were collected, washed twice with PBS, incubated with FMC63-scFv-FITC antibody (ACROBiosystems, USA) on ice for 30 min. Then, the stained T cell samples were washed once to remove unbound antibodies and detected by flow cytometry. Data were analyzed using CytExpert 2.3 software (Beckman Coulter, USA).

[0095] It was found that: We co-transfected human primary T cells with CD19-CAR plasmid DNA and transposase mRNA at a ratio of 2:2. Two days after transfection with the transposon plasmid, flow cytometry was used to evaluate the efficiency of the cells that obtained the transposon plasmid. The transposons cgSpy and PB carrying CD19 CAR were highly expressed, and more than 90% positive was detected by the FMC63-FITC antibody (an indicator of CD19 CAR, supplementary figure). Two weeks after transfection, we observed ~33% CD19 CAR-positive cells in the transgenes mediated by the cgSpy system, which was significantly higher than that of the PB system. These data indicate that the cgSpy transposon can effectively mediate gene transfer in T cells and is expected to become a new gene delivery tool for CAR-T therapy.

[0096] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. The above embodiments and the descriptions in the specification are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed. The scope of protection claimed by the present invention is defined by the appended claims and their equivalents.

[0097] Supplementary sequence information:

[0098] SEQ ID No.1 cgSpy protein sequence:

[0099] MSNAEKCASCNKYVIKVSPRKTIVTSQKMAEFLTQYLKSQIVLHDVLCNNCRIKAYKNKKTDSACDNNNENDVIVESSVSSSFDDPNFNISLMESAKDDVIKIEVPIKRTVATHKYCFICNDTKNIHVIPFEASLQIYIKIKIYVPKGNRCCRKHLIKNKLYNDELKHISIYSHFSSIEPVELQQLLNSLAITCDSTLFDKIGDFNMPEEQLFIFTGLTWENIIELKTMLISMKNSASRNVTQAIIIFLFKLRSGNANETIASIFQLEHKQLVSDYSNAVMNAFDKDVLPLKFGLKSATREYLINNHTSNVAKSLYDIDNKLLLICDGTYIRHQKSSNNEYQRKSFSGQKKVPLCKPFTICTTDGYIVDILGPYYATQNDASIMKEIMTESNGLCNLMKKGDIFILDRGFRDVKNMLTEQGYGVLMPALKGKRPQLSTIESNDSRFVRKLRWVVEAIHGILKQKYRLLDRKLDNKMLPKIGIYCKIASFLQNRYGKRLNSDAGRLDIIAQMKEKKNQENSLSEEIEKHGWSRKKLIFSDISTSDIFDFPEMTENDLHILFTGSYQFSQAISYLAEILNADGSITAKYVKERSNILKLSVKSRYINKKTYRCYIEYLPNTIGHSGVTRYACECASGKRTVGYCSHVAALIYYLAHGRYLSKILKPAEILTNLFTKNEIHPIINENSDIDD

[0100] SEQ ID No.2 cvSpy protein sequence:

[0101] MPPISRKFYACVLCDKRTKPGERRPINDALSTFLKKHFLLQIRPNSGDVVCDKCRRRHYRNEEQKSKTTDVTAEPALDDFVPPAPKPRKCTLSSPPSVKLSLSSTAKSHSYCFLCKRPGPKLVNVPPKARFSTFLHNEIIIPAGSRCCPVHLHEDLFTDEAISSVRCTNDHIILNRTSILNLLKNLKIAALHNETSRINFDDEKILSETDYINLTGLSREHFNDLHTYIAFSIRNTPTRSTRTSLGIFLFKLKTGTSSKVLSTVFGISKSSIKRAVSAVREALATNFVPHFLGFDHISRSDVIENHSRPLAQNLFGNGKEAILVLDGTYIYLQKSGNFQFQRRTYSMHKGRPLVKPMVVVTTTGYFIAILGPYMADVKNNDGSILNHMLASNVQDIKNWIENEDIFIVDRGFRDSLEFLEDLGIKAKMPSFIPRGQAQMSTEEANTSRLVTKVRWVVESANARIKSWKYLASVLPTHQVPYIRDYVCIVCAIANKYLPPLSTGQDNDEALAAKMLHLSQKVNTLKQRVENENLGKRTAVWKEPSNNLDDFPRLTEDDLRNITCGVYQIKMSSSYIHEHLEGNYQFFVHREDETLLRIKLQSRHISSKVYILWIEYNPIEVTAWYCKCKSGARVVGVCAHIAAILWYLGYARHNPDIRYGVKNWGKHLEDASDMPQVIDESESDTDGSVVEE

[0102] SEQ ID No.3.pCAG-cgSpy:

[0103] The T7 promoter sequence is underlined ; The Kozak sequence is italicized; the cgSpyCDS sequence is boldfaced as follows:

[0104]

[0105]

[0106] SEQ ID No.4.pCAG-cvSpy:

[0107] The T7 promoter sequence is underlined ; The Kozak sequence is italicized; the cgSpyCDS sequence is boldfaced as follows:

[0108]

[0109]

[0110]

[0111] SEQ ID No.5. PLB-cgSpy:

[0112] The cgSpy 5’ TSD is shown in uppercase italic; the cgSpy 3’ TSD is shown in lowercase italic; the cgSpy 5’ TIR is underlined; the cgSpy 3’ TIR is shown in bold and underlined:

[0113]

[0114]

[0115] SEQ ID No.6. PLB-cvSpy:

[0116] The cvSpy 5’ TSD is shown in uppercase italic; the cvSpy 5’ TIR is underlined; the cvSpy 5’ UTR is shown in bold and italic; the cvSpy 3’ UTR is underlined and italic; the cvSpy 3’ TIR is shown in bold and underlined; the cvSpy 3’ TSD is shown in lowercase italic:

[0117]

[0118]

[0119]

[0120] SEQ ID No.7. PLB-cgSpy-PGK-NEO-PolyA:

[0121] The cgSpy 5’ TSD is shown in uppercase italic; the cgSpy 3’ TSD is shown in lowercase italic; the cgSpy 5’ TIR is underlined; the cgSpy 3’ TIR is shown in bold and underlined:

[0122]

[0123]

[0124] SEQ ID No.8. PLB-cvSpy-PGK-NEO-PolyA

[0125] cvSpy 5’ TSD is shown in uppercase italic; cvSpy 5’ TIR is shown underlined; cvSpy 5’ UTR is shown in bold italic; cvSpy 3’ UTR is shown in underlined italic; cvSpy 3’ TIR is shown in bold underlined; cvSpy 3’ TSD is shown in lowercase italic:

[0126]

[0127]

[0128]

[0129] SEQ ID No.9. PLB-cgSpy-CD19-CAR:

[0130] cgSpy 5’ TSD is shown in uppercase italic; cgSpy 3’ TSD is shown in lowercase italic; cgSpy 5’ TIR is shown underlined; cgSpy 3’ TIR is shown in bold underlined:

[0131]

[0132]

[0133] SEQ ID No.10. PLB-cgSpy-DT-GFP:

[0134] cgSpy 5’ TSD is shown in uppercase italic; cgSpy 3’ TSD is shown in lowercase italic; cgSpy 5’ TIR is shown underlined; cgSpy 3’ TIR is shown in bold underlined:

[0135]

[0136]

[0137]

Claims

1. A Spy transposon system, characterized in that, Comprising cgSpy and cvSpy transposons and their corresponding transposases; the sequences of the cgSpy and cvSpy transposons are shown in SEQ ID No.5 and SEQ ID No.6; the amino acid sequences of the transposases are shown in SEQ ID No.1 and SEQ ID No.2; the nucleic acid sequences of the transposases are shown in SEQ ID No.3 and SEQ ID No.

4.

2. The Spy transposon system according to claim 1, wherein The cgSpy transposon comprises 464bp terminal inverted repeats and 3bp target site duplications; the cvSpy transposon comprises 3bp target site duplications, 24bp terminal inverted repeats, a 1502bp left non-coding domain and an 1187bp right non-coding domain.

3. The Spy transposon system according to claim 1, wherein The sequence of the donor plasmid is shown in SEQ ID No.7-10.

4. A gene transfer system, characterized in that, The gene transfer system comprises cgSpy and cvSpy transposons and their corresponding transposases; the sequences of the cgSpy and cvSpy transposons are shown in SEQ ID No.5 and SEQ ID No.6; the transposase is an amino acid sequence, a DNA sequence encoding the transposase, or an mRNA sequence encoding the transposase.

5. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the Spy transposon system according to claim 1 and a pharmaceutically acceptable carrier, excipient or solvent.

6. A kit, characterized in that, The kit comprises the Spy transposon system according to claim 1.

7. A gene transfer method, characterized in that, Comprising the following steps: contacting cells with the gene transfer system according to claim 3, thereby introducing an exogenous nucleic acid sequence into the cells.

8. Use of the Spy transposon system according to claim 1 in mediating gene transfer.

9. Use of the Spy transposon system according to claim 1 in the preparation of transgenic plants, transgenic animals, transgenic cells.

10. Use of the Spy transposon system according to claim 1 in the preparation of drugs or preparations for genomic research, gene therapy, cell therapy or stem cell induction and post-induction differentiation.

Images