Increased cellular stability for AAV production
By modulating Rep protein expression and using ribozymes to control leaky expression, the method enhances AAV production efficiency and stability, addressing inefficiencies in current manufacturing processes.
Patent Information
- Application Number
- PCT/US2025/042943
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-03-12
- Filing Date
- 2025-08-21
- Publication Date
- 2026-02-26
AI Technical Summary
Current methods for recombinant AAV production are inefficient, leading to low yield, high impurity, lack of scalability, and high production costs, with transient transfections resulting in heterogeneous products and potential cellular toxicity due to leaky expression of AAV proteins.
The use of polynucleotides and vectors that modulate the expression of small Rep proteins relative to large Rep proteins, incorporating ribozymes to prevent cellular toxicity in the uninduced state and enable controlled expression in the induced state, along with inducible promoters and transcription blocking elements to stabilize AAV production.
This approach increases cellular stability and efficiency, allowing for high-titer AAV production with improved packaging efficiency and reduced toxicity, enabling consistent and cost-effective manufacturing of recombinant AAV.
Smart Images

Figure IMGF000055_0001 
Figure IMGF000097_0001 
Figure IMGF000213_0001
Abstract
Description
324632001140INCREASED CELLULAR STABILITY FOR AAV PRODUCTIONCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Application No. 63 / 685,675, filed August 21, 2024, and U.S. Provisional Application No. 63 / 770,974, filed March 12, 2025, the contents of which are incorporated by reference in their entireties.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0002] The contents of the electronic sequence listing (324632001140SEQLIST.xml; Size: 988,388 bytes; and Date of Creation: August 14, 2025) is herein incorporated by reference in its entirety.INTRODUCTION
[0003] Adeno-associated virus (AAV) belongs to the Parvoviridae family and Dependovirus genus, of which some members require co-infection with a helper virus such as adenovirus to promote replication. AAV establishes a latent infection in the absence of a helper virus. AAV virions are composed of a 25 nm icosahedral capsid encompassing a 4.7 kb single-stranded DNA genome with two open reading frames: rep and cap. The non-structural rep gene encodes four AAV Rep proteins that are regulatory proteins essential for viral replication, whereas cap encodes three structural AAV Capsid proteins (Virion proteins 1-3 “VP1-3”) that assemble into a 60-mer capsid shell. This viral capsid mediates the ability of AAV vectors to overcome many of the biological barriers of viral transduction, including cell surface receptor binding, endocytosis, intracellular trafficking, and unpackaging in the nucleus.
[0004] There is a need in the art for better methods of recombinant AAV (r AAV) production that enhance AAV packaging efficiency to provide for delivery of a payload of interest by a r AAV virion to a cell.SUMMARY
[0005] Polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods for expressing AAV Rep proteins are provided. In provided aspects, among the provided embodiments are polynucleotides, vectors, and systems of vectors or polynucleotides, and cells including the same, that include a polynucleotide that includes a coding sequence for a ribozyme. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to produce higher levels of small Rep as compared to large Rep. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to prevent cellular toxicity due to leaky Rep protein expression in a system that may be used to produce higher levels of small Rep as compared to large Rep when in an uninduced state (e.g., a state where the necessary components for virion production are not actively expressed for virion production). In certain aspects, these vectors, vector systems, cells, and methods may be used to increase capsid titers. In certain aspects, these vectors, vector systems, cells, and methods may be used to produce rAAV. Modulating expression of small Rep as1MOFO-359992482324632001140 compared to large Rep is useful in many contexts. For example, increased expression of small Rep as compared to large Rep can increase both total virions and packaged virions during the production of recombinant AAV. Preventing cellular toxicity due to leaky Rep protein expression is useful in many contexts. For example, preventing cellular toxicity due to leaky Rep protein expression in the uninduced state (e.g., a state where the necessary components for virion production are not actively expressed for virion production) but then allow for expression in the induced state (e.g., a state where the necessary components for virion production are actively expressed for producing virion) can increase posttransfection survival of cells integrating the polynucleotides, vectors, and systems of vectors or polynucleotides of the present disclosure during selection.BRIEF DESCRIPTION OF THE DRAWINGS
[0006] FIGs. 1A-1B. An exemplary schematic of a Ribo-Off type system in the “on” state (FIG. 1A) and the “off’ state (FIG. IB). In the on state, an alternative transcriptional termination sequence is flanked by recombination sites between an upstream (5’) coding sequence and a downstream (3’) ribozyme sequence and native or other 3’ untranslated region (3’UTR). The alternative transcriptional termination sequence stabilizes an mRNA including the coding sequence. Recombination between the recombination sites generates the off state by excising the alternative transcriptional termination sequence, such that the ribozyme is downstream (3’) of the coding sequence and upstream (5’) of the 3’UTR. In the off state, the ribozyme can destabilize the mRNA by cleaving between the 3’UTR and the coding sequence, leading to degradation of the mRNA.
[0007] FIGs. 2A-2B. An exemplary schematic of a Ribo-On type system in the “off’ state (FIG. 2A) and the “on” state (FIG. 2B). In the off state, a sequence encoding a ribozyme is flanked by recombination sites all of which are downstream (3’) of a coding sequence and upstream (5’) of a 3’UTR. In the off state, the ribozyme can destabilize the mRNA by cleaving between the 3’UTR and the coding sequence, leading to degradation of the mRNA. Recombination between the recombination sites generates the on state by excising the ribozyme. Without the ribozyme, the mRNA will not be cleaved by the ribozyme, and the 3’UTR (native or heterologous) stabilizes the mRNA leading to expression of the coding sequence.
[0008] FIG. 3A. Schematic of a polynucleotide for expression of AAV large Rep transcripts and AAV small Rep transcripts for expressing large Rep proteins and small Rep proteins, respectively. An intron is inserted upstream of the small Rep coding sequence, which is within the coding sequence for large Rep. The schematic further depicts that the p5 (“P5”) promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence. The pl9 (“P19”) promoter is not modified.
[0009] FIG. 3B. Schematic of a polynucleotide for expression of AAV large Rep transcripts and AAV small Rep transcripts for expressing large Rep proteins and small Rep proteins, respectively. An intron is inserted upstream of the small Rep coding sequence and in the coding sequence for large Rep.2MOFO-359992482324632001140The schematic further depicts that the p5 promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence and the TATA box of the pl9 promoter is mutated.
[0010] FIG. 4A. Schematic of a polynucleotide for expression of AAV large Rep transcripts and AAV small Rep transcripts for expressing large Rep proteins and small Rep proteins, respectively. An intron is inserted upstream of the small Rep coding sequence, which is within the coding sequence for large Rep. A heterologous promoter is inserted into the intron and operably connected to the small Rep coding sequence. The schematic further depicts that the p5 (“P5”) promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence. The pl9 (“P19”) promoter is not modified.
[0011] FIG. 4B. Schematic of a polynucleotide for expression of AAV large Rep transcripts and AAV small Rep transcripts for expressing large Rep proteins and small Rep proteins, respectively. An intron is inserted upstream of the small Rep coding sequence and in the coding sequence for large Rep. A heterologous promoter is inserted into the intron and operably connected to the small Rep coding sequence. The schematic further depicts that the p5 (“P5”) promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence and the TATA box of the pl9 (“P19”) promoter is mutated.
[0012] FIG. 5. Schematic showing mRNA Transcripts 1-3 that can be produced from the polynucleotides depicted in FIG.4A-4B. The spliced-out intron is depicted with discontinuous lines. While not depicted in FIG. 5, Transcript 1 is capable of generating two types of mature mRNAs produced by alternative splicing, in which the two types of mature RNAs are (i) a mature RNA encoding the large Rep protein, Rep78; and ii) a mature RNA encoding the large Rep protein, Rep68. Transcript 2 is produced by transcription driven by the heterologous promoter positioned in the intron. Transcript 3 is produced by transcription driven by the pl9 promoter and initially includes the intron (shown by discontinuous lines) which is spliced out. While not depicted in FIG. 5, Transcript 2 and Transcript 3 are each capable of generating two types of mature mRNAs produced by alternative splicing of the shown a mRNA, in which the two types of mature RNAs are (i) a mature RNA encoding the small Rep protein, Rep52; and ii) a mature RNA encoding the small Rep protein, Rep40.
[0013] FIG. 6. Schematic of a polynucleotide for inducible expression of AAV large Rep transcripts and AAV small Rep transcripts for expressing large Rep proteins and small Rep proteins, respectively. An intron is inserted upstream of the small Rep coding sequence, which is within the coding sequence for large Rep proteins. A heterologous promoter is inserted into the intron. A Conditional by Deletion (CODE) module is included in the coding sequence common to large Rep proteins and small Rep proteins. The CODE module includes a sequence comprising a stop codon and lox sites (denoted by two triangles) that flank the sequence comprising the stop codon. Upon expression of a recombinase, the lox sites are recombined, resulting in excision of the sequence comprising the stop codon. The schematic further depicts that the P5 promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence and the TATA box of the Pl 9 promoter is mutated.3MOFO-359992482324632001140
[0014] FIG. 7A. Schematic showing mRNA Transcripts 1-3 that can be produced from the polynucleotide depicted in FIG. 6 if the CODE module is inserted downstream of the start codon for the small Rep proteins. The spliced-out intron is depicted with discontinuous lines. Transcript 1 is capable of being alternatively spliced to produce two different mRNAs, one encoding a truncated large Rep protein, Rep78, and the other encoding a truncated large Rep protein, Rep68, wherein the truncations occur at the stop codon within the CODE module. Transcripts 2 and 3 are each capable of being alternatively spliced to produce two different mRNAs, one encoding a truncated small Rep protein, Rep52, and the other encoding a small Rep protein, Rep40, wherein the truncations occur at the stop codon within the CODE module. The truncated large Rep proteins and the truncated small Rep proteins are non-functional and therefore also non-toxic.
[0015] FIG. 7B. Schematic showing mRNA Transcripts 1-3 that can be produced from the polynucleotide depicted in FIG. 6 if the CODE module is inserted upstream of the start codon for the small Rep proteins. The spliced-out intron is depicted with discontinuous lines. Transcript 1 is capable of being alternatively spliced to produce two different mRNAs, one encoding a truncated large Rep protein, Rep78, and the other encoding a truncated large Rep protein, Rep68, wherein the truncations occur at the stop codon within the CODE module. Transcripts 2 and 3 do not encode truncated small Rep proteins since the transcripts are truncated at the stop codon within the CODE module, before the start codon of the coding sequence for the small Rep proteins. The truncated large Rep proteins are non-functional and therefore also non-toxic in their truncated forms, while small Rep proteins are not expressed
[0016] FIG 8A. A polynucleotide for expression of Rep proteins and Cap proteins, wherein the coding sequences and promoters for the Rep proteins are separated from the coding sequence and promoter for the Cap proteins by a transcription blocking element (TBE) is depicted. An intron is inserted in the coding sequence for large Rep proteins, upstream of the small Rep coding sequence. A Conditional by Deletion (CODE) module is included in the intron. The CODE module includes a BFP marker sequence comprising a stop codon and lox sites that flank the BFP marker sequence comprising the stop codon. The stop codon in the CODE module results in truncated large Rep proteins that are non-functional, and therefore also non-toxic in their truncated forms, and prevents the expression of small Rep proteins. A heterologous promoter is inserted into the intron to drive expression of small Rep proteins but is not operably linked to the small Rep coding sequence until the CODE module is excised following recombination of the lox sites. The schematic further depicts that the P5 promoter is replaced with a heterologous promoter that is operably linked to the large Rep coding sequence and the TATA box of the Pl 9 promoter is mutated. A sequence encoding a ribozyme is inserted between recombination sites and downstream of the sequence encoding the small Rep proteins and / or the sequence encoding the large Rep proteins. The encoded ribozyme can induce cleavage and / or degradation of the mRNA to silence leaky expression of the large and / or small Rep proteins. An exemplary bovine growth hormone (bGH) polyadenylation signal sequence (PolyA) and an exemplary enhancer (e.g., a triple enhancer or double enhancer) are located downstream of the sequence encoding the Rep proteins. The TBE separates the Rep4MOFO-359992482324632001140 coding sequence from the Cap coding sequence. Expression of Cap is under the control of an inducible promoter (e.g., Tet-on promoter) and includes a polyadenylation signal sequence (Poly A) downstream of the sequence encoding the Cap proteins (Capsid). An exemplary polyadenylation signal sequence is an SV40 polyadenylation sequence. The polynucleotide also includes a selectable marker (e.g., antibiotic resistance gene) expressed under the control of a constitutive promoter (e.g., EF-lalpha promoter). In this example, the EF-lalpha promoter includes a mutated TATA box which reduces its activity resulting in decreased expression of the selectable marker. This promoter is useful for increasing copy number of the polynucleotide when present in a cell that is cultured under a selection pressure (e.g., antibiotic.) The inclusion of a ribozyme is useful for preventing cellular toxicity due to leaky Rep protein expression.
[0017] FIG. 8B. The polynucleotide of FIG. 8A after recombination between first and second recombination sites resulting in excision of the CODE module and recombination between third and fourth recombination sites resulting in excision of the ribozyme.
[0018] FIG. 9. A polynucleotide for expression of Rep proteins and Cap proteins, wherein the coding sequences and promoters for the Rep proteins are separated from the coding sequence and promoter for the Cap proteins by a transcription blocking element (TBE) is depicted. An intron is inserted in the coding sequence for large Rep proteins, upstream of the small Rep coding sequence. A heterologous promoter is inserted into the intron and operably connected to the small Rep coding sequence. The schematic further depicts that the P5 promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence and the TATA box of the P19 promoter is mutated. The TBE separates the Rep coding sequence from the Cap coding sequence. Expression of Cap is under the control of an inducible promoter (e.g., Tet-on promoter) and includes a polyadenylation signal sequence (Poly A) downstream of the sequence encoding the Cap proteins (Capsid). An exemplary polyadenylation signal sequence is an SV40 polyadenylation sequence. The polynucleotide also includes a selectable marker (e.g., antibiotic resistance gene) expressed under the control of a constitutive promoter (e.g., EF-lalpha promoter). In this example, the EF-lalpha promoter includes a mutated TATA box which reduces its activity resulting in decreased expression of the selectable marker. This promoter is useful for increasing copy number of the polynucleotide when present in a cell that is cultured under a selection pressure (e.g., antibiotic).
[0019] FIG. 10A. An exemplary system of polynucleotides for inducibly producing rAAV is depicted. In absence of first and second triggering agents, the system is in an off state.
[0020] FIG. 10B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 10A is shown in the on-state, after induction by the first and second triggering agents.
[0021] FIG. 11A. An exemplary system of polynucleotides for inducibly producing rAAV is depicted. Compared to the system depicted in FIGS. 10A-10B, this system includes an additional polynucleotide for expressing the Cap protein. In absence of first and second triggering agents, the system is in an off state.5MOFO-359992482324632001140
[0022] FIG. 11B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 11A is shown in the on-state, after induction by the first and second triggering agents.
[0023] FIG. 12A. An exemplary system of polynucleotides for inducibly producing rAAV is depicted 9. In absence of first and second triggering agents, the system is in an off state.
[0024] FIG. 12B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 12A is shown in the on-state, after induction by the first and second triggering agents.
[0025] FIG. 13A. An exemplary system of polynucleotides for inducibly producing rAAV is depicted. Compared to the system depicted in FIGS. 12A-12B, this system includes an additional polynucleotide for expressing the Cap protein. In absence of first and second triggering agents, the system is in an off state.
[0026] FIG. 13B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 13A is shown in the on-state, after induction by the first and second triggering agents.
[0027] FIG. 14A. An exemplary schematic of constructs of a v 1.0 system for inducibly producing rAAV. In absence of the first triggering agent and the second triggering agent, the system is in an off state, in which rAAV is not produced. A full description of a vl.O system is provided in US Pat. No. 12,054,738 and PCT Pub. No. WO 2022 / 026927; the disclosures of which are incorporated by reference in their entireties for all purposes.
[0028] FIG. 14B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 14A is shown in the post-triggered state, in which rAAV is produced after induction by the first triggering agent and the second triggering agent. A full description of a vl.O system is provided in US Pat. No. 12,054,738 and PCT Pub. No. WO 2022 / 026927; the disclosures of which are incorporated by reference in their entireties for all purposes.
[0029] FIG. 15A. An exemplary schematic of constructs of a v 1.2 system for inducibly producing rAAV. In absence of the first triggering agent and the second triggering agent, the system is in an off state, in which rAAV is not produced.
[0030] FIG. 15B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 15A is shown in the post-triggered state, where rAAV is produced after induction by the first triggering agent and the second triggering agent.
[0031] FIG. 16A. An exemplary schematic of constructs of a v 1.3 system for inducibly producing rAAV. In absence of the first triggering agent and the second triggering agent, the system is in an off state, in which rAAV is not produced.
[0032] FIG. 16B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 16A is shown in the post-triggered state, in which rAAV is produced after induction by the first triggering agent and the second triggering agent.
[0033] FIG. 17A. An exemplary schematic of constructs of a v 1.4 system for inducibly producing rAAV. In absence of the first triggering agent and the second triggering agent, the system is in an off state, in which rAAV is not produced.6MOFO-359992482324632001140
[0034] FIG. 17B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 17A is shown in the post-triggered state, where rAAV is produced after induction by the first triggering agent and the second triggering agent.
[0035] FIG. 18A. An exemplary vl .4.1 system of polynucleotides for inducibly producing rAAV is depicted using the polynucleotide described in FIG. 8A as Construct 1. This system includes a sequence encoding a ribozyme that is flanked by recombination sites and positioned downstream of the sequence encoding the small Rep proteins and / or the sequence encoding the large Rep proteins. The encoded ribozyme can induce cleavage and / or degradation of Rep mRNA to silence leaky expression of the large and / or small Rep proteins. The ribozyme downstream of the large and / or small Rep proteins can prevent leaky expression of one or more Rep proteins, where the leaky expression may be toxic to cells. In absence of first and second triggering agents, the system is in an off state.
[0036] FIG. 18B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 18A is shown in the on-state, after induction by the first and second triggering agents.
[0037] FIG. 19. Western blot for flag tag to detect expression of flag-tagged large Rep proteins and small Rep proteins in cells transiently transfected with a plasmid comprising the polynucleotide depicted in FIG. 4B having combinations of different promoters.
[0038] FIG. 20. Western blot for flag tag to detect expression of flag-tagged Rep proteins in cells transiently transfected with a vector comprising the polynucleotide having combinations of different heterologous promoters (PGK+CAG or UBC+CAG). Some of the flag-tagged Rep proteins were transfected with a vector as depicted in FIG. 7 (CODE or Lox). As noted with FIG. 5, the CODE module truncates the Rep proteins (e.g., Rep78 and Rep52), thus not producing the flag tag (encoded near 3’ end of transcript). By expressing a recombinase or exogenously adding a (e.g., Cre recombinase), the CODE module is excised (e.g., at Lox sites) allowing expression of full-length, flag-tagged Rep proteins.
[0039] FIG. 21. Exemplary data for a comparison of rAAV production systems from pools of vl.0, vl.2, vl.3, and vl.4.
[0040] FIG. 22. Exemplary AEX chromatogram data to determine rAAV encapsidated genomes produced by a pool of vl.4 cells.
[0041] FIG. 23A. Exemplary data for cell viability percent (Viability %) and viable cell density (VCD)for pools of vl.3 and vl.4 cells as measured as days post-induction by the first triggering agent and the second triggering agent.
[0042] FIG. 23B. Exemplary data for titer level (Vg / mL) for pools of vl.3 and vl.4 cells as measured as days post-induction by the first triggering agent and the second triggering agent.
[0043] FIG. 24. Exemplary data of absorbance at 260 nm and 280 nm for pools of vl.3 and vl.4 cells as a measurement of titer level.
[0044] FIG. 25. Exemplary data showing anion exchange high performance liquid chromatography as an estimate of fill percentage of pools of vl.3 and vl.4 cells7MOFO-359992482324632001140
[0045] FIG. 26. Exemplary data comparing anion exchange high performance liquid chromatography of vl.4 cell pools after production for 3 days and 7 days.
[0046] FIG. 27. Exemplary data of high temperature size exclusion chromatography to measure fill percentage of a vl.4 cell pool.
[0047] FIG. 28A. Exemplary data of insert production and IC50 for as vl.4 cell pool as compared to a triply transfected control SVEC0935.
[0048] FIG.28B. Exemplary AEX chromatogram data to determine r AAV encapsidated genomes produced by a triply transfected control SVEC0935.
[0049] FIG. 29. Exemplary data of reverse phase HPLC to characterize relative amount of each capsid protein from a vl.4 cell pool as compared to a triply transfected control SVEC0935.
[0050] FIG. 30. Exemplary data of sequencing reads that align to various targets from rAAV particles produced by a vl.4 cell pool.
[0051] FIG.31. Exemplary data of digital droplet PCR identifying inserted nucleic acids obtained from vl.3 and vl.4 cell pools.
[0052] FIG. 32. Exemplary gel electrophoresis data showing insert size and conformation of inserts from vl.3 and vl.4 cell pools.
[0053] FIG. 33. Exemplary data of scatter plots showing consistent titer levels of capsid proteins and viral genomes produced from multiple replicates and production runs from vl.3 and vl.4 cell pools.
[0054] FIG. 34. Exemplary AEX chromatogram and absorbance data to determine rAAV encapsidated genomes produced by a pool of vl.4 cells after AEX purification.
[0055] FIG. 35A. Exemplary data of titer levels (vg / mL and vp / mL) produced from cell banks created over two months of passaging from pools of vl.3 cells.
[0056] FIG. 35B. Exemplary data of titer levels (vg / mL and vp / mL) produced from cell banks created over two months of passaging from pools of vl.4 cells.
[0057] FIG. 35C. Exemplary data of titer levels (vg / mL and vp / mL) produced from cell banks created over two months of passaging from pools of vl.4.1 cells.
[0058] FIGs. 3 A-36B. Exemplary data of a bar graph (FIG. 3 A) and a table (FIG. 36B) showing increased purity produced by vl.3 and vl.4 cell pools as compared to a vl.O cell pool, a vl.O monoclonal line, and triply transfected cells.
[0059] FIG. 37. Exemplary data showing production levels and efficiency of rAAV production from cells that are transiently transfected with vl.4 constructs or cells with stably integrated vl.4 constructs.
[0060] FIGs. 38A-38C. Exemplary data of vg titer (FIG. 38 A), percent of filled capsids (FIG. 38B), and effectiveness curve (FIG. 38C) showing improved yield, quality, and performance of rAAV produced from cells with stably integrated vl.4 constructs over cells that are transiently transfected with vl.4 constructs.8MOFO-359992482324632001140
[0061] FIG 38D Exemplary data of transduction response curves for stably integrated and transiently transfected constructs encoding a ssPGRN payload.
[0062] FIGs. 39A-39D. Exemplary data of chromatograms assessing % full capsids (FIG. 39A), chromatograms assessing percentage of each capsid protein (VP1, VP2, and VP3) , gel electrophoresis characterizing vg integrity (FIG. 39C) and a table summarizing sequencing data (FIG. 39D) showing similar properties between rAAV produced from cells that are transiently transfected with vl.4 constructs and rAAV produced from cells with stably integrated vl.4 constructs.
[0063] FIG. 39E. Exemplary data showing sequencing reads from rAAV produced from cells that were stably and transiently transfected with v.1.4 constructs including a payload encoding scPGRN.
[0064] FIGs. 40A-40B. Exemplary data of titer levels assessed as vg / mL (FIG. 40A) and vp / mL (FIG. 40B) from cells containing either a triple enhancer (e.g., hTERT, SV40, and CMV) or a double enhancer (e.g., SV40 and CMV) as measured at 3 days and 7 days post-induction.
[0065] FIGs. 41A-41B. Exemplary data of VCD (FIG. 41A) and cell viability (FIG. 41B) of vl.3, vl.4, and vl.4.1 systems.
[0066] FIG. 42. A polynucleotide for expression of Rep proteins and Cap proteins. Compared to the polynucleotide of FIG. 9, there is no enhancer downstream of the Cap coding sequence.
[0067] FIG.43A. An exemplary schematic of constructs of a vl.3 system for inducibly producing rAAV. In absence of the first triggering agent and the second triggering agent, the system is in an off state, in which rAAV is not produced. Compared to the constructs of FIG. 16A, there is no enhancer downstream of the Cap coding sequence in Construct 1. In addition, the selection cassette is located downstream of the Cap expression cassette.
[0068] FIG. 43B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 43A is shown in the post-triggered state, in which rAAV is produced after induction by the first triggering agent and the second triggering agent.
[0069] FIG.44A. An exemplary schematic of constructs of a vl.4 system for inducibly producing rAAV. In absence of the first triggering agent and the second triggering agent, the system is in an off state, in which rAAV is not produced. Compared to the constructs of FIG. 17A, there is no enhancer downstream of the Cap coding sequence in Construct 1.
[0070] FIG. 44B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 44A is shown in the post-triggered state, where rAAV is produced after induction by the first triggering agent and the second triggering agent.
[0071] FIG. 45. Plots indicating the percent cell viability of Pl cells (left) or P2 cells (right) with either 4 or 7 KOs, as compared to control P2 cells (P2 clone A or B), for 7 days following induction of recombinant AAV (rAAV) production.
[0072] FIG. 46. Plots indicating the percent cell viability of engineered P2 cell lines containing 1 KO (DFFB KO), 7 KOs, or 8 KOs, as compared to control P2 cells (P2 clone A or B) without addition of9MOFO-359992482324632001140 chemical pan-caspase zVAD.fmk (left) or with addition of zVAD.fmk (right) following induction of rAAV production.
[0073] FIG. 47A. Plots showing the rAAV titer from different engineered P2 cell lines derived from two clones (A; left or B; right) containing no KOs (WT), 1 KO, 7 KOs, or 8 KOs with or without addition of chemical pan-caspase zVAD.fmk 4 or 6 days following induction.
[0074] FIG. 47B. Plots showing levels of human genomic DNA encapsidated in rAAVs, as measured by copies of Alu, from different engineered P2 cell lines derived from two clones (A; left or B; right) containing no KOs (WT), 1 KO, 7 KOs, or 8 KOs with or without addition of chemical pan-caspase zVAD.fmk 4 or 6 days following induction.
[0075] FIG. 48A. Plots showing percent cell viability (top), total AAV titer (middle), and level of human genomic DNA encapsidated in rAAVs (bottom) in either wild-type (WT) cells or an engineered cell line containing 7 KOs derived from two different clones of P2 cells.
[0076] FIG. 48B. Plots showing percent cell viability (top), total AAV titer (middle), and level of human genomic DNA encapsidated in rAAVs (bottom) in either wild-type (WT) cells, cells nucleofected with ribonucleic proteins (RNPs) containing a scrambled gRNA, or engineered cell line containing either: (a) a CASP3 single KO, (b) a IFNAR1 single KO, or (c) a BAX BAK1 double KO.DETAILED DESCRIPTION
[0077] Polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods to increase stability of cells for AAV production are provided. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to produce cell lines for recombinant AAV (rAAV) production that have increased stability by reducing cytotoxic effects from leaky expression of genes for rAAV production. In particular, among embodiments herein are polynucleotides, vectors, systems of vectors or polynucleotides and cells that include a polynucleotide encoding an inducible Rep protein that includes a ribozyme in the uninduced Rep sequence. In such an embodiment, in cases in which Rep proteins are expressed as a result of leaky expression in the uninduced state, they are cleaved to be non-functional by a ribozyme of the Rep construct. Once induced, the ribozyme is removed from the Rep construct, allowing Rep protein expression and function in the induced state for producing rAAV.
[0078] The gene therapy industry is an ever-growing therapeutic approach, and AAV is the dominant delivery vehicle. Yet, current approaches to rAAV manufacturing are inefficient. Many existing methods rely on transient expression systems, and in particular on triple transient transfection of a helper plasmid construct, a Rep / Cap construct, and a construct encoding a gene of interest (“payload”). The most widely used method for producing rAAV virions is based on the helper-virus-free transient transfection of multiple plasmids, typically a triple transfection, into adherent cell lines. Often transient transfections result in mixed populations of transfected cells where only some of the cells are actually transfected with all plasmid constructs. The system can result in a heterogenous viral product and / or result in a product that10MOFO-359992482324632001140 is severely limited due to low yield, high impurity, lack of consistent scalability and reproducibility, and unsustainable production costs. Moreover, these problems can lead to requiring high doses of rAAV for therapeutic applications, which can lead to toxic therapies.
[0079] Although there is ongoing investment to increase production capacity, current AAV manufacturing processes are inefficient and expensive. In addition, they result in variable product quality, with low levels of encapsidation of a payload, such as a therapeutic payload. Therefore, there is a need for new and improved methods to overcome these challenges while balancing the need for robust expression of the AAV proteins required for rAAV production with the toxicity of these proteins to the host production cell.
[0080] The provided embodiments address these problems. The provided embodiments provide a system in which cells in which AAV proteins are expressed exhibit increased generational stability due to control of leaky expression of AAV proteins that may otherwise result in potential toxicity to host cell production.
[0081] In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of small Rep proteins. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of large Rep proteins. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of Cap proteins. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of adenovirus helper proteins. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of VA-RNA. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of a payload. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of one or more of small Rep proteins, large Rep proteins, Cap proteins, helper proteins, VA-RNA, and / or a payload. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of at least one of small Rep proteins, large Rep proteins, Cap proteins, helper proteins, VA-RNA, and / or a payload. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of more than one of small Rep proteins, large Rep proteins, Cap proteins, helper proteins, VA-RNA, and / or a payload. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of more than two of small Rep proteins, large Rep proteins, Cap proteins, helper proteins, VA-RNA, and / or a payload. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of more than three of small Rep proteins, large Rep proteins, Cap proteins, helper proteins, VA-RNA, and / or a payload. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of more than four11MOFO-359992482324632001140 of small Rep proteins, large Rep proteins, Cap proteins, helper proteins, VA-RNA, and / or a payload. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of more than five of small Rep proteins, large Rep proteins, Cap proteins, helper proteins, VA-RNA, and / or a payload. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to reduce leaky expression of all of small Rep proteins, large Rep proteins, Cap proteins, helper proteins, VA-RNA, and / or a payload.
[0082] In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to produce rAAV. Reducing leaky expression of one or more genes for AAV production is useful in increasing cellular viability in cell lines that integrate the genes for AAV production into their genomes. Reducing leaky expression of one or more genes for AAV production is useful in increasing viable cell density (VCD) in cell lines that integrate the genes for AAV production into their genomes. Reducing leaky expression of one or more genes for AAV production is useful in increasing both cell viability and VCD in cell lines that integrate the genes for AAV production into their genomes.
[0083] In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to produce rAAV. Reducing leaky expression of one or more genes for AAV production is useful in maintaining cells in culture until a desired time to produce rAAV virions. Reducing leaky expression of one or more genes for AAV production is useful in maintaining cells in culture until cells are induced for rAAV virion production. Reducing leaky expression of one or more genes for AAV virion production is useful in maintaining cells in culture until the cells are induced for rAAV virion production and until a desirable time to produce rAAV virions.
[0084] In provided embodiments as described, the system also allows for stable integration of all genetic elements required for AAV production into host cells. As described, this can be achieved by using cell selections (e.g., antibiotic selection) for stable cell clones from polyclonal pools, allowing generation of a monoclonal cell line for each gene of interest (payload) system that expresses all plasmids for AAV production, such as following single cell seeding, outgrowth and expansion and screening for high expressing clones. Moreover, exquisite control of viral gene expression also is achieved using the various inducible systems in combination with the ribozyme as part of the Rep construct cassette. This means that toxic elements can be kept fully silenced (e.g., not transcribed and / or not translated) until induced when there is peak cell density and fitness. In the uninduced or off state, viral genes that normally can be toxic to host cells, such as E2A and E4 helper proteins, Rep proteins and Cap proteins, are not expressed. However, in the induced state, the viral genes (e.g., expressing E2A and E4 helper proteins, Rep proteins, and Cap proteins) are allowed to be expressed resulting in highly efficient virion production. Among provided aspects, the system allows high titer production of as much as 1.5e12vg / L or more including a titer of greater than 1.5e13vg / L or greater than 1.5e14vg / L. For example, in provided aspects, the system allows high titer production of as much as 1.5e14vg / L or more including a titer of greater than 2e14vg / L, greater than 3e14vg / L, greater than 4e14vg / L, greater than 5e14vg / L and higher. In provided aspects, the system also allows an increase in filled capsids, with a packaging efficiency of greater than 15%, greater12MOFO-359992482324632001140 than 20%, greater than 25%, greater than 30%, greater than 35%, greater than 40%, greater than 50%, greater than 60%, greater than 70% or more, even pre -purification. In some embodiments, such packaging efficiency (e.g., with as much as 70% packaging efficiency) can be achieved while maintaining the high Vg titers. As a result, the provided systems allow for manufacturing processes to produce rAAV more efficiently, in a shorter amount of time, more consistently and with a high robustness of titer and packaging, thereby allowing for decreased dose, decreased cost, lower toxicity / adverse effects, and / or consistent patient dosing. Compared to methods using transient transfection, the systems allow for as much as multiple-fold improvements in manufacturing productivity as determined by increased yield (e.g., titer (vg / mL) from cell lysates), increased quality (e.g., percent packaging efficiency pre-purification), and increased performance (e.g., high-yield pay load expression of transduced cells). For example, the increased yield can be greater than 10-fold, greater than 20-fold, greater than 30-fold or more final product per production volume. The improvements can be seen across AAV serotypes, including AAV9, AAV5, AAV2 and other serotypes.
[0085] Before the present polynucleotides, vectors, systems, cells, and methods are described, it is to be understood that this invention is not limited to particular methods or components described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
[0086] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0087] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, some potential and preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. It is understood that the present disclosure supersedes any disclosure of an incorporated publication to the extent there is a contradiction.
[0088] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may13MOFO-359992482324632001140 be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method may be carried out in the order of events recited or in any other order which is logically possible.
[0089] It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells, and reference to "the vector" includes reference to one or more vectors and equivalents thereof, such as viral vectors, plasmids, constructs, and the like, known to those skilled in the art, and so forth.
[0090] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
[0091] It must be noted that as used herein and in the appended claims, references to numerical order — e.g., “first,” “second,” “third,” etc. — may be used for convenience to differentiate between similar components or features. Such reference is for purpose of distinguishing the components being referred to. Unless mandated by the text or context, such references to order should not be considered to force order on any such component. It also is understood that reference to such distinguishing terms is non-limiting and does not mean that such a number of components is necessarily present or present in any particular order.I. Definitions
[0092] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which the invention pertains.
[0093] The term "about", particularly in reference to a given quantity, is meant to encompass deviations of up to plus or minus five percent.
[0094] "AAV" is an abbreviation for adeno-associated virus and may be used to refer to the virus itself or derivatives thereof. The term covers all subtypes and both naturally occurring and recombinant forms, except where required otherwise. The components of the AAV DNA genome consists of two open reading frames, Rep and Cap, flanked by two 145 base inverted terminal repeats (ITRs). Rep gene encodes multiple distinct proteins including Rep78, Rep68, Rep52, and Rep40. These proteins are also referred to herein as Rep proteins or Rep and may encompass one or more of Rep78, Rep68, Rep52, and Rep40 and functional variants thereof and homologs thereof. Rep78 and Rep68 and functional variants thereof and homologs thereof are referred to herein as large Rep. Rep52, and Rep40 and functional variants thereof and homologs thereof are referred to herein as small Rep. Rep proteins from an AAV of a particular serotype may also be referred to as Repl, Rep2, etc. where the Rep protein is derived from an AAV1 or an AAV2 serotype, respectively. Cap gene encodes capsid proteins VP1, VP2, and VP3 required for14MOFO-359992482324632001140 production of rAAV capsids. These proteins are also referred to herein as Cap proteins or Cap and may encompass one or more of VP1, VP2, and VP3 and functional variants thereof and homologs thereof. Cap proteins from an AAV of a particular serotype may also be referred to as Capl, Cap2, Cap4, etc. where the Rep protein is derived from an AA1, an AAV2, or an AAV5 serotype, respectively. In addition to Rep and Cap, AAV requires a helper plasmid containing genes from a helper virus such as adenovirus, including Ela, Elb, E4, E2a, and VA genes for AAV replication.
[0095] "Recombinant virus" is meant to describe a virus that has been genetically altered, e.g., by the addition or insertion of a heterologous nucleic acid construct into the virus.
[0096] The abbreviation "rAAV" refers to recombinant adeno-associated virus, also referred to as a recombinant AAV vector (or "rAAV vector"). The term “AAV” includes any AAV serotype as well as AAV vectors based on the combination of different serotypes (also referred to as "hybrid AAV vectors" or "pseudotype AAV vectors"). AAV serotype may be AAV type 1 (AAV-1), AAV type 2 (AAV-2), AAV type 3 (AAV-3), AAV type 4 (AAV-4), AAV type 5 (AAV-5), AAV type 6 (AAV-6), AAV type 7 (AAV- 7), AAV type 8 (AAV-8), AAV type 9 (AAV-9), AAV type 10 (AAV-10), AAV type 11 (AAV-11), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, AAV-7m8, AAV-6.2, AAV-Dj, AAV-DJ / 8, AAV2-retro, AAV2-QuadYF and AAV2.7m8, AAV-PHP.B, AAV- PHP.B2, AAV-PHP.B3, AAV-PHP.A, AAV-PHP.eB, AAV-PHP.eS, evolved capsids that are less immunogenic to mice and humans, and variants thereof and combinations thereof. “Primate AAV” refers to AAV isolated from a primate, “non-primate AAV” refers to AAV isolated from a non-primate mammal, “bovine AAV” refers to AAV isolated from a bovine mammal (e.g., a cow), etc. An "rAAV vector" comprises a polynucleotide sequence not of AAV origin (i.e., a polynucleotide heterologous to AAV), typically a polynucleotide sequence of interest for introducing into a target cell. In general, the heterologous polynucleotide is flanked by at least one, and usually by two AAV inverted terminal repeat sequences (ITRs). The heterologous polynucleotide can also be referred to as a polynucleotide pay load. The term rAAV vector encompasses both rAAV virions and rAAV vector plasmids.
[0097] An "AAV virus" or "AAV viral particle" or "rAAV vector particle" or “rAAV particle” refers to a viral particle composed of at least one AAV capsid protein (typically by all of the capsid proteins of a wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than a wild-type AAV genome, such as a transgene to be delivered to a mammalian cell), it is typically referred to as an "rAAV vector particle" or simply an "rAAV vector". Thus, production of a rAAV particle necessarily includes production of a rAAV vector, as such a vector contained within an rAAV particle.
[0098] "Packaging" refers to a series of intracellular events that result in the assembly, encapsidation, and production of an AAV particle.
[0099] AAV "rep" and "cap" genes refer to polynucleotide sequences encoding replication and capsid proteins of adeno-associated virus. AAV rep and cap are referred to herein as AAV "packaging genes."15MOFO-359992482324632001140
[0100] By "AAV Rep coding region" or “sequence encoding one or more Rep proteins” or “Rep encoding sequence” and grammatical equivalents thereof is meant the art-recognized region of the AAV genome which encodes the replication proteins of the virus which are required to replicate the viral genome and / or a payload flanked by ITRs. The rep coding region, as used herein, may be derived from any viral serotype, such as those described above. The region need not include all of the wild-type genes but may be altered, e.g., by the insertion, deletion or substitution of nucleotides, so long as the rep genes provide for expression Rep proteins. Rep coding sequences are further described below.
[0101] By "AAV cap coding region" or “sequence encoding one or more cap proteins,” or “Cap encoding sequence” and grammatical equivalents thereof it is meant the art-recognized region of the AAV genome which encodes the coat proteins of the virus which are required for the capsid that viral genome or a payload is packaged into by the Rep proteins. For a further description of the cap coding region, see, e.g., Muzyczka, N. (1992) Current Topics in Microbiol, and Immunol. 158, 97-129; Kotin, R. M. (1994) Human Gene Therapy 5, 793-801. The AAV cap coding region, as used herein, may be derived from any AAV serotype, as described above. The region need not include all of the wild-type cap genes but may be altered, e.g., by the insertion, deletion or substitution of nucleotides, so long as the genes provide for sufficient packaging functions. Cap coding sequences are further described below.
[0102] By "adeno-associated virus inverted terminal repeats" or "AAV ITRs" is meant the art- recognized regions found at each end of the AAV genome which function together in cis as origins of DNA replication and as packaging signals for the viral genome. The nucleotide sequences of AAV ITR regions are known. See, e.g., Kotin, R. M. (1994) Human Gene Therapy 5, 793-801; Berns, K. I. "Parvoviridae and their Replication" in Fundamental Virology, 2d ed., (B. N. Fields and D. M. Knipe, eds.) for the AAV- 2 ITRs sequence. As used herein, an "AAV ITR" need not have a wild-type nucleotide sequence, but may be altered, e.g., by the insertion, deletion or substitution of nucleotides. The AAV ITR may be derived from any of several AAV serotypes, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV- 5, AAV-7, etc. Furthermore, 5' and 3' ITRs which flank a selected nucleotide sequence in an AAV vector need not necessarily be identical or derived from the same AAV serotype or isolate. The ITRs may be single stranded (ssITRs) or self-complementary (scITRs).
[0103] A "helper virus" for AAV refers to a virus that allows AAV (e.g., wild-type AAV) to be replicated and packaged by a mammalian cell. A variety of such helper viruses for AAV are known in the art, including adenoviruses, herpesviruses and poxviruses such as vaccinia. The adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C is most commonly used. Numerous adenoviruses of human, non-human mammalian and avian origin are known and available from depositories such as the American Type Culture Collection (ATCC). Viruses of the herpes family include, for example, herpes simplex viruses (HSV) and Epstein-Barr viruses (EBV), as well as cytomegaloviruses (CMV) and pseudorabies viruses (PRV); which are also available from depositories such as ATCC.
[0104] "Helper virus function(s)" refers to function(s) encoded in a helper virus genome which allow AAV replication and packaging (in conjunction with other requirements for replication and16MOFO-359992482324632001140 packaging described herein). As described herein, "helper virus function" may be provided in a number of ways, including by providing helper virus or providing, for example, polynucleotide sequences encoding the requisite function(s) to a producer cell in trans.
[0105] An "infectious" virus or viral particle is one that comprises a polynucleotide component, which the virus or viral particle is capable of delivering into a cell for which the viral species is tropic. The term does not necessarily imply any replication capacity of the virus. As used herein, an “infectious” virus or viral particle is one that may access a target cell, may infect a target cell, and may express a heterologous nucleic acid in a target cell. Thus, “infectivity” refers to the ability of a viral particle to access a target cell, infect a target cell, and express a heterologous nucleic acid in a target cell. Infectivity may refer to in vitro infectivity or in vivo infectivity. Assays for counting infectious viral particles are described elsewhere in this disclosure and in the art. Viral infectivity may be expressed as the ratio of infectious viral particles to total viral particles. Total viral particles may be expressed as the number of viral genome (vg) copies. The ability of a viral particle to express a heterologous nucleic acid in a cell may be referred to as “transduction.” The ability of a viral particle to express a heterologous nucleic acid in a cell may be assayed using a number of techniques, including assessment of a marker gene, such as a green fluorescent protein (GFP) assay (e.g., where the virus comprises a nucleotide sequence encoding GFP), where GFP is produced in a cell infected with the viral particle and is detected and / or measured; or the measurement of a produced protein, for example by an enzyme-linked immunosorbent assay (ELISA). Viral infectivity may be expressed as the ratio of infectious viral particles to total viral particles. Methods of determining the ratio of infectious viral particle to total viral particle are known in the art. See, e.g., Grainger et al. (2005) Mol. Ther. 11 :S337 (describing a TCID50 infectious titer assay); and Zolotukhin et al. (1999) Gene Ther. 6:973.
[0106] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The term polynucleotide, as used herein, refers interchangeably to double - and single-stranded molecules. Unless otherwise specified or required, any embodiment of the invention described herein that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form.
[0107] As used herein, the term “polynucleotide construct” refers to a DNA segment of any size that includes one or more sequences encoding an RNA or protein and at least one promoter for driving expression from the one or more sequences. A polynucleotide construct may be a circular DNA or a linear DNA. A polynucleotide construct may be single stranded or double stranded. As used herein, the term "vector" includes any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which may transfer gene sequences into and between cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors. The use of the term "vector" throughout this17MOFO-359992482324632001140 specification encompasses plasmid or viral vectors, which permit the desired components to be transferred to the host cell via transfection or infection. For example, an adeno-associated viral (AAV) vector is a plasmid comprising a recombinant AAV genome. In some embodiments, useful vectors are contemplated to be those vectors in which the nucleic acid segment to be transcribed is positioned under the transcriptional control of a promoter. A vector may be linear or circular, single stranded or double stranded, DNA or RNA. In certain aspects, the vector may be circular, double stranded DNA.
[0108] As used herein, the term “vector system” refers to two or more vectors that are used together, e.g., by simultaneous or sequential introduction into a cell, to provide at least two different components into the cell. The two different components may then work together in the cell.
[0109] A polynucleotide or polypeptide has a certain percent "sequence identity" to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same when comparing the two sequences. The term percent “sequence identity,” in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the percent “sequence identity” can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.
[0110] For sequence comparison, typically one sequence acts as a reference sequence (also called the subject sequence) to which test sequences (also called query sequences) are compared. The percent sequence identity is defined as a test sequence’s percent identity to a reference sequence. For example, when stated “Sequence A having a sequence identity of 50% to Sequence B,” Sequence A is the test sequence and Sequence B is the reference sequence. When using a sequence comparison algorithm, test and reference sequences are input into a computer program, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then aligns the sequences to achieve the maximum alignment, based on the designated program parameters, introducing gaps in the alignment if necessary. The percent sequence identity for the test sequence(s) relative to the reference sequence can then be determined from the alignment of the test sequence to the reference sequence. The equation for percent sequence identity from the aligned sequence is as follows:[(Number of Identical Positions) / (Total Number of Positions in the Test Sequence)] x 100%
[0111] For purposes herein, percent identity and sequence similarity calculations are performed using the BLAST algorithm for sequence alignment, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ). The BLAST algorithm uses a test sequence (also called a query sequence) and a reference sequence (also called a subject sequence) to search18MOFO-359992482324632001140 against, or in some cases, a database of multiple reference sequences to search against. The BLAST algorithm performs sequence alignment by finding high-scoring alignment regions between the test and the reference sequences by scoring alignment of short regions of the test sequence (termed “words”) to the reference sequence. The scoring of each alignment is determined by the BLAST algorithm and takes factors into account, such as the number of aligned positions, as well as whether introduction of gaps between the test and the reference sequences would improve the alignment. The alignment scores for nucleic acids can be scored by set match / mismatch scores. For protein sequences, the alignment scores can be scored using a substitution matrix to evaluate the significance of the sequence alignment, for example, the similarity between aligned amino acids based on their evolutionary probability of substitution. For purposes herein, the substitution matrix used is the BLOSUM62 matrix. For purposes herein, the public default values of April 6, 2023 are used when using the BLASTN and BLASTP algorithms. The BLASTN and BLASTP algorithms then output a “Percent Identity” output value and a “Query Coverage” output value. The overall percent sequence identity as used herein can then be calculated from the BLASTN or BLASTP output values as follows:Percent Sequence Identity = (“Percent Identity” output value) x (“Query Coverage” output value)
[0112] The following non-limiting examples illustrate the calculation of percent identity between two nucleic acids sequences. The percent identity is calculated as follows: [(number of identical nucleotide positions) / (total number of nucleotides in the test sequence)] x 100%. Percent identity is calculated to compare test sequence 1: AAAAAGGGGG (length = 10 nucleotides, SEQ ID NO: 263) to reference sequence 2: AAAAAAAAAA (length = 10 nucleotides, SEQ ID NO: 264). The percent identity between test sequence 1 and reference sequence 2 would be [(5) / (10)] xl00% = 50%. Test sequence 1 has 50% sequence identity to reference sequence 2. In another example, percent identity is calculated to compare test sequence 3: CCCCCGGGGGGGGGGCCCCC (length = 20 nucleotides, SEQ ID NO: 265) to reference sequence 4: GGGGGGGGGG (length = 10 nucleotides, SEQ ID NO: 266). The percent identity between test sequence 3 and reference sequence 4 would be [(10) / (20)] xl00% = 50%. Test sequence 3 has 50% sequence identity to reference sequence 4. In another example, percent identity is calculated to compare test sequence 5: GGGGGGGGGG (length = 10 nucleotides, SEQ ID NO: 266) to reference sequence 6: CCCCCGGGGGGGGGGCCCCC (length = 20 nucleotides, SEQ ID NO: 267). The percent identity between test sequence 5 and reference sequence 6 would be [(10) / (10)] xl00% = 100%. Test sequence 5 has 100% sequence identity to reference sequence 6.
[0113] The following non-limiting examples illustrate the calculation of percent identity between two protein sequences. The percent identity is calculated as follows: [(number of identical amino acid positions) / (total number of amino acids in the test sequence)] x 100%. Percent identity is calculated to compare test sequence 7: FFFFFYYYYY (length = 10 amino acids; SEQ ID NO: 268) to reference sequence 8: YYYYYYYYYY (length = 10 amino acids; SEQ ID NO: 269). The percent identity between test sequence 7 and reference sequence 8 would be [(5) / (10)] xl00% = 50%. Test sequence 7 has 50% sequence identity to reference sequence 8. In another example, percent identity is calculated to compare19MOFO-359992482324632001140 test sequence 9: LLLLLFFFFFYYYYYLLLLL (length = 20 amino acids; SEQ ID NO: 270) to reference sequence 10: FFFFFYYYYY (length = 10 amino acids; SEQ ID NO: 268). The percent identity between test sequence 9 and reference sequence 10 would be [(10) / (20)] xl00% = 50%. Test sequence 9 has 50% sequence identity to reference sequence 10. In another example, percent identity is calculated to compare test sequence 11: FFFFFYYYYY (length = 10 amino acids; SEQ ID NO: 268) to reference sequence 12: LLLLLFFFFFYYYYYLLLLL (length = 20 amino acids, SEQ ID NO: 270). The percent identity between test sequence 11 and reference sequence 12 would be [(10) / (10)] xl00% = 100%. Test sequence 11 has 100% sequence identity to reference sequence 12.
[0114] For purposes herein, reference to a polynucleotide sequence (e.g., a DNA sequence or an RNA sequence) also encompasses the reverse complement of the polynucleotide sequence. For example, a sequence of AAAAAGGGGG (SEQ ID NO: 263) also encompasses a sequence of CCCCCTTTTT (SEQ ID NO: 271).
[0115] A "gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular protein after being transcribed and translated.
[0116] The term "host cell" denotes, for example, microorganisms, yeast cells, insect cells, and mammalian cells, that may be, or have been, used as recipients of an AAV vector system as described herein, or other transfer DNA. The term includes the progeny of the original cell which has been transfected. Thus, a "host cell" as used herein generally refers to a cell which has been transfected with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to natural, accidental, or deliberate mutation.
[0117] As used herein, the term "cell line" refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes may occur in karyotype during storage or transfer of such clonal populations. Therefore, cells derived from the cell line referred to may not be precisely identical to the ancestral cells or cultures, and the cell line referred to includes such variants.
[0118] The term "cell culture," refers to cells grown adherent or in suspension, bioreactors, roller bottles, hyperstacks, microspheres, macrospheres, flasks and the like, as well as the components of the supernatant or suspension itself, including but not limited to rAAV particles, cells, cell debris, cellular contaminants, colloidal particles, biomolecules, host cell proteins, nucleic acids, and lipids, and flocculants. Large scale approaches, such as bioreactors, including suspension cultures and adherent cells growing attached to microcarriers or macrocarriers in stirred bioreactors, are also encompassed by the term "cell culture. " Cell culture procedures for both large and small-scale production of proteins are encompassed by the present disclosure.20MOFO-359992482324632001140
[0119] The encapsidation ratio of a population of rAAV virions may be measured as the ratio of rAAV viral particle (VP) to viral genome (VG). The rAAV viral particle includes empty capsids, partially full capsids (e.g., comprising a partial viral genome), and full capsids (e.g., comprising a full viral genome).
[0120] The F:E ratio of a population of rAAV virions may be measured as the ratio of rAAV full capsids to empty capsids. The rAAV full capsid particle includes partially full capsids (e.g., comprising a partial viral genome) and full capsids (e.g., comprising a full viral genome). The empty capsids lack a viral genome.
[0121] The potency or infectivity of a population of rAAV virions may be measured as the percentage of target cells infected by the rAAV virions at a multiplicity of infection (MOI; viral genomes / target cell). Exemplary MOI values are 1 x 101, 1 x 102, 2 x 103, 5 x 104, or 1 x 105vg / target cell. An MOI may be a value chosen from the range of 1 x 101to 1 x 105vg / target cell.
[0122] The term “auxotrophic” or “auxotrophic selection marker” as used herein refers to the usage of a medium lacking a supplement, such as a medium lacking an essential nutrient such as the purine precursors hypoxanthine and thymidine (HT), or the like, for selection of a functional enzyme which allows for growth in the medium lacking the essential nutrient, e.g., a functional dihydrofolate reductase or the like.
[0123] The terms “tetracycline” is used generically herein to refer to all antibiotics that are structurally and functionally related to tetracycline, including tetracycline, doxycycline, demeclocycline, minocycline, sarecycline, oxytetracycline, omadacycline, or eravacycline.
[0124] The terms “constitutive” or “constitutive expression” are used interchangeably herein. They refer to genes that are transcribed in an ongoing manner. Such gene are driven by a constitutive promoter. In some embodiments, the terms refer to the expression of a therapeutic payload or a nucleic acid sequence that is not conditioned on addition of an expression triggering agent to the cell culture medium. A constitutive promoter is capable of directing continuous gene expression in a cell. Constitutive promoters regulate expression of basal genes, like housekeeping genes. In contrast, an inducible promoter directs gene expression in the presence of particular transcription activator(s) or absence of a transcription repressor(s). Thus, an inducible promoter can be controlled by controlling the level of the transcription activator(s) or transcription repressor(s).
[0125] As used herein, the term “polynucleotide payload” refers to a polynucleotide sequence that is packaged into a rAAV virion for delivery by the rAAV virion into a cell. A polynucleotide payload is flanked by AAV inverted terminal repeats (ITRs). Upon delivery to a cell, the polynucleotide payload may be available to the cell as a DNA (e.g., a homology region for homology-directed repair), transcribed into an RNA (e.g., a guide RNA (gRNA), a tRNA, a suppressor tRNA, a siRNA, a miRNA, an mRNA, a shRNA, a circular RNA, an antisense oligonucleotide (ASO)), or transcribed and translated into a polypeptide (e.g., an antibody, a hormone, a site-specific endonuclease, a reporter gene, a component of a CRISPR / Cas system, an adenosine deaminase acting on RNA (ADAR) enzyme, a transcriptional activator, a transcriptional repressor, a ribozyme, or a DNAzyme.21MOFO-359992482324632001140
[0126] "Recombinant," as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature. A recombinant virus is a viral particle comprising a recombinant polynucleotide. The terms respectively include replicates of the original polynucleotide construct and progeny of the original virus construct.
[0127] A "control element" or "control sequence" is a nucleotide sequence involved in an interaction of molecules that contributes to the functional regulation of a polynucleotide, including replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. The regulation may affect the frequency, speed, or specificity of the process, and may be enhancing or inhibitory in nature. Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A promoter is a DNA region capable under certain conditions of binding RNA polymerase and initiating transcription of a coding region usually located downstream (in the 3' direction) from the promoter. A promoter is usually upstream of a gene whose expression is controlled by the promoter.
[0128] "Operatively linked" or "operably linked" refers to a juxtaposition of genetic elements, wherein the elements are in a relationship permitting them to operate in the expected manner. For instance, a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence. There may be intervening residues between the promoter and coding region so long as this functional relationship is maintained.
[0129] "Heterologous" means derived from a genotypically distinct entity from that of the rest of the entity to which it is being compared. For example, a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence with which it is not naturally found linked is a heterologous promoter. Thus, for example, an rAAV that includes a heterologous nucleic acid encoding a heterologous payload is an rAAV that includes a nucleic acid not normally included in a naturally-occurring, wild-type AAV, and the encoded heterologous payload is a payload not normally encoded by a naturally-occurring, wild-type AAV. As another example, a large Rep coding sequence operatively linked to a heterologous promoter refers to a large Rep coding sequence operatively linked to a non-native promoter.
[0130] A cell is said to be "stably" altered, transduced, genetically modified, or transformed with a genetic sequence if the sequence is available to perform its function during extended culture of the cell in vitro. Generally, such a cell is "heritably" altered (genetically modified) in that a genetic alteration is introduced which is also inheritable by progeny of the altered cell. For example, a gene integrated into the nuclear genome of the cell and is available to perform its function during extended culture of the cell in vitro. A gene integrated into the nuclear genome of the cell is inheritable by progeny of the cell.
[0131] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The terms also encompass an amino acid polymer that has been22MOFO-359992482324632001140 modified; for example, disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with a labeling component. Polypeptides such as anti-angiogenic polypeptides, neuroprotective polypeptides, and the like, when discussed in the context of delivering a payload to a mammalian subject, and compositions therefor, refer to the respective intact polypeptide, or any fragment or genetically engineered derivative thereof, which retains the desired biochemical function of the intact protein. Similarly, references to nucleic acids encoding anti-angiogenic polypeptides, nucleic acids encoding neuroprotective polypeptides, and other such nucleic acids for use in delivery of a payload to a mammalian subject (which may be referred to as "transgenes" to be delivered to a recipient cell), include polynucleotides encoding the intact polypeptide or any fragment or genetically engineered derivative possessing the desired biochemical function.
[0132] An "isolated" plasmid, nucleic acid, vector, virus, virion, host cell, or other substance refers to a preparation of the substance devoid of at least some of the other components that may also be present where the substance or a similar substance naturally occurs or is initially prepared from. Thus, for example, an isolated substance may be prepared by using a purification technique to enrich it from a source mixture. Enrichment may be measured on an absolute basis, such as weight per volume of solution, or it may be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments of this invention are increasingly more isolated. An isolated plasmid, nucleic acid, vector, virus, host cell, or other substance is in some cases purified, e.g., from about 80% to about 90% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99%, or more, pure.
[0133] The terms "treatment", "treating", "treat" and the like are used herein to generally refer to obtaining a desired pharmacologic and / or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom(s) thereof and / or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and / or adverse effect attributable to the disease. The term “treatment" encompasses any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease and / or symptom(s) from occurring in a subject who may be predisposed to the disease or symptom(s) but has not yet been diagnosed as having it; (b) inhibiting the disease and / or symptom(s), i.e., arresting development of a disease and / or the associated symptoms; or (c) relieving the disease and the associated symptom(s), i.e., causing regression of the disease and / or symptom(s). Those in need of treatment may include those already afflicted (e.g., those with a neurological disorder) as well as those in which prevention is desired (e.g., those with increased susceptibility to a neurological disorder; those suspected of having a neurological disorder; those having one or more risk factors for a neurological disorder, etc.).
[0134] A "therapeutically effective amount" or "efficacious amount" means the amount of a compound that, when administered to a mammal or other subject for treating a disease, is sufficient, in combination with another agent, or alone in one or more doses, to effect such treatment for the disease.23MOFO-359992482324632001140The "therapeutically effective amount" will vary depending on the compound, the disease and its severity and the age, weight, etc., of the subject to be treated.
[0135] The terms “individual,” “host,” “subject,” and “patient” are used interchangeably herein, and refer to a mammal, including, but not limited to, human and non-human primates, including simians and humans; mammalian sport animals (e.g., horses, camels, etc.); mammalian farm animals (e.g., sheep, goats, cows, etc.); mammalian pets (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.). In some cases, the individual is a human.
[0136] The terms "hybridize" and "hybridization" refer to the formation of complexes between nucleotide sequences which are sufficiently complementary to form complexes via Watson Crick base pairing.
[0137] The term "homologous region" refers to a region of a nucleic acid with homology to another nucleic acid region. Thus, whether a "homologous region" is present in a nucleic acid molecule is determined with reference to another nucleic acid region in the same or a different molecule. Further, since a nucleic acid is often double-stranded, the term "homologous, region," as used herein, refers to the ability of nucleic acid molecules to hybridize to each other. For example, a single-stranded nucleic acid molecule may have two homologous regions which are capable of hybridizing to each other. Thus, the term "homologous region" includes nucleic acid segments with complementary sequences. Homologous regions may vary in length, but will typically be between 4 and 500 nucleotides (e.g., from about 4 to about 40, from about 40 to about 80, from about 80 to about 120, from about 120 to about 160, from about 160 to about 200, from about 200 to about 240, from about 240 to about 280, from about 280 to about 320, from about 320 to about 360, from about 360 to about 400, from about 400 to about 440, etc.).
[0138] As used herein, the terms "complementary" or "complementarity" refers to polynucleotides that are able to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in an anti-parallel orientation between polynucleotide strands. Complementary polynucleotide strands may base pair in a Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil (U) rather than thymine (T) is the base that is considered to be complementary to adenosine. However, when a uracil is denoted in the context of the present invention, the ability to substitute a thymine is implied, unless otherwise stated. "Complementarity" may exist between two RNA strands, two DNA strands, or between an RNA strand and a DNA strand. It is generally understood that two or more polynucleotides may be "complementary" and able to form a duplex despite having less than perfect or less than 100% complementarity. Two sequences are "perfectly complementary" or "100% complementary" if at least a contiguous portion of each polynucleotide sequence, comprising a region of complementarity, perfectly base pairs with the other polynucleotide without any mismatches or interruptions within such region. Two or more sequences are considered "perfectly complementary" or "100% complementary" even if either or both polynucleotides contain additional non-complementary sequences as long as the contiguous region of complementarity within each24MOFO-359992482324632001140 polynucleotide is able to perfectly hybridize with the other. "Less than perfect" complementarity refers to situations where less than all of the contiguous nucleotides within such region of complementarity are able to base pair with each other. Determining the percentage of complementarity between two polynucleotide sequences is a matter of ordinary skill in the art.
[0139] As used herein, the term “recombination site” denotes a region of a nucleic acid molecule comprising a binding site or sequence-specific motif recognized by a site-specific recombinase that binds at the target site and catalyzes recombination of specific sequences of DNA at the target site. Site-specific recombinases catalyze recombination between two such target sites. The relative orientation of the target sites determines the outcome of recombination. For example, translocation occurs if the recombination sites are on separate DNA molecules. DNA between two recombination sites oriented in the same direction on the same DNA molecule will be excised as a circular loop of DNA. DNA between two recombination sites that are orientated in the opposite direction on the same DNA molecule will be inverted.
[0140] As used herein, the term “enhancer” refers to a non-translated nucleic acid sequence that is contiguous with the coding sequence (in cis) and functions to increase expression of the transcript and / or protein from the coding sequence. Enhancers can include transcriptional enhancers or translational enhancers. Transcriptional enhancers are DNA sequences and influence the rate at which a nearby gene is transcribed into messenger RNA (mRNA) and, ultimately, translated into a functional protein. A translational enhancer is a specific sequence or structural element in messenger RNA (mRNA) that plays a role in regulating the process of translation. Translational enhancers can be involved in modulating the efficiency or specificity of translation.
[0141] The terms "antibody" and “immunoglobulin” include antibodies or immunoglobulins of any isotype, fragments of antibodies which retain specific binding to antigen, including, but not limited to, Fab, Fv, scFv, and Fc fragments, chimeric antibodies, humanized antibodies, single-chain antibodies, including antibodies comprising only heavy chains (e.g. VHH camelid antibodies), bispecific antibodies, and fusion proteins comprising an antigen-binding portion of an antibody and a non-antibody protein.
[0142] The term “ribozyme” refers to catalytically active nucleic acid molecules, including DNA, RNA, and combinations thereof. Ribozymes are capable of catalyzing cleavage, splicing, ligation, and other reactions. Certain ribozymes are c / 'v-acting, such that they catalyze a reaction on the same molecule or trans-acting, such that they catalyze a reaction on a different molecule.
[0143] The term “leaky expression” refers to gene expression, when the gene is not supposed to be expressed — such expression can include transcription of the gene and / or translation of the gene. As a non-limiting example, gene expression of a gene that is operably linked to an inducible promoter absent an inducing or triggering agent is leaky expression. An additional non-limiting example of leaky expression includes expression of a gene in the presence of silencing agent or inhibitor.
[0144] The term “c / 'v-acting” refers to a regulatory element or sequence located on the same polynucleotide as a coding sequence it regulates. These elements function locally to regulate the expression of nearby coding sequences. Non-limiting examples of c / 'v-acting elements or factors include promoters,25MOFO-359992482324632001140 enhancers, and silencers. Some factors encode a functional nucleotide sequence, such as a DNAzyme or ribozyme.II. Polynucleotides and Polynucleotide Systems
[0145] Various embodiments are directed to one or more polynucleotides, where each polynucleotide comprises a sequence encoding a component for rAAV production. A collection of polynucleotides may be considered a “polynucleotide system,” “a system of polynucleotides,” “a polynucleotide set,” and / or “a set of polynucleotides.” The polynucleotides described herein contain expression cassettes containing coding sequences for a component for rAAV production as well as necessary regulatory sequences for transcription, such as a promoter, enhancer and / or polyA sequence.A. Polynucleotides Encoding Ribozymes for Sustainable AAV production
[0146] A polynucleotide is provided that includes a ribozyme. In various embodiments, the ribozyme catalyzes a hydrolytic reaction. In certain instances, the ribozyme catalyzes a cleavage reaction within an RNA molecule. In some instances, the ribozyme catalyzes a self-cleavage reaction within an RNA molecule (e.g., civ-acting reaction), such that the ribozyme cleaves an RNA molecule at the position of the ribozyme.
[0147] In various instances, one or more sequences encoding a protein for AAV production includes a sequence encoding a civ-acting ribozyme. In various instances, one or more sequences encoding a protein for AAV production is located upstream of (5’ of) a sequence encoding civ-acting ribozyme. In various instances, one or more sequences encoding a proteinfor AAV production is located downstream of (3’ of) a sequence encoding civ-acting ribozyme. In various instances, one or more sequences encoding a protein for AAV production is located upstream of (5’ of) a sequence encoding a civ-acting ribozyme and one or more sequences encoding a proteinfor AAV production is located downstream of (3’ of) a sequence encoding civ-acting ribozyme. In various instances, the civ-acting ribozyme is a self-cleaving ribozyme. In certain instances, the civ-acting ribozyme controls expression of one or more sequences encoding a protein for AAV production by activating (e.g., Ribo-On) or deactivating (e.g., Ribo-Off) the gene (or genes) at desired times.
[0148] FIG. 1A illustrates an example of a Ribo-Off type system. Ribo-Off type systems position an alternative terminating sequence (e.g., transcriptional termination sequence) flanked by recombination sites (e.g., lox sites) between a sequence encoding a self-cleaving ribozyme and the coding sequence of the protein for AAV production. The transcriptional termination sequence stabilizes the mRNA thus allowing expression of the gene. As illustrated in FIG. IB, upon recombination between the flanking recombination sites, the transcriptional termination sequence can be excised, thus placing the sequence encoding the self-cleaving ribozyme between the coding sequence and the native 3’UTR. The self-cleaving ribozyme can thus destabilize the mRNA knocking out, knocking down, or otherwise preventing or limiting expression of the operably linked gene.26MOFO-359992482324632001140
[0149] FIG. 2A illustrates an example of a Ribo-On type system. Ribo-On type systems position a sequence encoding a self-cleaving ribozyme flanked by recombination sites (e.g., lox sites) between the operably linked gene and its 3’UTR. In this arrangement, the self-cleaving ribozyme destabilizes the mRNA, thus knocking out, knocking down, or otherwise preventing or limiting expression of the operably linked gene. As illustrated in FIG. 2B, upon recombination between the flanking recombination sites, the sequence encoding the self-cleaving ribozyme is removed from the mRNA, thus allowing expression of the operably linked gene.
[0150] In some instances, the encoded ribozyme is a Hammerhead ribozyme. In their natural state, Hammerhead ribozymes are a class of ribozymes that perform self-cleavage reactions and do not catalyze multiple reactions or turnovers. In certain embodiments the encoded ribozyme is selected from one or more of a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, and a RAGATH-1- hammerhead.
[0151] In some instances, a polynucleotide encoding one or more sequences encoding a protein for AAV production includes a Ribo-off type ribozyme system to control gene expression. In various instances, a Ribo-off type ribozyme system is operably located between a transcription initiation site and a polyadenylation (poly A) signal sequence operably linked to a sequence encoding a protein for AAV production. In certain such instances, the Ribo-off type system is located between the transcription initiation site and the sequence encoding a protein for AAV production. In some such instances, the Ribo- off type system is located between the sequence encoding a protein for AAV production and the polyA signal sequence.
[0152] In various instances, a Ribo-off type system is operably linked to one or more sequences encoding AAV Rep proteins, AAV Cap proteins, helper proteins, a payload, VA-RNA, and / or any other coding sequence. In certain instances, a Ribo-off type system is operably linked to coding sequence for one or both of AAV large Rep proteins and AAV small Rep proteins.
[0153] In some aspects, provided herein is a polynucleotide comprising an AAV Rep expression cassette that comprises a sequence encoding a ribozyme. In some embodiments, the AAV Rep expression cassette comprises a sequence encoding Rep proteins, a sequence encoding a ribozyme, and a polyA signal sequence. In some embodiments, the sequence encoding a ribozyme is located downstream of (e.g., 3’ of) the sequence encoding the Rep proteins and upstream of (e.g., 5’ of) the polyA signal sequence. In some embodiments, the ribozyme is a civ-acting ribozyme. In some embodiments, the ribozyme is a self-cleaving ribozyme. In some embodiments, the ribozyme is a Hammerhead ribozyme. In some embodiments, the ribozyme is a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, or a RAGATH-1 -hammerhead. In some embodiments, the sequence encoding a ribozyme is flanked by recombination sites to allow for inducible excision of the sequence encoding a ribozyme.27MOFO-359992482324632001140
[0154] In some aspects, provided herein is a polynucleotide comprising an AAV Cap expression cassette that comprises a sequence encoding a ribozyme. In some embodiments, the AAV Cap expression cassette comprises a sequence encoding Cap proteins, a sequence encoding a ribozyme, and a polyA signal sequence. In some embodiments, the sequence encoding a ribozyme is located downstream of (e.g., 3’ of) the sequence encoding the Cap proteins and upstream of (e.g., 5’ of) the polyA signal sequence. In some embodiments, the ribozyme is a cA-acting ribozyme. In some embodiments, the ribozyme is a self-cleaving ribozyme. In some embodiments, the ribozyme is a Hammerhead ribozyme. In some embodiments, the ribozyme is a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, or a RAGATH-1 -hammerheadin some embodiments, the sequence encoding a ribozyme is flanked by recombination sites to allow for inducible excision of the sequence encoding a ribozyme.
[0155] In some aspects, provided herein is a polynucleotide comprising an AAV Helper expression cassette that comprises a sequence encoding a ribozyme. In some embodiments, the AAV Helper expression cassette comprises a sequence encoding AAV Helper proteins, a sequence encoding a ribozyme, and a polyA signal sequence. In some embodiments, the sequence encoding a ribozyme is located downstream of (e.g., 3’ of) the sequence encoding the AAV Helper proteins and upstream of (e.g., 5’ of) the polyA signal sequence. In some embodiments, the ribozyme is a cA-acting ribozyme. In some embodiments, the ribozyme is a self-cleaving ribozyme. In some embodiments, the ribozyme is a Hammerhead ribozyme. In some embodiments, the ribozyme is a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, or a RAGATH-1 -hammerhead. In some embodiments, the sequence encoding a ribozyme is flanked by recombination sites to allow for inducible excision of the sequence encoding a ribozyme.
[0156] In some aspects, provided herein is a polynucleotide comprising a VA-RNA expression cassette that comprises a sequence encoding a ribozyme. In some embodiments, the ribozyme is a cisacting ribozyme. In some embodiments, the ribozyme is a self-cleaving ribozyme. In some embodiments, the ribozyme is a Hammerhead ribozyme. In some embodiments, the ribozyme is a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, or a RAGATH-1 -hammerhead. In some embodiments, the sequence encoding a ribozyme is flanked by recombination sites to allow for inducible excision of the sequence encoding a ribozyme.
[0157] In some aspects, provided herein is a polynucleotide comprising a payload expression cassette that comprises a sequence encoding a ribozyme. In some embodiments, the payload expression cassette comprises a sequence encoding a payload, a sequence encoding a ribozyme, and a polyA signal sequence. In some embodiments, the sequence encoding a ribozyme is located downstream of (e.g., 3’ of) the sequence encoding the pay load and upstream of (e.g., 5’ of) the polyA signal sequence In some embodiments, the ribozyme is a cA-acting ribozyme. In some embodiments, the ribozyme is a self-cleaving28MOFO-359992482324632001140 ribozyme. In some embodiments, the ribozyme is a Hammerhead ribozyme. In some embodiments, the ribozyme is a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, or a RAGATH-1 -hammerhead. In some embodiments, the sequence encoding a ribozyme is flanked by recombination sites to allow for inducible excision of the sequence encoding a ribozyme.B. Polynucleotides for AAV Rep and Cap Production1. Polynucleotides for Expression of Rep proteins
[0158] Provided herein is a polynucleotide comprising a sequence encoding AAV Rep proteins, e.g. an AAV Rep expression cassette. In some embodiments, the polynucleotide comprises a Rep open reading frame. In some embodiments, the Rep open reading frame comprises a large Rep coding sequence and a small Rep coding sequence. The large Rep coding sequence partially overlaps with the small Rep coding sequence such that the small Rep coding sequence is common within a portion of the large Rep coding sequence. The large Rep coding sequence encodes two large Rep proteins, Rep78 and Rep68. The large Rep coding sequence is transcribed into a precursor mRNA that is alternatively spliced to produce two types of mature mRNA, where one mature mRNA encodes the large Rep protein, Rep78 and the other mature mRNA encodes the large Rep protein, Rep68. The small Rep coding sequence encodes two small Rep proteins, Rep52 and Rep40. The small Rep coding sequence is transcribed into a precursor mRNA that is alternatively spliced to produce two types of mature mRNA, where one mature mRNA encodes the small Rep protein, Rep52 and the other mature mRNA encodes the small Rep protein, Rep40.
[0159] In some embodiments, the polynucleotide comprises an AAV Rep expression cassette. In some embodiments, the AAV Rep expression cassette comprises a promoter and a Rep open reading frame. The Rep open reading frame encodes four nonstructural proteins, Rep 78, Rep 68, Rep52, and Rep 40. Transcription of the sequence encoding the large Rep proteins, Rep 78 and Rep 68, can be driven by the native p5 promoter. Alternative splicing generates separate transcripts for Rep78 and Rep 68. Transcription of the sequence encoding the small Rep proteins, Rep 52 and Rep 40, can be driven by the native pl9 promoter. Alternative splicing generates separate transcripts for Rep52 and Rep 40.
[0160] In some embodiments, the Rep open reading frame comprises a large Rep coding sequence and a small coding sequence. In some embodiments, the large Rep coding sequence is operably linked to a first promoter. In some embodiments, the large Rep coding sequence comprises a small Rep coding sequence. In some embodiments, the large Rep coding sequence and the small Rep coding sequence overlap within the Rep open reading frame. In some embodiments, the large Rep coding sequence comprises a pl9 promoter upstream of the small Rep coding sequence. In some embodiments, the small Rep coding sequence is operably linked to the pl9 promoter.
[0161] In some embodiments, the large Rep coding sequence encodes one or more large Rep proteins and the small Rep coding sequence encodes one or more small Rep proteins. In some embodiments the Rep open reading frame comprises the coding sequences for Rep78, Rep68, Rep52 and Rep 40. In some29MOFO-359992482324632001140 such embodiments, the one or more large Rep proteins comprises Rep78 and Rep68 and the one or more small Rep protein comprises Rep52 and Rep40. In some embodiments, the Rep open reading frame does not include the Rep40 coding sequence. In some such embodiments, the one or more large Rep proteins comprises Rep78 and the one or more small Rep protein comprises Rep 52. In some such embodiments, transcripts for Rep68 and Rep40 are not expressed.
[0162] In some embodiments, the AAV Rep expression cassette comprises one or more promoters for driving transcription of the large and small Rep coding sequences encoded in the Rep open reading frame. In some embodiments, the one or more promoters comprise a p5 native AAV promoter and a pl9 native AAV promoter. In some embodiments, the one or more promoters comprise heterologous promoters. Heterologous promoters can include constitutive, inducible, and / or any other type of heterologous promoter. Inducible promoters can be induced in response to exogenous or endogenous signals. For example, an inducible promoter may be induced in response to the production of a particular compound (e.g., protein, carbohydrate, lipid, etc.) within a cell or it may be induced by the addition of a triggering agent or inducer added exogenously, such as tetracycline, doxycycline, etc.
[0163] In some embodiments, the Rep coding sequences are operably linked to an inducible promoter. In some embodiments, the inducible promoter comprises a tetracycline-inducible promoter, a cumate-inducible promoter, or a cumate-inducible promoter. In some embodiments, the Rep coding sequences are operably linked to a constitutive promoter. In some embodiments, the constitutive promoter is EFl alpha promoter or human cytomegalovirus promoter.
[0164] A polynucleotide is provided that includes a first promoter operably linked to a large Rep coding sequence. In some embodiments, the first promoter is heterologous to the large Rep coding sequence. The large Rep coding sequence includes a small Rep coding sequence. In some embodiments, a promoter is operably linked to the small Rep coding sequence. In some embodiments, the promoter operably linked to the small Rep coding sequence has higher promoter activity as compared to the first promoter. In some embodiments, the large Rep coding sequence includes an intron and a small Rep coding sequence. In some embodiments, the intron includes a second promoter operably linked to the small Rep coding sequence. In some embodiments, the second promoter has higher promoter activity as compared to the first promoter. In some embodiments, the second promoter is heterologous to the small Rep coding sequence and the second promoter has higher promoter activity as compared to the first promoter.
[0165] In certain aspects, the large Rep coding sequence comprises (i) a functional pl9 promoter operably linked to the small Rep coding sequence and (ii) the intron comprising the second promoter. In this aspect, the polynucleotide expresses two small Rep coding transcripts, one expressed under the control of the pl9 promoter and the other expressed under the control of the second promoter. Both transcripts encode the two small Rep proteins, Rep58 and Rep 40 when alternatively spliced. In certain aspects, the intron and hence the second promoter is located downstream of the pl9 promoter and upstream of the transcription start site of the small Rep coding sequence.30MOFO-359992482324632001140
[0166] In certain aspects, the intron is a synthetic intron comprising a 5’ splice donor site, the second promoter sequence, and a 3’ splice acceptor site, wherein the splice donor and acceptor sites are compatible with a cell used for expressing the Rep proteins. The intron is positioned to allow for generation of mRNAs lacking the intron which can then be translated to produce the large Rep proteins, Rep78 and Rep68.
[0167] In other aspects, the pl9 promoter is mutated to substantially reduce promoter activity. In some embodiments, the TATA box of the pl9 promoter is mutated. In certain aspects, the mutated pl9 promoter results in a reduction of expression of the small Rep to a level that is at least 30% less, at least 40% less, at least 50% less, at least 60% less, at least 70% less, at least 80% less, at least 90% less, or is undetectable as compared to the expression level of the small Rep under the control of the native pl9 promoter. In some aspects, the polynucleotide lacks a functional pl9 promoter.
[0168] In certain aspects, the first promoter operably linked to the large Rep coding sequence is the native p5 promoter and the expression from the large Rep coding sequence is controlled by the p5 promoter.
[0169] In certain aspects, the first promoter operably linked to the large Rep coding sequence is a not a p5 promoter and the polynucleotide includes the native p5 promoter and both the first promoter and the p5 promoter control expression from the large Rep coding sequence. In certain aspects, the first promoter is heterologous to the large Rep coding sequence.
[0170] In certain aspects, the p5 promoter present upstream of the AAV large Rep coding sequence is mutated to substantially reduce promoter activity. In certain aspects, the first promoter operably linked to the large Rep coding sequence is a not a p5 promoter and the polynucleotide includes the mutated p5 promoter and both the first promoter and the p5 promoter control expression from the large Rep coding sequence. In certain aspects, the first promoter is heterologous to the large Rep coding sequence.
[0171] In other aspects, the polynucleotide lacks a functional p5 promoter. In certain aspects, the first promoter operably linked to the large Rep coding sequence is a not a p5 promoter and the polynucleotide includes the first promoter and lacks a p5 promoter for controlling expression from the large Rep coding sequence. In certain aspects, the p5 promoter present upstream of the AAV Rep coding sequence is removed. In certain aspects, the p5 promoter present upstream of the AAV Rep coding sequence is replaced with the first promoter. In certain aspects, the first promoter is heterologous to the large Rep coding sequence.
[0172] In certain aspects, one or both of the first and second promoters for driving the expression of the large Rep proteins and small Rep proteins, respectively, are independently selected from constitutive promoters and / or inducible promoters. In certain aspects, the first promoter and the second promoter may be independently selected from the following promoters: ubiquitin C (UBC) promoter, Rous sarcoma virus long terminal repeat (RSV) promoter, chicken beta actin promoter, cytomegalovirus (CMV) promoter, CMV enhancer / chicken beta actin (CAG) promoter, ribosomal protein L13a (RPL13a) promoter, elongation factor 1-alpha (EFla or EFlalpha) promoter, simian virus 40 (SV40) early promoter,31MOFO-359992482324632001140 phosphoglycerate kinase (PGK) promoter, hypoxanthine-guanine phosphoribosyltransferase (Hprt) promoter, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter, albumin promoter (ALB), muscle creatine kinase (MSC) promoter, sialophorin promoter (CD43), histone H4 promoter, prostaglandin synthase 2 (PGS2) promoter, activated leukocyte cell adhesion molecule (ALCAM) promoter, fragile X mental retardation 1 (FMRI) promoter, CD68 promoter keratin 14 (K14) promoter, Thyl promoter, pax6 paired box (P2) promoter, elongation factor 2 (EF2) promoter, platelet-derived growth factor beta (PDGF- B) promoter, vascular endothelial growth factor receptor 2 (Flk-1) promoter, glucocorticoid receptor promoter (GRP), Lek promoter, myosin light chain 2 (MLC-2) promoter, chromobox homolog 3 (Cbx3) promoter, Nanog promoter, pancreatic and duodenal homeobox 1 (PDX1) promoter, neuron-specific enolase (NSE) promoter, CCAAT / enhancer binding protein alpha (C / EBPa) promoter, Vavl promoter, Rosa26 promoter, peroxisome proliferator-activated receptor gamma coactivator 1 -alpha (hPGCla) promoter, cytokeratin 19 (Ckl9) promoter, myeloperoxidase (MPO) promoter, fatty acid binding protein 4 (FABP4) promoter, TATA box promoter, endothelial nitric oxide synthase (eNOS) promoter, vivmentin promoter, glial fibrillary acidic protein (GFAP) promoter, calcium / calmodulin-dependent protein kinase II alpha (CaMKIIa) promoter, y-actin promoter, plasminogen activator inhibitor- 1 (PAI-1) promoter, and stromal cell-derived factor 1 (SDF-1) promoter. In certain aspects, the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Rous sarcoma virus long terminal repeat (RSV) promoter; (ii) the first promoter is a chicken beta actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken beta actin (CAG) promoter and the second promoter is a RSV promoter; (iv) the first promoter is a chicken beta actin promoter and the second promoter is a RSV promoter, or (v) the first promoter is a herpes simplex virus (HSV) thymidine kinase (TK) HSVtk promoter and the second promoter is a murine leukemia virus-derived (MND) promoter.
[0173] In some embodiments, the first promoter and the second promoter are selected from the group consisting of: a ubiquitin C (UBC) promoter, a Rous sarcoma virus long terminal repeat (RSV) promoter, a chicken beta actin promoter, a cytomegalovirus (CMV) promoter, a CMV enhancer / chicken beta actin (CAG) promoter, or a phosphoglycerate kinase (PGK) promoter. In some embodiments, the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Rous sarcoma virus long terminal repeat (RSV) promoter. In some embodiments, the first promoter is a chicken beta actin promoter and the second promoter is a cytomegalovirus (CMV) promoter. In some embodiments, the first promoter is a CMV enhancer / chicken beta actin (CAG) promoter and the second promoter is a RSV promoter. In some embodiments, the first promoter is a chicken beta actin promoter and the second promoter is a RSV promoter. In some embodiments, the first promoter is a UBC promoter and the second promoter is a CAG promoter.
[0174] In some embodiments, the first promoter and the second promoter comprise a nucleotide sequence independently selected from any one of SEQ ID NOs: 17, 134-138, 186, 190, 247, 341, 342, 348, and 349, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing. In some embodiments, the first32MOFO-359992482324632001140 promoter comprises the nucleotide sequence of SEQ ID NO: 137 or SEQ ID NO: 186, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing. In some embodiments, the second promoter comprises the nucleotide sequence of any one of SEQ ID NOs: 136, 190, 342 and 349 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing.
[0175] In certain aspects, the polynucleotide includes an excisable element that controls expression of large and small Rep proteins. In some embodiments, the excisable element is positioned in the small Rep coding sequence since the small Rep coding sequence is common with the large Rep coding sequence such that expression of both small and large Rep proteins can be controlled. The excisable element includes a sequence comprising a stop codon which prevents translation of the full-length Rep proteins, resulting in expression of truncated Rep proteins that are non-functional and lack toxicity associated with the full-length Rep proteins. The excisable element includes a first recombination site and a second recombination site flanking the sequence comprising the stop codon. The first recombination site and the second recombination site are oriented in the same direction and recombination between the first and second recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon allowing expression of full-length large Rep proteins and full-length small Rep proteins. In some embodiments, the excisable element is positioned upstream of the small Rep coding sequence. In some such embodiments, the stop codon in the excisable element results in truncated transcripts for large Rep proteins and transcripts for the small Rep proteins are not expressed. Following the excision of the sequence comprising the stop codon, full length large Rep proteins and small Rep proteins are expressed. In some embodiments, the stop codon is within a coding sequence. For example, the stop codon is within a coding sequence that encodes a detectable marker. In some embodiments, the detectable marker is a fluorescent marker. In some embodiments, the fluorescent marker is a blue fluorescent protein (BFP). Therefore, in some embodiments, the stop codon is a stop codon of BFP.In certain embodiments, the Rep open reading frame comprises, from 5’ to 3’: the large Rep coding sequence, an intron, and the small Rep coding sequence. In some embodiments, the intron comprises a promoter and an excisable element. In some embodiments, the excisable element comprises a coding sequence comprising a stop signaling sequence flanked by recombination sites. In some embodiments, the stop signaling sequence is within a coding sequence. For example, the stop signaling sequence is within a coding sequence that encodes a detectable marker. In some embodiments, the detectable marker is a fluorescent marker. In some embodiments, the fluorescent marker is a blue fluorescent protein (BFP). Therefore, in some embodiments, the stop signaling sequence is a stop signaling sequence of BFP. In some embodiments, the flanking recombination sites are oriented in the same direction. The stop signaling sequence in the excisable element prevents the expression of transcripts for small Rep proteins and results in truncated transcripts for large Rep proteins.33MOFO-359992482324632001140
[0176] In some embodiments, the intron is a synthetic intron comprising from 5’ to 3’: (i) a 5’ splice donor site, (ii) the promoter, (iii) the excisable element further comprising a first 3’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, and (iv) a second 3’ acceptor site. In some such embodiments, the splice donor site and the first and second splice acceptor sites are compatible with a cell used for expressing Rep proteins. Upon exposure to a recombinase, the first 3’ splice acceptor site and the coding sequence comprising a stop signaling sequence are excised following a recombination event between the recombination sites of the excisable element. In some such embodiments, the promoter located in the intron is operably linked to the small Rep coding sequence. Following excision of the coding sequence comprising a stop signaling sequence, full length large Rep proteins and small Rep proteins are expressed.
[0177] In certain embodiments, the Rep open reading frame comprises from 5’ to 3’: the large Rep coding sequence, the pl9 promoter, a first part of the small Rep coding sequence, an intron, and a second part of the small Rep coding sequence. In some such embodiments, the first part and the second part of the small Rep coding sequence form the small Rep coding sequence. In some embodiments, the small Rep coding sequence is operably linked to the pl 9 promoter. In some embodiments, the pl 9 promoter is a native pl9 promoter. In some embodiments, the pl9 promoter is a mutant pl9 promoter. In some embodiments, the mutant pl9 promoter has reduced transcriptional activity compared to the native pl9 promoter. In some embodiments, the intron comprises an excisable element comprising a coding sequence comprising a stop signaling sequence flanked by recombination sites. In some embodiments, the flanking recombination sites are oriented in the same direction. The stop signaling sequence in the excisable element results in truncated transcripts for large and small Rep proteins.
[0178] In some embodiments, the intron is synthetic intron comprising, from 5’ to 3’ : (i) a 5’ splice donor site, (ii) the excisable element further comprising a first 3’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, and (iii) a second 3’ acceptor site. In some such embodiments, the splice donor site and the first and second splice acceptor sites are compatible with a cell used for expressing Rep proteins. Upon exposure to a recombinase, the first 3’ splice acceptor site and the coding sequence comprising a stop signaling sequence are excised following a recombination event between the recombination sites of the excisable element. Following excision of the coding sequence comprising a stop signaling sequence, full length large and small Rep proteins are expressed.
[0179] In certain aspects, the large Rep coding sequence encodes transcripts that include the intron. When expressed in a suitable cell, the intron is excised to generate processed transcripts that can be translated into Rep78 and Rep68. In certain aspects, the large Rep coding sequence also includes the excisable element. When present in a suitable cell that also includes a recombinase (e.g., an inducible recombinase) that recombines the first and second recombination sites, the excisable element is removed and the large Rep coding sequence is transcribed into transcripts that include the intron, which intron is excised to generate processed transcripts that can be translated into Rep78 and Rep68.34MOFO-359992482324632001140
[0180] In certain aspects, the open reading frame of sequence encoding the small Rep proteins is present within the large Rep coding sequence and the second promoter drives the expression of transcripts that are translated into Rep52 and Rep40. In certain embodiments, the second promoter is located within an intron. In certain embodiments, the second promoter is located within the intron as described above.
[0181] In some embodiments, the AAV Rep expression cassette comprises: (i) a first part of the Rep open reading frame, (ii) an excisable element comprising a first recombination site, a coding sequence encoding a stop signaling sequence, a second recombination site, wherein the first and second recombination sites flank the coding sequence encoding a stop signaling sequence and wherein the first recombination site and the second recombination site are oriented in the same direction, and (iii) a second part of the Rep open reading frame.
[0182] In some embodiments, the AAV Rep expression cassette comprises from 5' to 3': a first promoter operably linked to a first sequence comprising a first part of the Rep open reading frame, a 5' splice site, a first part of an intron, a first recombination site, a first 3' splice site, a coding sequence comprising a stop signaling sequence, a second recombination site, a second part of the intron, a second 3' splice site, and a second sequence comprising a second part of the Rep open reading frame. In certain embodiments, the first recombination site, the first 3' splice site, the coding sequence comprising the stop signaling sequence, and the second recombination site form an excisable element. In certain embodiments, the first recombination site and the second recombination site are oriented in the same direction. In certain embodiments, the first promoter is not operably linked to the second sequence comprising the second part of the Rep open reading frame. In certain embodiments, the first and second recombination sites are recombined by the inducible recombinase in the presence of a first triggering agent and a second triggering agent, resulting in excision of the excisable element. In certain embodiments, the first part of the Rep open reading frame and the first part of the intron are joined to the second part of the intron and the second part of the Rep open reading frame to form a complete Rep open reading frame, allowing expression of AAV Rep proteins.
[0183] In the exemplary embodiments, prior to the cell being contacted with the first triggering agent and the second triggering agent, the Rep coding sequence is interrupted by an excisable element. Addition of both the first triggering agent and the second triggering agent are required for excision of the excisable element. In some embodiments, the excisable element is inserted at CAG-G, CAG-A, AAG-G, AAG-A, wherein the dash (-) indicates the point of insertion of the excisable element, in the Rep coding sequence, and the excisable element is inserted downstream of the pl9 promoter. In some embodiments, the excisable element is inserted at CAG-G, CAG-A, AAG-G, AAG-A, wherein the dash (-) indicates the point of insertion of the excisable element, in the Rep coding sequence, and the excisable element is inserted downstream of the pl9 promoter and upstream of the p40 promoter.
[0184] In certain embodiments, the excisable element comprises, from 5’ to 3’, a first spacer segment, a second spacer segment, and a third spacer segment.35MOFO-359992482324632001140
[0185] In particular embodiments, the first spacer segment comprises a 5’ splice site (5’SS) 5’ to the first spacer element. In some embodiments, the first spacer segment comprises a nucleic acid sequence having at least 80% identity to SEQ ID NO: 205. In some embodiments, the first spacer segment comprises a nucleic acid sequence having at least 90% identity to SEQ ID NO: 205. In some embodiments, the first spacer segment comprises a nucleic acid sequence having at least 95% identity to SEQ ID NO: 205. In some embodiments, the first spacer segment comprises a nucleic acid sequence having at least 98% identity to SEQ ID NO: 205. In some embodiments, the first spacer segment comprises a nucleic acid sequence having at least 99% identity to SEQ ID NO: 205. In some embodiments, the first spacer segment comprises a nucleic acid sequence of SEQ ID NO: 205.
[0186] In some embodiments, the second spacer segment comprises a polynucleotide encoding a detectable protein marker flanked by lox sites. In certain embodiments, the detectable protein marker is a fluorescent protein. In particular embodiments, the fluorescent protein is a green or blue fluorescent protein (GFP or BFP). In specific embodiments, the GFP is EGFP. In particular embodiments, the fluorescent protein is a blue fluorescent protein (BFP). Screening for the fluorescent marker can be used to confirm integration of the construct into the cell genome and can subsequently be used to confirm excision of the intervening spacer segment. In some embodiments, the second spacer segment further comprises a polyA signal sequence. In certain embodiments, the poly A signal sequence comprises a rabbit beta globin (RBG) polyA signal sequence. In some embodiments, the second spacer segment further comprises a first 3’ splice site (3’SS) between the first lox site and the polynucleotide encoding the protein marker.
[0187] In some embodiments, the second spacer segment comprises a nucleic acid sequence having at least 80% identity to SEQ ID NO: 237. In some embodiments, the second spacer segment comprises a nucleic acid sequence having at least 90% identity to SEQ ID NO: 237. In some embodiments, the second spacer segment comprises a nucleic acid sequence having at least 95% identity to SEQ ID NO: 237. In some embodiments, the second spacer segment comprises a nucleic acid sequence having at least 98% identity to SEQ ID NO: 237. In some embodiments, the second spacer segment comprises a nucleic acid sequence having at least 99% identity to SEQ ID NO: 237. In some embodiments, the second spacer segment comprises a nucleic acid sequence of SEQ ID NO: 237.
[0188] In some embodiments, the third spacer segment further comprises a second 3’ splice site (3’SS). In particular embodiments, the second 3’ splice site is positioned 3’ to the second lox site.
[0189] In some embodiments, the third spacer segment comprises a nucleic acid sequence having at least 80% identity to SEQ ID NO: 207. In some embodiments, the third spacer segment comprises a nucleic acid sequence having at least 90% identity to SEQ ID NO: 207. In some embodiments, the third spacer segment comprises a nucleic acid sequence having at least 95% identity to SEQ ID NO: 207. In some embodiments, the third spacer segment comprises a nucleic acid sequence having at least 98% identity to SEQ ID NO: 207. In some embodiments, the third spacer segment comprises a nucleic acid sequence having at least 99% identity to SEQ ID NO: 207. In some embodiments, the third spacer segment comprises a nucleic acid sequence of SEQ ID NO: 207.36MOFO-359992482324632001140
[0190] In certain aspects, the small Rep coding sequence may include a first spacer segment and a second spacer segment flanking the excisable element, wherein the first spacer segment comprises a 5’ splice site (5’SS) at the 5’ end of the first spacer segment followed by a first intron and the second spacer segment comprises a second intron followed by a first 3’ end of the second spacer segment, wherein the excisable element comprises from 5’ end to 3’ end: the first recombination site, a second 3’ splice site (3’SS), the stop signaling sequence (e.g., a stop codon), and the second recombination site.
[0191] In certain aspects, the excisable element is flanked by a split intron to prevent read-through from the stop signaling sequence. For example, the polynucleotide construct comprises from 5’ to 3’: one or more native AAV Rep promoters operably linked to a first part of an AAV Rep coding sequence, a 5’ splice site (SS), a first part of an intron, a first recombination site, a first 3’ SS, a coding sequence comprising a stop signaling sequence, a second recombination site, a second part of the intron, a second 3’ SS, and a second part of the AAV Rep coding sequence, wherein the first recombination site, the first 3’ splice site, the coding sequence comprising the stop signaling sequence, and the second recombination site form an excisable element, wherein the first recombination site and the second recombination site are oriented in the same direction, and wherein the one or more promoters are not operably linked to the second part of the AAV Rep coding sequence. The first and second recombination sites are recombined by an inducible recombinase resulting in excision of the excisable element which results in a polynucleotide in which the first part of the AAV Rep coding sequence and the first part of the intron are joined to the second part of the intron and the second part of the AAV Rep coding sequence to form a complete AAV Rep coding sequence comprising the intron. Upon transcription, the intron is spliced out by the endogenous cellular machinery to generate a mature mRNA which is translated to produce AAV Rep proteins.
[0192] In certain aspects, the excisable element is flanked by a split intron to prevent read-through from the stop signaling sequence. For example, the polynucleotide construct comprises from 5’ to 3’: one or more native AAV Rep promoters operably linked to a first part of an AAV Rep coding sequence, a 5’ splice site (SS), a first part of an intron, a first recombination site, a first 3’ SS, a coding sequence comprising a stop signaling sequence, a second recombination site, a second part of the intron, a second 3’ SS, and a second part of the AAV Rep coding sequence, wherein the first recombination site, the first 3’ splice site, the coding sequence comprising the stop signaling sequence, and the second recombination site form an excisable element, wherein the first recombination site and the second recombination site are oriented in opposite directions, and wherein the one or more promoters are not operably linked to the second part of the AAV Rep coding sequence. The first and second recombination sites are recombined by an inducible recombinase resulting in excision of the excisable element which results in a polynucleotide in which the first part of the AAV Rep coding sequence and the first part of the intron are joined to the second part of the intron and the second part of the AAV Rep coding sequence to form a complete AAV Rep coding sequence comprising the intron. Upon transcription, the intron is spliced out by the endogenous cellular machinery to generate a mature mRNA which is translated to produce AAV Rep proteins. In some37MOFO-359992482324632001140 embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise Lox sites. In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxP, LoxN, Lox2272, or Lox511 sequences. In some embodiments the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxP sequences. In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxN sequences.
[0193] In some embodiments, the recombinase is a Cre recombinase. In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a Cre recombinase fused to the ligand binding domain of an estrogen receptor. In some embodiments, the inducible recombinase is a Cre-ERT2 fusion protein.
[0194] In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise flippase recognition target (FRT) sites. In some such embodiments, the recombinase is a flippase (FRP) recombinase. In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a FRP recombinase fused to the ligand binding domain of an estrogen receptor. In some embodiments, the inducible recombinase is a FRP- ERT2 fusion protein.
[0195] In some embodiments, the coding sequence encoding the stop signaling sequence comprised in the excisable element encodes, from 5' to 3', an exon and the stop signaling sequence. In some embodiments, the coding sequence comprises a sequence encoding a protein marker. In certain embodiments, the sequence encoding the protein marker is in-frame with the stop signaling sequence.
[0196] In certain aspects, the excisable element includes a sequence encoding a marker protein (e.g., a detectable marker) in frame with the stop codon such that the marker protein is expressed when the excisable element is present. For example, detectable markers contemplated herein include luminescent markers, fluorescent markers, or radiolabels. Fluorescent markers include, but are not limited to, EGFP, GFP, BFP, RFP, or any combination thereof.
[0197] In some embodiments, the coding sequence comprising a stop signaling sequences is a detectable protein marker. In some embodiments, the detectable protein marker is a luminescent marker, a radiolabel, or a fluorescent marker. In some embodiments, the detectable protein marker is a fluorescent protein. In particular embodiments, the fluorescent protein is a blue fluorescent protein (BFP). In some embodiments, the detectable marker comprises the nucleotide sequence of SEQ ID NO: 193, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
[0198] In certain aspects, the 5’ splice site is a rabbit beta globin 5’ splice site. In certain aspects, both of the first and second 3’ splice sites are rabbit beta globin 3’ splice sites. In certain aspects, the vector may include an excisable element as described in US20220145328A1, e.g., paragraphs 10, 30, and 31, which are incorporated herein by reference.38MOFO-359992482324632001140
[0199] In some embodiments, the excisable element comprises the nucleotide sequence of SEQ ID NO: 200 or SEQ ID NO: 219, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
[0200] In certain aspects, the polynucleotide includes a tag encoding sequence present in frame with the large Rep coding sequence and the small Rep coding sequence such that the large Rep and the small Rep each are expressed as a fusion protein comprising the tag. Any suitable tag may be used. In certain aspects, the tag is a purification tag and / or a detectable tag. In certain aspects, the tag may be a poly-Histidine tag, a Flag tag, a MYC tag, a GST tag, a MBP tag, a strep tag, etc.
[0201] In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep transcripts at a level that is lower than the expression level of the large Rep transcripts from a vector not having the first promoter. In certain aspects, the vector is configured to provide for an expression of the large Rep transcripts at a level that is lower than the expression level of the large Rep transcripts from a vector having a p5 promoter for driving large Rep expression. In certain aspects, the first promoter is weaker than the p5 promoter. In certain aspects, the first promoter is stronger than the p5 promoter but weaker than the second promoter driving expression of the small Rep transcripts. In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep proteins at a level that is lower than the expression level of the large Rep proteins from a vector not having the first promoter. In certain aspects, the vector is configured to provide for an expression of the large Rep proteins at a level that is lower than the expression level of the large Rep proteins from a vector having a p5 promoter for driving large Rep expression. In certain aspects, the first promoter is weaker than the p5 promoter. In certain aspects, the first promoter is stronger than the p5 promoter but weaker than the second promoter driving expression of the small Rep proteins.
[0202] In certain aspects, the polynucleotide is configured to provide for an expression of the small Rep transcripts at a level that is higher than the expression of the small Rep transcripts from a vector not having the second promoter. In certain aspects, the vector is configured to provide for an expression of the small Rep transcripts at a level that is higher than the expression of the small Rep transcripts from a vector having a pl9 promoter. In certain aspects, the second promoter is stronger than the pl9 promoter. In certain aspects, the second promoter is weaker than the pl9 promoter. In certain aspects, the second promoter is weaker than the pl9 promoter and stronger than the first promoter driving expression of the large Rep transcripts. In certain aspects, the polynucleotide is configured to provide for an expression of the small Rep proteins at a level that is higher than the expression of the small Rep proteins from a vector not having the second promoter. In certain aspects, the vector is configured to provide for an expression of the small Rep proteins at a level that is higher than the expression of the small Rep proteins from a vector having a pl9 promoter. In certain aspects, the second promoter is stronger than the pl9 promoter. In certain aspects, the second promoter is weaker than the pl9 promoter. In certain aspects, the second promoter is weaker than the pl9 promoter and stronger than the first promoter driving expression of the large Rep proteins.39MOFO-359992482324632001140
[0203] In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep transcripts at a level that is lower than the expression level of the small Rep transcripts. In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep proteins at a level that is lower than the expression level of the small Rep proteins. In certain aspects, the first promoter is weaker than the second promoter.
[0204] In certain aspects, a ratio of the expression level of the small Rep transcripts to the expression level of the large Rep transcripts using the vector is higher than the ratio of the small Rep transcripts to large Rep transcripts ratio produced using a vector that includes a p5 promoter instead of the first promoter for driving large Rep transcripts expression and includes a pl9 promoter instead of the second promoter for driving small Rep transcripts expression. In certain aspects, a ratio of the expression level of the small Rep proteins to the expression level of the large Rep proteins using the vector is higher than the ratio of the small Rep proteins to large Rep proteins ratio produced using a vector that includes a p5 promoter instead of the first promoter for driving large Rep proteins expression and includes a pl9 promoter instead of the second promoter for driving small Rep proteins expression.
[0205] In certain aspects, a ratio of the expression level of the small Rep transcripts to the expression level of the large Rep transcripts ranges from 1.5:1 to 10,000:1, including 1.5:1; 1.8:1; 2:1; 2.3:1; 2.5:1; 2.8:1; 3:1; 3.5:1; 4:1; 4.5:1; 5:1; 5.5:1; 6:1; 6.5:1; 7:1; 7.5:1; 8:1; 8.5:1; 9:1; 9.5:1; 10:1; 50:1; 100:1; 300:1; 500:1; 1000:1; 3000:1; 5000:1; or 10,000:1. In certain aspects, a ratio of the expression level of the small Rep proteins to the expression level of the large Rep proteins ranges from 1.5:1 to 10,000:1, including 1.5:1; 1.8:1; 2:1; 2.3:1; 2.5:1; 2.8:1; 3:1; 3.5:1; 4:1; 4.5:1; 5:1; 5.5:1; 6:1; 6.5:1; 7:1; 7.5:1; 8:1; 8.5:1; 9:1; 9.5:1; 10:1; 50:1; 100:1; 300:1; 500:1; 1000:1; 3000:1; 5000:1; or 10,000:1.
[0206] FIG. 3A depicts a schematic of a polynucleotide according to one embodiment described herein. The polynucleotide includes an upstream heterologous promoter (e.g., a first promoter) that replaces the native p5 (“P5”) promoter for AAV large Rep. In this example, the native pl9 (“P19”) promoter is mutated to reduce expression of the small Rep (e.g., comprises a TATA box mutation). The open reading frame (ORF) of the large Rep partially overlaps with the ORF for the small Rep since large and small Rep genes share the same ORF in the 3 ’-end. Upstream half of Rep in this schematic refers to the portion of the large Rep coding sequence that encodes the large Rep sequences that do not overlap with the small Rep coding sequence. Downstream half of Rep in this schematic refers to the small Rep coding sequence which also includes the ORF that is part of the 3 ’end of the large Rep coding sequence. The custom intron of the schematic is an intron that is inserted in between the upstream half and downstream half of Rep and upstream of the small Rep coding sequence. However, in certain aspects, the intron may be positioned further downstream within the small Rep coding sequence with respect to the transcription start site for the small Rep, closer to the start site. In certain aspects, the intron may be positioned further upstream with respect to the transcription start site for the small Rep, closer to the pl9 promoter (e.g., within 10 nucleotides (nt), within 25 nt, within 50 nt, within 100 nt, within 250 nt, or within 500 nt). By placing the split intron and excisable element configuration proximally to the native pl9 promoter or heterologous40MOFO-359992482324632001140 promoter minimizes the transcript length, and potentially the associated polypeptide, which may further minimize the likelihood of a functional polypeptide. The intron may include a multiple cloning site to facilitate introduction of the second promoter for driving expression of the small Rep. The second promoter may be heterologous to the small Rep coding sequence. The polynucleotide construct also may include an optional ORF encoding a tag that is in-frame with the large Rep and small Rep ORFs which results in production of tagged large and small Rep proteins. The pl9 (“P19”) promoter may not include any mutations that decrease promoter activity. Additionally, the 5’ splice site and 3 ’splice sites should be in an intron-exon context, such as one or more of: CAG-G, CAG-A, AAG-G, or AAG-A, where the hyphen denotes site of insertion.
[0207] FIG. 3B. Schematic of a polynucleotide for expression of AAV large Rep transcripts and small Rep transcripts and subsequent expression of AAV large Rep proteins and small Rep proteins from these transcripts. An intron is inserted upstream of the small Rep coding sequence, which is within the coding sequence for large Rep. The schematic further depicts that the p5 (“P5”) promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence and the TATA box of the pl9 (“P19”) promoter is mutated to decrease promoter activity.
[0208] FIG.4A depicts a schematic of a polynucleotide shown in FIG.3A for expression of AAV large Rep and small Rep transcripts and subsequent expression of AAV large Rep proteins and small Rep proteins from these transcripts. An intron is inserted upstream of the small Rep coding sequence and in the coding sequence for large Rep. A heterologous promoter (e.g., a second promoter) introduced into the intron for driving transcription from the small Rep coding sequence. The schematic further depicts that the p5 (“P5”) promoter is replaced with a heterologous promoter (e.g., a first promoter) that is operably connected to the large Rep coding sequence. The pl9 (“P19”) promoter is not modified to decrease promoter activity.
[0209] FIG.4B depicts a schematic of a polynucleotide shown in FIG. 4A for expression of AAV large Rep and small Rep transcripts and subsequent expression of AAV large Rep proteins and small Rep proteins from these transcripts. An intron is inserted upstream of the small Rep coding sequence and in the coding sequence for large Rep. A heterologous promoter (e.g., a second promoter) is inserted into the intron and operably connected to the small Rep coding sequence. The schematic further depicts that the p5 (“P5”) promoter is replaced with a heterologous promoter (e.g., a first promoter) that is operably connected to the large Rep coding sequence and the TATA box of the P19 promoter is mutated to decrease promoter activity.
[0210] FIG. 5 illustrates three types of transcripts produced from the polynucleotide shown in FIG. 4B. Transcript 1 is produced under the control of the upstream heterologous promoter (e.g., first promoter) and initially includes the intron. Upon splicing out of the intron, large Rep proteins are translated from the processed transcripts. Transcript 2 is produced under the control of the internal heterologous promoter (e.g., second promoter) and is translated into small Rep proteins. Transcript 3 is produced under the control of the pl9 promoter and is similar to Transcript 2.41MOFO-359992482324632001140
[0211] FIG. 6 depicts a schematic of a polynucleotide shown in FIG. 4B with an excisable element inserted at a position that encodes a sequence common to large and small Rep proteins. The excisable element includes a stop codon flanked by recombination sites. Presence of this excisable element prevents expression of both full-length large Rep proteins and full-length small Rep proteins. In the presence of a recombinase, the recombination sites are joined and the stop codon is removed, allowing for expression of full-length large Rep proteins and full-length small Rep proteins.
[0212] FIG. 7A illustrates three types of transcripts produced from the polynucleotide shown in FIG.6 if the excisable element is inserted downstream of the start codon of the small Rep coding sequence. Transcript 1 is produced under the control of the upstream heterologous promoter (e.g., first promoter) and initially includes the intron and is not translated into large Rep proteins due the presence of the stop codon in the excisable element. Transcript 2 is produced under the control of the internal heterologous promoter (e.g., second promoter) and is not translated into small Rep proteins due the presence of the stop codon in the excisable element. Transcript 3 is produced under the control of the pl9 promoter and initially includes the intron and is not translated due the presence of the stop codon in the excisable element. FIG. 7B illustrates three types of transcripts produced from the polynucleotide shown in FIG. 6 if the excisable element is inserted upstream of the start codon of the small Rep coding sequence. Transcript 1 is similar to Transcript of FIG. 7A, while Transcripts 2 and 3 do not include the small Rep coding sequence since the stop codon in the excisable element is before the start codon of the of the small Rep coding sequence. a) Elements for Enhancing Rep Protein Expression
[0213] In some embodiments, the AAV Rep expression cassette further comprises a polyadenylation (polyA) signal sequence downstream of the Rep open reading frame. In some embodiments, the AAV Rep expression cassette further comprises an enhancer downstream of the polyA signal sequence. In some embodiments, the AAV Rep expression cassette comprises a first promoter, the Rep open reading frame, a polyA signal sequence, and an enhancer.
[0214] In certain embodiments, a polynucleotide comprising an AAV Rep coding sequence operably linked to native Rep promoters, a PolyA signal sequence, and an enhancer downstream of the PolyA signal sequence is provided. In certain embodiments, a polynucleotide comprising an AAV Rep coding sequence operably linked to heterologous promoters, a PolyA signal sequence, and an enhancer downstream of the PolyA signal sequence is provided.
[0215] A suitable polyA signal sequence may be a signal sequence that increases the length of poly A added to Rep mRNAs and / or the amount of Rep mRNAs with a long polyA as compared to a coding sequence not including the PolyA signal sequence. In certain cases, the polyA signal sequence may be an AAV Rep polyA signal sequence. In certain cases, the polyA signal sequence may be a native AAV Rep polyA signal sequence. In certain cases, the polyA signal sequence may be a polyA signal sequence that is stronger than AAV Rep polyA signal sequence. A PolyA signal sequence that is stronger than AAV Rep PolyA signal sequence provides for an expression level of the Rep proteins that is higher than the expression level of the Rep proteins using the AAV Rep PolyA signal sequence, e.g., at least 5%, 10%,42MOFO-35999248232463200114020%, 30%, 40%, 50% higher, or more. Polyadenylation (poly A) signal sequences generally include a short sequence that triggers polyadenylation of an mRNA. In certain instances, RNA stability, expression, and / or function can be enhanced with additional sequences surrounding a shorter sequence. Various PolyA signal sequences can be used for the coding sequences of various embodiments.
[0216] In certain embodiments, a polyA signal sequence that is stronger than AAV Rep polyA signal sequence may be bGH-polyA signal sequence or a SV40 polyA signal sequence as described herein. Additional suitable polyA signal sequences are described below in a section titled “PolyA signal sequences”. In a particular embodiment, a polynucleotide comprising the AAV Rep coding sequence operably linked to native Rep promoters, the bGH-PolyA signal sequence downstream of the AAV Rep coding sequence; and an enhancer downstream of the bGH-PolyA signal sequence is provided. In a particular embodiment, a polynucleotide comprising the AAV Rep coding sequence operably linked to heterologous promoters, the bGH-PolyA signal sequence downstream of the AAV Rep coding sequence; and an enhancer downstream of the bGH-PolyA signal sequence is provided.
[0217] A suitable enhancer may be a translational enhancer and / or a transcriptional enhancer. The enhancer increases the expression of the Rep proteins as compared to expression from a polynucleotide lacking the enhancer. Suitable enhancers are described below in a section titled “Enhancers.” i) PolyA Signal Sequence
[0218] In some embodiments, the polyA signal sequence is a native AAV Rep polyA signal sequence. In some embodiments, the polyA signal sequence is a heterologous polyA signal sequence. In some embodiments, the heterologous polyA signal sequence is selected from the group consisting of: a bovine growth hormone (bGH) polyA signal sequence, a human growth hormone (hGH) polyA signal sequence, a Simian Virus 40 (SV40) polyA signal sequence, a Chinese hamster growth hormone polyA signal sequence, a human neurophilin-1 polyA signal sequence, a nopaline synthase polyA signal sequence, an alpha globulin polyA signal sequence, and a rabbit globin polyA signal sequence.
[0219] In certain cases, the polyA signal sequence may be a AAV Rep polyA signal sequence and include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 1.
[0220] In certain cases, the polyA signal sequence may be a polyA signal sequence that is stronger than a AAV Rep polyA signal sequence, wherein the native AAV Rep polyA signal sequence includes a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 1. A PolyA signal sequence that is stronger than AAV Rep PolyA signal sequence provides for an expression level of the Rep proteins that is higher than the expression level of the Rep proteins using the AAV Rep PolyA signal sequence, e.g., at least 5%, 10%, 20%, 30%, 40%, 50% higher, or more.43MOFO-359992482324632001140
[0221] In various instances, the polyadenylation signal sequence comprises one or more of a bovine growth hormone poly adenylation (bGH-PolyA), a human growth hormone poly adenylation (hGH- PolyA), and / or a Chinese hamster growth hormone poly adenylation (chGH-PolyA).
[0222] The bGH-PolyA signal may include a nucleotide sequence that has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to nucleotide sequence of SEQ ID NO: 2.
[0223] The hGH-polyA signal may include a nucleotide sequence that has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to nucleotide sequence of SEQ ID NO: 3.
[0224] The chGH-polyA signal may include a nucleotide sequence that has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to nucleotide sequence of SEQ ID NO: 4.
[0225] Additional details regarding PolyA signal sequences are disclosed in US Pat. Nos. 11,793,180, 11,752,181, 10,912,826, 8,975,391, 7,557,197, and 5,122,458; US Pat. Pub. Nos. 2023 / 0332169, 2023 / 0330265, and 2023 / 0323390; or Gene Volume 231, Issues 1-2, 29 April 1999, Pages 77-86, Mol Cell Biol. 1989 Oct; 9(10): 4248-4258, and Nucleic Acids Research, Volume 15, Issue 23, 10 December 1987, Pages 9627-9640 and the disclosed PolyA signal sequences are hereby incorporated by reference in their entireties.
[0226] In certain cases, the SV40 polyA signal sequence may include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 5. In certain cases, the SV40 polyA signal sequence may include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 222.
[0227] Additional suitable polyA signal sequences can be selected from one or more of human neurophilin-1 polyA, nopaline synthase polyA, alpha globulin polyA, rabbit globin polyA, and / or other applicable poly adenylation signal sequences. In such instances, the polyA signal sequence may include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to any one of SEQ ID NOs: 6-10. ii) Enhancers
[0228] An enhancer can be any enhancer or combination of enhancers that increase transcription and / or translation of a gene. In certain cases, the enhancer present downstream of the polyA signal sequence (e.g., AAV Rep polyA signal sequence or a stronger polyA signal sequence, such as, bGH-PolyA signal sequence or SV40 polyA signal sequence) that is present downstream of the Rep coding sequence may be a single enhancer or may include combination of enhancers that increase transcription and / or translation of AAV Rep proteins. A combination of enhancers can include two enhancers (i.e., double enhancer), three44MOFO-359992482324632001140 enhancers (i.e., triple enhancer), four enhancers, five enhancers, or more enhancers. In some embodiments, the enhancer is a transcriptional enhancer, a translational enhancer, or a transcriptional and translational enhancer
[0229] In certain instances, an enhancer is selected from a cytomegalovirus (CMV) enhancer (SEQ ID NO: 169), a Simian virus 40 (SV40) enhancer (SEQ ID NO: 170), and a human telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 171). In certain embodiments, the enhancer comprises a sequence selected from SEQ ID NOs: 169-171. In various embodiments, the enhancer comprises a sequence having approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to one of SEQ ID NOs: 169-171. In certain embodiments, the enhancer comprises at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to one of SEQ ID NOs: 169-171.
[0230] Some embodiments incorporate a “double enhancer” comprising any two enhancers selected from a CMV enhancer, an SV40 enhancer, and an hTERT enhancer. In some embodiments incorporating a double enhancer, the double enhancer comprises a CMV enhancer and an SV40 enhancer. In some embodiments incorporating a double enhancer, the double enhancer comprises an hTERT enhancer and an SV40 enhancer. In some embodiments incorporating a double enhancer, the double enhancer comprises a CMV enhancer and an hTERT enhancer.
[0231] In certain embodiments, the double enhancer comprises the sequence of SEQ ID NO: 172. In various embodiments, the double enhancer comprises a sequence having approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 172. In certain embodiments, the double enhancer comprises at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to SEQ ID NO: 172.
[0232] Some embodiments incorporate a “triple enhancer” comprising a CMV enhancer, an SV40 enhancer, and an hTERT enhancer. In some embodiments, the order from 5’ to 3’ of the enhancers of a triple enhancer is 5 ’-hTERT enhancer-SV40 enhancer-CMV enhancer-3’. In some embodiments, an enhancer, such as a triple enhancer, is operably linked to the Rep gene. Additional details can be found in M. Watanabe et al., A novel gene expression system strongly enhances the anticancer effects of a REIC / Dkk-3-encoding adenoviral vector, Oncology Reports 31:1089-95 (2014); the disclosure of which is hereby incorporated by reference in its entirety.
[0233] In certain embodiments, the triple enhancer comprises the sequence of SEQ ID NO: 11. In various embodiments, the triple enhancer comprises a sequence having approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 11. In certain embodiments, the triple enhancer comprises at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to SEQ ID NO: 11.
[0234] In some embodiments, the enhancer is a transcriptional enhancer comprising a sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at45MOFO-359992482324632001140 least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to any one of SEQ ID NOs: 11-25. In some embodiments, the enhancer can include two or more of these sequences.
[0235] In addition to or instead of a transcriptional enhancer, some embodiments include a translational enhancer. In various embodiments, a translational enhancer is selected from a SARS-CoV2 5’-UTR or a variant thereof (SEQ ID NOs: 26-42). Specifically, SEQ ID NO: 26 provides the entire SARS- CoV2 5’-UTR, while SEQ ID Nos: 27-42 provide variants of the SARS-CoV2 5’-UTR. Such variants include substituting a region of the SARS-CoV2 5’-UTR with another element (SEQ ID NO: 27), altering a sequence of the SARS-CoV25’-UTR (SEQ ID NO: 28), or deletion variants of the SARS-CoV25’-UTR (SEQ ID Nos: 29-42), where each deletion variant represents a fragment of the entire SARS-CoV2 5’- UTR. In some embodiments, a SARS-Cov2 5’UTR is operably linked to the Rep coding sequence. Additional details can be found in WO 2021 / 231503; the disclosure of which is hereby incorporated by reference in its entirety. In many instances, the SARS-Cov2 5’UTR is located upstream of (i.e., 5’ of) the Rep coding sequence. In many instances, the SARS-Cov2 5’UTR is located downstream of (i.e., 3’ of) the Rep coding sequence.
[0236] Additionally or alternatively, some embodiments select a translational enhancer based on a mouse homeobox a9 (Hoxa9) IRES-like element. The Hoxa9 IRES-like element possesses four pairing elements (P1-P4). The P4 element (SEQ ID NO: 43) forms a stem-loop structure that has shown an ability to enhance translation. Certain embodiments may utilize a variant of the P4 element, such as a sequence variant selected from SEQ ID Nos: 44-54 or a structural variant selected from SEQ ID Nos: 55-56. The structural variants of SEQ ID Nos: 55-56 represent the respective arms of the P4 stem-loop structure. In some embodiments, a Hoxa9 IRES-like element is operably linked to the Rep gene. Additional details can be found in WO 2021 / 231502; the disclosure of which is hereby incorporated by reference in its entirety. In many instances, the Hoxa9 IRES-like element is located upstream of the Rep coding sequence. In many instances, the Hoxa9 IRES-like element is located downstream of the Rep coding sequence.
[0237] In various instances, a translational enhancer comprises a sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to any one of SEQ ID NOs: 11-116.
[0238] Additional details regarding enhancers are disclosed in one or more of: US Pat. No. 5,723,332; US Pat. Pub. Nos. 2023 / 0323390, 2023 / 0321238, 2023 / 0272378, 2023 / 0265381, 2023 / 0203515, 2023 / 0193304, 2023 / 0175018, 2021 / 0060182, and 2013 / 0177581; PCT Pub. Nos. WO 2021 / 231503 and WO 2021 / 231502; and Scientific Reports volume 8, Article number: 13753 (2018), Proc Natl Acad Sci U S A. 2012 Apr 24; 109(17): 6626-6631, PNAS January 7, 2010 107 (4) 1385-1390, Transgenic Research volume 19, pages 667-674 (2010), Journal of Bioscience and Bioengineering Volume 105, Issue 3, March 2008, Pages 300-302, Journal of Bioscience and Bioengineering, Volume 98, Issue 1, 2004, Pages 1-8, Virology Volume 321, Issue 1, 30 March 2004, Pages 36-46; the disclosures of which are hereby incorporated by reference in their entireties.46MOFO-359992482324632001140
[0239] In certain aspects, the large Rep coding sequence and small Rep coding sequence are both operably linked to a poly adenylation (poly A) signal sequence. In certain aspects, the large Rep coding sequence and small Rep coding sequence are both operably linked to a transcriptional and / or translational enhancer positioned downstream of the large Rep coding sequence and small Rep coding sequence. In certain aspects, the transcriptional and / or translational enhancer may be positioned downstream of the polyA signal sequence. The polyA signal sequence may be a polyA signal sequence functional in the cells used for producing the rAAV. In some instances, the polyA signal sequence may be a bovine Growth Hormone polyA (bGH-PolyA) signal sequence or a SV40 polyA signal sequence.
[0240] In certain aspects, the transcriptional and / or translational enhancer positioned downstream of the large Rep coding sequence and small Rep coding sequence may be any transcriptional and / or translational enhancer functional in the cells used for producing the rAAV. In certain cases, the enhancer present downstream of the large Rep coding sequence and small Rep coding sequence and / or downstream of the polyA signal (e.g., bGH-PolyA signal or SV40 polyA signal) may be a single enhancer or may include combination of enhancers that increase transcription and / or translation of a gene. In certain embodiments, an enhancer can be any enhancer or combination of enhancers that increase transcription and translation of a gene.
[0241] Some embodiments utilize one or more enhancers selected from a cytomegalovirus (CMV) enhancer, a Simian virus 40 (SV40) enhancer, and a human telomerase reverse transcriptase (hTERT) enhancer. Some embodiments incorporate a “triple enhancer” comprising a CMV enhancer, an SV40 enhancer, and an hTERT enhancer. In some embodiments, the order from 5’ to 3’ of the enhancers of a triple enhancer is 5 ’-hTERT enhancer-SV40 enhancer-CMV enhancer-3’. In some embodiments, an enhancer, such as a triple enhancer, is operably linked to the Rep gene. Additional details can be found in M. Watanabe et al., A novel gene expression system strongly enhances the anticancer effects of a REIC / Dkk-3 -encoding adenoviral vector, Oncology Reports 31:1089-95 (2014); the disclosure of which is hereby incorporated by reference in its entirety.
[0242] In certain embodiments, the triple enhancer comprises the sequence of SEQ ID NO: 11. In various embodiments, the triple enhancer comprises approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to SEQ ID NO: 11. In certain embodiments, the triple enhancer comprises at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to SEQ ID NO: 11.
[0243] The bGH-PolyA signal sequence may include a nucleotide sequence that has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to nucleotide sequence of SEQ ID NO: 2.
[0244] In certain cases, the SV40 polyA signal sequence may include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 5.47MOFO-359992482324632001140 b) Exemplar AAV Rep Proteins
[0245] In particular embodiments, the encoded Rep proteins, are large and small Rep proteins from AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV- 10, AAV-11, or chimeric combinations thereof. In particular embodiments, the encoded Rep proteins are large Rep proteins and small Rep proteins from AAV serotype 2.
[0246] The Rep sequence can encode Rep from any desired AAV serotype. In some embodiments, the encoded Rep protein is drawn from the same serotype as the Cap protein. In some embodiments, the encoded Rep protein is drawn from a different serotype from the Cap protein. In particular embodiments, the encoded Rep protein includes, but is not limited to, a Rep protein from AAV serotypes AAV-1, AAV- 2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11, or chimeric combinations thereof.
[0247] The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV- 2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol, 45: 555-564 (1983); the complete genome of AAV- 3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_00 1862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 relating to AAV-8); the AAV-9 genome is provided in Gao et al. Virol, 78: 6381-6388 (2004); the AAV-10 genome is provided in Mol Ther, 13(1): 67-76 (2006); and the AAV-11 genome is provided in Virology, 330(2): 375-383 (2004).
[0248] In some embodiments, the Rep polypeptide is a wildtype Rep polypeptide. In other embodiments, the Rep polypeptide is a synthetic or mutant Rep polypeptide. In many embodiments, the Rep polypeptide is selected from any naturally occurring serotype or variant. Exemplary and non-limiting wild type Rep polypeptides include one or more of SEQ ID NOs: 143 to 152.
[0249] In some embodiments, the Rep proteins encoded by the Rep expression cassette comprise an amino acid sequence having least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to one or more of SEQ ID NOs: 143 to 152. In some embodiments, the Rep proteins comprise the amino acid sequence of SEQ ID NO: 144 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence of SEQ ID NO: 144.
[0250] In some embodiments, a polynucleotide comprising a sequence encoding AAV Rep proteins, e.g., a Rep expression cassette, further comprises a sequence encoding AAV Cap proteins, e.g., a Cap expression cassette. AAV Cap proteins are described in the section below (e.g., Section II.B.2 Polynucleotides Encoding Cap proteins). In some such embodiments, the AAV Rep expression cassette is in an opposite orientation relative the AAV Cap expression cassette. In some embodiments, the AAV Rep48MOFO-359992482324632001140 expression cassette is oriented 3’ to 5’ and the AAV Cap expression cassette is oriented 5’ to 3.’ In some embodiments, the AAV Rep expression cassette is oriented 5’ to 3’ and the AAV Cap expression cassette is oriented 3’ to 5’. In some embodiments, the AAV Rep expression cassette is separated from the AAV Cap expression cassette by an intervening sequence. In certain embodiments, the intervening sequence is a transcription blocking element (TBE). In some embodiments, the TBE comprises the sequence of SEQ ID NO: 117 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.2. Polynucleotides for Expression of Cap proteins
[0251] In some embodiments, a polynucleotide comprises a sequence encoding AAV Cap proteins, e.g. an AAV Cap expression cassette. In some instances, the polynucleotide comprising a sequence encoding AAV Cap proteins is located on a plasmid, vector, or construct by itself. AAV Cap proteins are encoded in a single open reading frame (e.g., a Cap coding sequence) that is alternatively spliced to produce the three capsid proteins, VP1, VP2, and VP3. In some embodiments, a polynucleotide comprises an AAV Cap expression cassette that comprises a Cap open reading frame. In some embodiments, the Cap expression cassette comprises an intron upstream of the Cap open reading frame. In some embodiments, the intron is a 5’ p40 intron. The 5’ p40 intron upstream of the Cap open reading frame includes a splice donor (SD) site and a first splice acceptor (SAI) site while a second splice acceptor site (SA2) is located with the exon for the Cap open reading frame. VP1 is spliced from the first splice acceptor site (SAI) while VP2 and VP3 are spliced from the second splice acceptor site (SA2).
[0252] In some embodiments, transcription of Cap open reading frame is driven by a native AAV Cap promoter. In certain embodiments, the native AAV Cap proteins promoter is a native AAV p40 promoter. In some embodiments, the AAV Cap expression cassette comprises a promoter operably linked to the Cap open reading frame. The promoter can be selected from a native promoter, a heterologous promoter, an inducible promoter, and / or a constitutive promoter. In certain aspects, the promoter may be a native promoter. In certain aspects, the native promoter may be p40.
[0253] In some instances, the AAV Cap expression cassette is comprised on a polynucleotide comprising an AAV Rep open reading frame. In some such embodiments, the Rep open reading frame is 5’ to the Cap open reading frame. In certain embodiments, the Cap open reading frame is operably linked to an endogenous p40 promoter. In certain aspects, the p40 promoter may be present in the Rep open reading frame. In certain aspects, the p40 promoter may be present in the large Rep coding sequence that is common with the small Rep coding sequence. In some embodiments, the Cap open reading frame is operably linked to a heterologous promoter. In some embodiments, the Cap open reading frame is operably linked to an inducible promoter. The inducible promoter may be a promoter that is induced in response to exogenous or endogenous signals. For example, an inducible promoter may be induced in response to the production of a particular compound (e.g., protein, carbohydrate, lipid, etc.) within a cell or it may be induced by the addition of a triggering agent or inducer added exogenously, such as tetracycline, doxycycline, etc.49MOFO-359992482324632001140
[0254] In some embodiments, the inducible promoter comprises a tetracycline -responsive promoter element (TRE). In some embodiments, the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter. In some embodiments, the minimal promoter is a human cytomegalovirus promoter. In some embodiments, transcription from the inducible promoter is activated by the binding of an activator. Activators are known in the art. In some embodiments, the activator is reverse tetracycline-controlled transactivator (rtTA) comprising a Tet Repressor binding protein (TetR) fused to a VP16 transactivation domain. In some embodiments, the activator is selected from rtTa variants: rtTA, S2, M2, 2s-Sl, 2s-M2, VI, rtTa3, V10, and V16. See, e.g., Das AT, Tenenbaum L, Berkhout B. Tet- On Systems For Doxycycline-inducible Gene Expression. Curr Gene Ther. 2016;16(3):156-67. doi: 10.2174 / 1566523216666160524144041.
[0255] In some embodiments, the activator binds the promoter in the presence of a first triggering agent. In some embodiments, the activator is Tet-On3G. In some embodiments, the inducible promoter is activated in the presence of a first triggering agent. In some embodiments, the first triggering agent is doxycycline or tetracycline. In some embodiments, the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 184, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:184. In some embodiments the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 184.
[0256] In some embodiments, the polynucleotide comprising a sequence encoding AAV Rep proteins (e.g., a Rep expression cassette) and the polynucleotide comprising a sequence encoding AAV Cap proteins (e.g. a Cap expression cassette) are the same polynucleotide. For example, a polynucleotide construct comprises the sequence encoding AAV Rep proteins and the sequence encoding AAV Cap proteins. In various instances, the sequence encoding the AAV Rep proteins is 5’ of the sequence encoding the AAV Cap proteins. In some instances, the sequence encoding the AAV Rep proteins is downstream of the sequence encoding the AAV Cap proteins. In some instances, the sequence encoding the AAV Rep proteins and the sequence encoding the AAV Cap proteins are antiparallel to each other (e.g., on different coding strands). In various embodiments, the sequence encoding the AAV Rep proteins and the sequence encoding the AAV Cap proteins are separated by an intervening sequence.
[0257] In certain aspects, the polynucleotide also includes an AAV Cap coding sequence. The AAV Cap coding sequence may be operatively linked to an inducible promoter or constitutive promoter. In certain aspects, the Cap coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence and the polynucleotide further comprises an inducible or constitutive promoter operably linked to the Cap coding sequence. In certain aspects, the polynucleotide comprises an inducible promoter operably linked to the Cap coding sequence.
[0258] In certain aspects, the first promoter operatively linked to the large Rep coding sequence is present adjacent to the inducible promoter or constitutive promoter operatively linked to AAV Cap coding sequence, where the adjacent promoters are blocked from cross-promoting transcription by presence of an intervening sequence between the adjacent promoters. The intervening sequence may50MOFO-359992482324632001140 include a TBE such that the first promoter cannot affect transcription of Cap coding sequence and the inducible promoter or constitutive promoter operatively linked to AAV Cap coding sequence cannot affect transcription from the large Rep coding sequence.
[0259] In certain aspects, the intervening sequence comprises a transcriptional blocking element (TBE). In these embodiments, a TBE separates the first promoter that is operably linked to the large Rep coding sequence and the inducible promoter operably linked to AAV Cap coding sequence.
[0260] In certain embodiments, the TBE comprises the sequence of SEQ ID NO: 117. In various embodiments, the TBE comprises a sequence having approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 117. In certain embodiments, the TBE comprises a sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to SEQ ID NO: 117.
[0261] FIG. 9 depicts an exemplary polynucleotide for expressing Rep and Cap proteins. In this embodiment, a TBE separates the first promoter that is operably linked to the large Rep coding sequence and the inducible promoter operatively linked to AAV Cap coding sequence. A triple enhancer is located downstream to the poly A signal sequence (denoted as Poly A).
[0262] In other aspects, the AAV Cap coding sequence may be operably linked to a promoter, e.g., a constitutive promoter. In certain aspects, the promoter may be a native promoter. In certain aspects, the native promoter may be p40. In certain aspects, the p40 promoter may be present in the large Rep coding sequence that is common with the small Rep coding sequence. The AAV Cap coding sequence may be operably linked to an inducible promoter.
[0263] Various embodiments may include one or more of an enhancer and a polyA signal sequence. PolyA signal sequences can include one or more of the polyA sequences described herein (see e.g., Section II.B.l.a.i.). Such polyA signal sequences can be heterologous to the AAV Cap protein. In some instances, the polyA signal sequence encodes a stronger polyA signal than a native AAV Cap poly adenylation signal sequence and is 3' of the sequence encoding AAV Cap proteins. Enhancers can include one or more of enhancers described herein, including translational and / or transcriptional enhancers see e.g., Section II.B.l.a.ii.). Such enhancers can be 3’ and / or 5’ of the sequence encoding the AAV Cap proteins, depending on effect or purpose of the enhancer. In some instances, the polynucleotide comprises multiple enhancers, as described herein.
[0264] In certain aspects, the Cap coding sequence may be operably linked to a polyadenylation (polyA) signal sequence. The polyA signal sequence may be a polyA signal sequence functional in the cells used for producing the rAAV. In some instances, the polyA signal sequence may be a bovine Growth Hormone polyA (bGH-PolyA) signal sequence or a SV40 polyA signal sequence.
[0265] The bGH-PolyA signal sequence may include a nucleotide sequence that has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to nucleotide sequence of SEQ ID NO: 2:51MOFO-359992482324632001140
[0266] In certain cases, the SV40 polyA signal sequence may include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 5. In certain cases, the SV40 polyA signal sequence may include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 222.
[0267] In some embodiments, the Cap expression cassette comprises an intron downstream of the inducible promoter and upstream of the Cap coding sequence. In some embodiments, the intron comprises one or more splice sites for alternative splicing of the Cap open reading frame. In some embodiments, the intron can be a 5’ intron. In some embodiments, the 5’ intron is from the p40 promoter. In some embodiments, the intron comprises the nucleotide sequence of SEQ ID NO: 198, or or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence thereto.
[0268] In some embodiments, the Cap coding sequence is from AAV5, AAV9 or AAV2. In some embodiments, the Cap coding sequence is from AAV5. In some embodiments, the Cap coding sequence is from AAV9. In some embodiments, the Cap coding sequence is from AAV2.
[0269] In some embodiments, the Cap coding sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 199, 335, and 336, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the Cap coding sequence comprises the nucleotide sequence of SEQ ID NO: 199. In some embodiments, the Cap coding sequence comprises the nucleotide sequence of SEQ ID NO: 335. In some embodiments, the Cap coding sequence comprises the nucleotide sequence of SEQ ID NO: 336.
[0270] In some embodiments, the AAV Cap expression cassette comprises the nucleotide sequence of any one of SEQ ID NOs: 202, 338 and 345, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOs: 202, 338, and 345. In some embodiments, the AAV Cap expression cassette comprises the nucleotide sequence of SEQ ID NO: 202. In some embodiments, the AAV Cap expression cassette comprises the nucleotide sequence of SEQ ID NO: 338. In some embodiments, the AAV Cap expression cassette comprises the nucleotide sequence of SEQ ID NO: 345. a) Exemplar AAV Cap Proteins
[0271] The Cap open reading frame can encode Cap proteins from any desired AAV serotype. Such Cap proteins may include one or more of VP1, VP2, and VP3. In some embodiments, the encoded Cap protein is drawn from the same serotype as the Rep protein. In some embodiments, the encoded Cap protein is drawn from a different serotype from the Rep protein. In particular embodiments, the encoded Cap protein includes, but is not limited to, a Cap protein from AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11, or chimeric combinations thereof.52MOFO-359992482324632001140
[0272] In some aspects, the capsid is a capsid selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68 (described in W02020 / 033842, incorporated herein by reference in its entirety). The hu68 capsid is described in WO 2018 / 160582, incorporated herein by reference in its entirety. In some aspects, the capsid is an AAV5 capsid. In some aspects, the capsid is an AAV1 capsid. In some aspects, the capsid is an AAV2 capsid. In some aspects, the capsid is an AAV3 capsid. In some aspects, the capsid is an AAV4 capsid. In some aspects, the capsid is an AAV6 capsid. In some aspects, the capsid is an AAV7 capsid. In some aspects, the capsid is an AAV8 capsid. In some aspects, the capsid is an AAV9 capsid.
[0273] In some aspects, the capsid is a derivative, modification, or pseudotype of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV 13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10 , AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68.
[0274] In some aspects, capsid protein is a chimera of capsid proteins from two or more serotype selected from AAV1, AAV2, rAAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16 (described in W02020 / 033842, incorporated herein by reference in its entirety). In certain embodiments, the capsid is an rh32.33 capsid, described in US Pat. No. 8,999,678, incorporated herein by reference in its entirety.
[0275] The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV- 2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol, 45: 555-564 (1983); the complete genome of AAV- 3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_00 1862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 relating to AAV-8); the AAV-9 genome is provided in Gao et al. Virol, 78: 6381-6388 (2004); the AAV-10 genome53MOFO-359992482324632001140 is provided in Mol Ther, 13(1): 67-76 (2006); and the AAV-11 genome is provided in Virology, 330(2): 375-383 (2004).
[0276] In some embodiments, the Cap polypeptide is a wildtype Cap polypeptide. In other embodiments, the Cap polypeptide is a synthetic or mutant Cap polypeptide. In many embodiments, the Cap polypeptide is selected from any naturally occurring serotype or variant. Exemplary and non-limiting, naturally occurring Cap polypeptides can be selected from one or more of SEQ ID NOs: 153-168. Wild type Rep polypeptides can be selected from one or more of SEQ ID NOs: 143-152, while wild type Cap polypeptides can be selected from one or more of SEQ ID NOs: 153-168. The table below provides a summary of which polypeptide sequences correlate to which AAV serotypes and is not limiting on the scope of the present disclosure.
[0277] In some embodiments, the Cap proteins encoded by the Cap expression cassette comprise an amino acid sequence having least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to one or more of SEQ ID NOs: 153 to 168. In some embodiments, the Cap proteins comprise the amino acid sequence of SEQ ID NO: 157 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence of SEQ ID NO: 157. In some embodiments, the Cap proteins comprise the amino acid sequence of SEQ ID NO: 161 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence of SEQ ID NO: 161. In some embodiments, the Cap proteins comprise the amino acid sequence of SEQ ID NO: 154 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence of SEQ ID NO: 154.3. Exemplary Rep / Cap Polynucleotides Encoding a Ribozyme
[0278] Provided herein is a polynucleotide comprising a sequence encoding a ribozyme, e.g., any sequence encoding a ribozyme described in Section ILA, where the one or more sequences encoding a protein for AAV production comprise an AAV Rep expression cassette, e.g., any AAV Rep expression54MOFO-359992482324632001140 cassette described in Section II.B.l, and an AAV Cap expression cassette, e.g., any AAV Cap expression cassette described in Section II.B.2.
[0279] As noted above, expression of one or more genes for rAAV production (e.g., Rep proteins, Cap proteins, etc.) can lead to cellular toxicity. To limit this effect, a polynucleotide comprising a sequence encoding one or both of a large Rep and a small Rep protein, e.g., any of those described in Section II.B.l, further comprises a sequence encoding a cA-acting ribozyme, e.g., any of those described in Section ILA. In certain instances, the ribozyme catalyzes a reaction on the mRNA encoding the large and / or small Rep proteins to lead to degradation and / or silencing of the large and / or small Rep proteins. Such activity can limit cellular toxicity caused by leaky large and / or small Rep proteins Rep expression. An exemplary Rep / Cap construct comprising a sequence encoding a ribozyme is shown in Table E5.
[0280] Additionally, as discussed further below, in some embodiments, a polynucleotide sequence comprising an AAV Cap expression cassette, e.g., any of those described in Section II.B.2, comprises a sequence encoding a ribozyme that is cA-acting to a sequence encoding a Cap protein. In some embodiments, to further limit potential cellular toxicity, the polynucleotide sequence comprising a sequence encoding a ribozyme that is cA-acting to the sequence encoding one or both of the large and the small Rep protein further comprises a sequence encoding a ribozyme that is cA-acting to a sequence encoding a Cap protein.
[0281] FIG. 8A and FIG. 8B illustrate an exemplary Rep / Cap construct comprising a sequence encoding a ribozyme. In the illustrated example, the sequence encoding a ribozyme is located downstream (e.g., 3’ of) a sequence encoding the Rep proteins and upstream of (e.g., 5’ of) a polyA signal sequence. In some embodiments, the sequence encoding the ribozyme is located upstream of the small Rep coding sequence. In some embodiments, the sequence encoding the ribozyme is located downstream of the small Rep coding sequence. In some embodiments, the sequence encoding the ribozyme is located downstream of the large Rep coding sequence and the small Rep coding sequence.
[0282] In some embodiments, the ribozyme is a self-cleaving ribozyme — in such embodiments, the ribozyme in the mRNA cleaves itself from the mRNA molecule, thus separating the polyA sequence from the coding sequence. By performing this reaction, the mRNA molecule is no longer functional and subject to degradation, leading to silencing of the encoded protein. In some embodiments, the ribozyme mediates degradation of an RNA encoding the ribozyme. In some instances, the self-cleaving ribozyme is part of a Ribo-off system.
[0283] In some instances, the encoded ribozyme is a Hammerhead ribozyme. In their natural state, Hammerhead ribozymes are class of ribozymes that perform self-cleavage reactions and do not catalyze multiple reactions or turnovers. In certain embodiments the encoded ribozyme is selected from one or more of a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, and a RAGATH-1- hammerhead.55MOFO-359992482324632001140
[0284] In various embodiments, the sequence encoding a ribozyme has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 183 or SEQ ID NO: 139.
[0285] In various embodiments, the sequence encoding a ribozyme has approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 183 or SEQ ID NO: 139.
[0286] In some embodiments, the sequence encoding a ribozyme comprises SEQ ID NO: 183 or SEQ ID NO: 139.
[0287] In some embodiments, the sequence encoding a ribozyme is flanked by recombination sites to allow for inducible excision of the sequence encoding a ribozyme. In certain embodiments, the sequence encoding a ribozyme is flanked by a third recombination site and a fourth recombination site, wherein the third recombination site and the fourth recombination site are oriented in the same direction and wherein recombination between the third and fourth recombination sites by a recombinase, e.g., an inducible recombinase, results in excision of the sequence encoding the ribozyme. In certain instances, the third and fourth recombination sites comprise Lox sequences (or Lox sites). Lox sequences are part of a Cre-Lox recombination system that allows for recombination between Lox sites using a Cre recombinase. In some embodiments, the Lox sequences comprise LoxP, LoxN, Lox2272, and Lox511. In certain instances, the third and fourth recombination sites are LoxN sequences. In some instances, the third and fourth recombination sites are LoxP sequences. In various instances the third and fourth recombination sites differ from the first and second recombination sites. In various embodiments, a Cre recombinase can be added exogenously. In certain embodiments, a Cre recombinase is expressed within the cell. In certain instances, the Cre recombinase is inducible (e.g., operably linked to an inducible promoter).
[0288] FIG. 8B illustrates the construct within FIG. 8A after excising the sequence encoding a ribozyme — e.g., exposure to a Cre recombinase. As illustrated, the sequence encoding a ribozyme has been excised by recombination between the third and fourth recombination sites. Additionally, an excisable element comprising a marker protein (e.g., BFP) has been excised by its flanking recombination sites. Resultant mRNA from the construct of FIG. 8B will be spliced between the 5’ splice site (5’SS) and 3’ splice site (3’SS) allowing for translation of the Rep proteins.
[0289] In some embodiments, the AAV Rep expression cassette comprises, from 5’ to 3’, a promoter, a Rep open reading frame, an excisable element comprising a sequence encoding a ribozyme flanked by recombination sites, and a polyadenylation (poly A) signal sequence. In some embodiments, an mRNA transcript encoding a Rep protein comprises a sequence encoding a ribozyme. In some such embodiments, the ribozyme mediates degradation of the mRNA transcript encoding a Rep protein. In some embodiments, the mRNA transcript encodes Rep 78, Rep 68, Rep 52, or Rep40. Upon exposure to a recombinase, a recombination event between the flanking recombination sites results in the excision of the sequence encoding the ribozyme. Following excision of the sequence encoding the ribozyme, a stable mRNA transcript encoding a Rep protein is produced, thus allowing Rep protein expression.56MOFO-359992482324632001140
[0290] In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise Lox sites. In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise LoxP, LoxN, Lox2272, or Lox511 sequences. In some embodiments the recombination sites flanking the sequence encoding the ribozyme comprise LoxP sequences. In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise LoxN sequences.
[0291] In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise flippase recognition target (FRT) sites. In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise flippase recognition target (FRT) sites. In some such embodiments, the recombinase is a flippase (FRP) recombinase. In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a FRP recombinase fused to the ligand binding domain of an estrogen receptor. In some embodiments, the inducible recombinase is a FRP-ERT2 fusion protein.
[0292] In some embodiments, the recombination sites flanking the sequence encoding the ribozyme and the recombination sites flanking the coding sequence comprising the stop signaling sequence are different. In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise LoxP sequences and the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxN sequences. In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise LoxN sequences and the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxP sequences.
[0293] In some embodiments, the AAV Rep expression cassette comprises the nucleotide sequence of SEQ ID NO: 201, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 201.
[0294] In some instances, a polynucleotide comprising a sequence encoding Cap proteins further comprises a sequence encoding a ribozyme that is civ-acting to the sequence encoding Cap proteins. In certain instances, the ribozyme catalyzes a reaction on the mRNA encoding Cap proteins to lead to degradation and / or silencing of the Cap proteins.
[0295] In some instances, the sequence encoding a ribozyme is located downstream (e.g., 3’ of) a sequence encoding Cap and upstream of a polyA signal sequence. In some embodiments, the ribozyme is a self-cleaving ribozyme — in such embodiments, the ribozyme in the mRNA cleaves itself from the mRNA molecule, thus separating the polyA sequence from the coding sequence. By performing this reaction, the mRNA molecule is no longer functional and subject to degradation, leading to silencing of the encoded protein.
[0296] In some instances, the encoded ribozyme is a Hammerhead ribozyme. In their natural state, Hammerhead ribozymes are class of ribozymes that perform self-cleavage reactions and do not catalyze multiple reactions or turnovers. In certain embodiments the encoded ribozyme is selected from one or more of a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead57MOFO-359992482324632001140 ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, and a RAGATH-1- hammerhead.
[0297] In various embodiments, the sequence encoding a ribozyme has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 183 or SEQ ID NO: 139.
[0298] In various embodiments, the sequence encoding a ribozyme has approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 183 or SEQ ID NO: 139.
[0299] In some embodiments, the sequence encoding a ribozyme is flanked by recombination sites to allow for inducible excision of the sequence encoding a ribozyme. In certain embodiments, the sequence encoding a ribozyme is flanked by a third recombination site and a fourth recombination site, wherein the third recombination site and the fourth recombination site are oriented in the same direction and wherein recombination between the third and fourth recombination sites by a recombinase, e.g., an inducible recombinase, results in excision of the sequence encoding the ribozyme. In certain instances, the third and fourth recombination sites comprise Lox sequences (or Lox sites). Lox sequences are part of a Cre-Lox recombination system that allows for recombination between Lox sites using a Cre recombinase. In some embodiments, the Lox sequences comprise LoxP, LoxN, Lox2272, and Lox511. In certain instances, the third and fourth recombination sites are LoxN sequences. In some instances, the third and fourth recombination sites are LoxP sequences. In various embodiments, a Cre recombinase can be added exogenously. In certain embodiments, a Cre recombinase is expressed within the cell. In certain instances, the Cre recombinase is inducible (e.g., operably linked to an inducible promoter).
[0300] In some instances, a polynucleotide comprising a sequence encoding Cap proteins and a sequence encoding large and / or small Rep proteins further comprises a first sequence encoding a ribozyme that is civ-acting to the sequence encoding Cap proteins and a second sequence encoding a ribozyme that is civ-acting to the sequence encoding large and / or small Rep proteins. In certain instances, the first sequence encoding a ribozyme catalyzes a reaction on the mRNA encoding Cap proteins to lead to degradation and / or silencing of the Cap proteins and the second sequence encoding a ribozyme catalyzes a reaction on the mRNA encoding Rep proteins to lead to degradation and / or silencing of the Rep proteins.
[0301] In some instances, the first sequence encoding a ribozyme is located downstream (e.g., 3’ of) a sequence encoding Cap and upstream of a polyA signal sequence. In some instances, the second sequence encoding a ribozyme is located downstream (e.g., 3’ of) a sequence encoding Rep and upstream of a polyA signal sequence. In some embodiments, the first and second ribozymes are self-cleaving ribozymes — in such embodiments, the first and second ribozymes in the mRNA cleave themselves from their respective mRNA molecules, thus separating the polyA sequence from the coding sequence. By performing this reaction, the mRNA molecules are no longer functional and subject to degradation, leading to silencing of the encoded proteins.58MOFO-359992482324632001140
[0302] In some instances, the encoded ribozyme is a Hammerhead ribozyme. In their natural state, Hammerhead ribozymes are class of ribozymes that perform self-cleavage reactions and do not catalyze multiple reactions or turnovers. In certain embodiments the encoded ribozyme is selected from one or more of a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, and a RAGATH-1- hammerhead.
[0303] In various embodiments, the sequence encoding a ribozyme has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 183 or SEQ ID NO: 139.
[0304] In various embodiments, the sequence encoding a ribozyme has approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 183 or SEQ ID NO: 139.
[0305] In some embodiments, the sequence encoding a ribozyme is flanked by recombination sites to allow for inducible excision of the sequence encoding a ribozyme. In certain embodiments, the sequence encoding a ribozyme is flanked by a third recombination site and a fourth recombination site, wherein the third recombination site and the fourth recombination site are oriented in the same direction and wherein recombination between the third and fourth recombination sites by a recombinase, e.g., an inducible recombinase, results in excision of the sequence encoding the ribozyme. In certain instances, the third and fourth recombination sites comprise Lox sequences (or Lox sites). Lox sequences are part of a Cre-Lox recombination system that allows for recombination between Lox sites using a Cre recombinase. In some embodiments, the Lox sequences comprise LoxP, LoxN, Lox2272, and Lox511. In certain instances, the third and fourth recombination sites are LoxN sequences. In some instances, the third and fourth recombination sites are LoxP sequences. In various instances the third and fourth recombination sites differ from the first and second recombination sites. In various embodiments, a Cre recombinase can be added exogenously. In certain embodiments, a Cre recombinase is expressed within the cell. In certain instances, the Cre recombinase is inducible (e.g., operably linked to an inducible promoter).4. Polynucleotides Encoding a Selectable Marker
[0306] In certain aspects, the polynucleotide also includes a coding sequence for a selectable marker, e.g. a selection cassette. The coding sequence for the selectable marker may be operatively linked to a constitutive promoter. In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR).
[0307] In some embodiments, the polynucleotide further comprises a selection cassette. In some embodiments, the selection cassette comprises, from 5’ to 3’, a constitutive promoter operably linked to a nucleotide sequence encoding a selectable marker. In some embodiments, the selection cassette is located59MOFO-359992482324632001140 downstream of the AAV Cap expression cassette. In some embodiments, the selection cassette is in the same orientation as the AAV Cap expression cassette. In some embodiments, the selection cassette is located downstream of the AAV Rep expression cassette. In some embodiments, the selection cassette is in the same orientation as the AAV Rep expression cassette.
[0308] In some embodiments, the constitutive promoter is an EFla promoter. In some embodiments, the EFla promoter has a TATA box mutation. A TATA box reduces the activity of the EFla promoter resulting in decreased expression of the selectable marker. This promoter is useful for increasing copy number of the polynucleotide when present in a cell that is cultured under a selection pressure (e.g., antibiotic and for preventing cellular toxicity due to leaky Rep protein expression). In some embodiments, the constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 350, 185 or SEQ ID NO: 224, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 350, 185 or SEQ ID NO: 224
[0309] In some embodiments, the selectable marker is an antibiotic resistance gene. In some embodiments, the antibiotic resistance gene is selected from the group consisting of: a blasticidin resistance gene, a hygromycin resistance gene, a puromycin resistance gene, and an ampicillin resistance gene. In some embodiments, the resistance gene is a blasticidin resistance gene. In some embodiments, the selectable marker is a split selectable marker comprising: a) a first part of a resistance gene linked to an N- intein, or b) a C-intein linked to a second part of a resistance gene. In some embodiments, the selectable marker is a split selectable marker comprising: a) a first part of a blasticidin resistance gene linked to an N-intein, or b) a C-intein linked to a second part of a blasticidin resistance gene.
[0310] In some embodiments, the selectable marker comprises the nucleotide sequence of SEQ ID NO: 182 or SEQ ID NO: 334, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 182 or SEQ ID NO: 334.
[0311] In some embodiments, the selectable marker comprises the nucleotide sequence of SEQ ID NO: 181 or SEQ ID NO: 250, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 181 or SEQ ID NO: 250.
[0312] In some embodiments, the selection cassette comprises a 3’ UTR downstream of the selectable marker. In some embodiments, the 3’ UTR comprises the nucleotide sequence of SEQ ID NO: 325, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 325.
[0313] In some embodiments, the selection cassette comprises a polyA sequence downstream of the selectable marker. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 328, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 328.60MOFO-359992482324632001140
[0314] In some embodiments, the selection cassette comprises the nucleotide sequence of SEQ ID NO: 243, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 243.
[0315] In some embodiments, the polynucleotide comprises:!) an AAV Rep expression cassette comprising the nucleotide sequence of SEQ ID NO: 201 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, ii) an AAV Cap expression cassette comprising a Cap coding sequence operably linked to a heterologous promoter, and (Hi) a selection cassette encoding a selectable marker.
[0316] In some embodiments, the polynucleotide comprises: i) an AAV Rep expression cassette comprising the nucleotide sequence of SEQ ID NO: 201 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, ii) an AAV Cap expression cassette comprising the nucleotide sequence of any one of SEQ ID NOs: 202, 338, and 345 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing, and iii) a selection cassette comprising the nucleotide sequence of SEQ ID NO: 243, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
[0317] In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 221, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
[0318] In some embodiments, the polynucleotide comprises the nucleotide sequence of any one of SEQ ID NOs: 329, 343, and 346, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 329. In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 343. In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 346.
[0319] In some embodiments, the polynucleotide comprises the nucleotide sequence of any one of SEQ ID NOs: 140-142, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the forgoing.
[0320] The polynucleotide described herein may be used in a vector. The vector comprising the polynucleotide may be used in conjunction with one or more additional vectors for producing rAAV. Such vector systems are provided in the following section.C. Polynucleotides Encoding Adenoviral Helper Proteins
[0321] Provided herein, in some embodiments, is a polynucleotide comprising a sequence encoding one or more AAV helper proteins. In some embodiments, the polynucleotide comprises an AAV helper expression cassette comprising a sequence encoding one or more helper proteins operably linked to a promoter. In some embodiments, the AAV helper expression cassette is a first expression cassette,61MOFO-359992482324632001140 wherein the first expression cassette comprises a nucleotide sequence encoding one or more AAV helper proteins.
[0322] In some embodiments, the polynucleotide further comprises a second expression cassette, e.g., an activator expression cassette, comprising a constitutive promoter operably linked to a nucleotide sequence encoding an activator. In some embodiments, the polynucleotide further comprises athird expression cassette, e.g., a VA-RNA expression cassette, comprising a first part of a constitutive promoter, a third excisable element, a second part of a constitutive promoter and a sequence encoding VA RNA.
[0323] In some embodiments, the first expression cassette further comprises an inducible promoter. In some embodiments, the first expression cassette comprises, from 5’ to 3’: a) an inducible promoter, b) a self-excising element that comprises a sequence encoding a recombinase that is flanked by a fifth recombination site and a sixth recombination site, and c) a nucleotide sequence encoding one or more helper proteins, wherein the recombinase is operably linked to the inducible promoter.
[0324] In some embodiments, the inducible promoter of the polynucleotide comprising a sequence encoding one or more AAV helper proteins is the same as the inducible promoter of the polynucleotide comprising a sequence encoding AAV Cap proteins. In some embodiments, the inducible promoter of the first expression cassette is the same as the inducible promoter of the AAV Cap expression cassette. In some embodiments, the inducible promoter that is operably linked to the recombinase is the same as the inducible promoter that is operably linked to the Cap open reading frame.
[0325] In some embodiments, transcription from the inducible promoter is activated by the binding of an activator. In some embodiments, the activator activates transcription from the inducible promoter operably linked to the recombinase and the inducible promoter operably linked to the Cap open reading frame. In some embodiments, the activator binds the inducible promoter in the presence of a first triggering agent. In some embodiments, the activator is Tet-On3G. In some embodiments, the inducible promoter is activated in the presence of a first triggering agent. In some embodiments, the first triggering agent is doxycycline or tetracycline.
[0326] In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a Cre recombinase fused to an estrogen receptor ligand binding domain. In some embodiments, the inducible recombinase is a Cre-ERT2 fusion protein. In some embodiments, the inducible recombinase translocates to the nucleus in the presence of a second triggering agent. In some embodiments, the second triggering agent is tamoxifen.
[0327] In some embodiments, in the off state, such as depicted in Construct 2 of FIG. 18A, the self-excising element, comprising the sequence encoding the recombinase (e.g., a Cre recombinase), of the first expression cassette prevents operable linkage of the inducible promoter to the sequence encoding the one or more AAV helper proteins. In the on state, such as depicted in Construct 2 of FIG. 18B, in the presence of a first triggering agent, e.g., doxycycline, expression of the recombinase is activated by binding of the first triggering agent to an activator. In the presence of a second triggering agent, e.g., tamoxifen the inducible recombinase translocates to the nucleus andthe self-excising element is excised by the62MOFO-359992482324632001140 recombinase, thereby resulting in operable linkage of the inducible promoter to the one or more AAV helper proteins and allowing the expression of the one or more AAV helper proteins. Self-excision of the sequence encoding the Cre recombinase limits the duration of Cre expression in the cells thus limiting Cre related toxicity and promiscuous recombination events. In some embodiments, the activator, such as TetON3G, is expressed from a second expression cassette and can only bind to an inducible promoter, e.g., a tet-inducible promoter, in the presence of a triggering agent, such as doxycycline. In some embodiments, such as depicted in Construct 2 of FIG. 18B, when expression of the recombinase is activated, e.g., in the presence of a first triggering agent, and the inducible recombinase translocates to the nucleus, e.g., in the presence of a second triggering agent, the third excisable element is excised, thereby reconstituting the constitutive promoter by operably linking the first part with the second part of the constitutive promoter, which results in expression of the VA RNA.
[0328] In certain embodiments, this helper construct comprises: an inducible promoter operably linked to a self-excising element; the self-excising element comprising a third recombination site and a fourth recombination site flanking a sequence encoding an inducible recombinase; a constitutive promoter operably linked to a sequence encoding an activator. In some embodiments, the third recombination site and the fourth recombination site are oriented in the same direction. In some embodiments, the second inducible promoter is not operably linked to the sequence encoding the one or more adenoviral helper proteins. In some embodiments, the polynucleotide comprising a sequence encoding adenovirus helper proteins constitutively expresses the activator and the activator is unable to activate the first inducible promoter or the second inducible promoter in absence of a first triggering agent. In some embodiments, in absence of activation of the first inducible promoter and the second inducible promoter, detectable levels of the Rep proteins from the polynucleotide comprising a sequence encoding AAV Rep proteins or if present the Cap proteins, the Cap proteins from the polynucleotide comprising a sequence encoding AAV Cap proteins, the inducible recombinase, and the one or more adenoviral helper proteins are not expressed, and wherein the inducible recombinase is activated in the presence of a second triggering agent. In some embodiments, a polynucleotide comprising a sequence encoding adenovirus helper proteins is comprised within a construct, where the construct further comprises a polynucleotide comprising a sequence encoding VA-RNA as described herein.
[0329] In some embodiments, the polynucleotide comprising the sequence encoding one or more adenoviral helper proteins comprises: (i) a first sequence comprising from 5' to 3': a second inducible promoter operably linked to a sequence encoding a recombinase, e.g., an inducible recombinase; a selfexcising element comprising a fifth recombination site, the sequence encoding the recombinase, and a sixth recombination site; and a sequence encoding one or more adenoviral helper proteins, wherein the second inducible promoter is not operably linked to the sequence encoding the one or more adenoviral helper proteins; (ii) a second sequence comprising a first constitutive promoter operably linked to a sequence encoding an activator. In some embodiments, the third recombination site and the fourth recombination site are oriented in the same direction. In some embodiments, the cell constitutively expresses the activator,63MOFO-359992482324632001140 and the activator is unable to activate the second inducible promoter in absence of a first triggering agent. In some embodiments, in the presence of the first triggering agent, the activator activates the second inducible promoter resulting in expression of the inducible recombinase, and the inducible recombinase is expressed. In some embodiments, in the presence of a second triggering agent, the inducible recombinase translocates to a nucleus of the cell and causes recombination between the third recombination site and the fourth recombination site resulting in excision of the self-excising element, thereby operably linking the second inducible promoter to the sequence encoding the one or more adenoviral helper proteins and allowing expression of the one or more adenoviral helper proteins.
[0330] In some embodiments, the one or more adenoviral helper proteins comprise one or more of adenovirus E1A protein, E1B protein, E2A protein, and E4 protein. In certain embodiments, the one or more adenoviral helper proteins comprises E2A protein and E4 protein.
[0331] In some embodiments, the polynucleotide comprising the sequence encoding for one or more AAV helper proteins comprises a bicistronic open reading frame encoding two AAV helper proteins..
[0332] In some embodiments, the one or more adenoviral helper proteins are separated by a bicistronic open reading frame. In certain embodiments, the bicistronic open reading frame comprises an internal ribosome entry site (IRES) or a peptide 2A (P2A) sequence. In some embodiments, the sequence encoding the one or more AAV helper proteins is a bistronic open reading frame encoding at least two AAV helper proteins. In some embodiments, the one or more helper proteins comprise E2A and E4. In some embodiments, the E2A protein is encoded by a nucleotide sequence comprising SEQ ID NO: 212 and SEQ ID NO: 213, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the E2A protein is encoded by a nucleotide sequence comprising SEQ ID NO: 212 and SEQ ID NO: 213. In some embodiments, the E4 protein is encoded by a nucleotide sequence comprising SEQ ID NO: 217, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the E4 protein is encoded by a nucleotide sequence comprising SEQ ID NO: 217.
[0333] In some embodiments, the sequence coding for E2A and the sequence coding for E4 are separated by an internal ribosome entry site (IRES) or by a cleavable linker. In some embodiments, the sequence coding for E2A and the sequence coding for E4 are separated by an IRES. In some embodiments, the IRES comprises that nucleotide sequence of SEQ ID NO: 216, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the IRES comprises that nucleotide sequence of SEQ ID NO: 216.
[0334] In some embodiments, the sequence coding for E2A and the sequence coding for E4 are separated by a cleavable linker. In some embodiments, the cleavable linker is a 2A peptide, optionally wherein the 2A peptide is P2A, T2A, F2A, or E2A. In some embodiments, the 2A peptide is P2A, T2A, F2A, or E2A.64MOFO-359992482324632001140
[0335] In some embodiments, the second inducible promoter operably linked to the self-excising element in the polynucleotide is a tetracycline-inducible promoter, an ecdysone-inducible promoter, or a cumate-inducible promoter.
[0336] In some embodiments, the first inducible promoter and the second inducible promoter are the same. In some embodiments, the first inducible promoter and the second inducible promoter are a tetracycline-inducible promoter. In some embodiments, the inducible promoter of the second polynucleotide is the same as the inducible promoter of the first polynucleotide.
[0337] In certain embodiments, the inducible promoter comprises a tetracycline-responsive promoter element (TRE). In certain embodiments, the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter. In some embodiments, the tetO sequence concatamers comprises the sequence of SEQ ID NO: 228. In certain embodiments, the minimal promoter is a human cytomegalovirus promoter. In some embodiments, the minimal promoter comprises the nucleotide sequence of SEQ ID NO: 229.
[0338] In some embodiments, the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 184 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 184.
[0339] In some embodiments, the first constitutive promoter is EFl alpha promoter or human cytomegalovirus promoter.
[0340] In some embodiments, the activator is reverse tetracycline-controlled transactivator (rTA) comprising a Tet Repressor binding protein (TetR) fused to a VP16 transactivation domain.
[0341] In some embodiments, the inducible promoter is activated in the presence of a triggering agent, e.g., a first triggering agent. For instance, as shown in FIG. 44A, in the absence of a triggering agent, the inducible promoter is not activated, thereby resulting in a lack of expression of helper proteins E2A and E4 from Construct 2, whereas in the presence of a triggering agent, e.g., doxycycline, there is activation of the inducible promoter, thereby resulting in expression of helper proteins E2A and E4 from Construct 2, as shown in FIG. 44B. In some embodiments, a triggering agent, e.g., first triggering agent, for inducing the inducible promoter, e.g., the tetracycline-inducible promoter, is tetracycline. In other embodiments, a triggering agent, e.g., a first triggering agent, for inducing the inducible promoter, e.g., the tetracycline-inducible promoter, is doxycycline. Accordingly, in some embodiments, the triggering agent is doxycycline. In some embodiments, the first triggering agent is doxycycline.
[0342] In some embodiments, the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus in the presence of a second triggering agent, such as tamoxifen. As used herein, an estrogen response element can refer to an estrogen receptor.
[0343] In some embodiments, the sequence encoding the recombinase in the self-excising element is excised following a recombination event between the fifth recombination site and the sixth recombination site. In some embodiments, the second inducible promoter is operably linked to the sequence65MOFO-359992482324632001140 encoding one or more AAV helper proteins following a recombination event between the fifth recombination site and the sixth recombination site, as depicted in FIG. 44B.
[0344] In some embodiments, the recombinase is a Cre recombinase or a flippase (FLP) recombinase.
[0345] In some embodiments, the recombination sites in the polynucleotide comprising a sequence encoding AAV Rep proteins and / or the polynucleotide comprising a sequence encoding helper proteins are lox sites and the inducible recombinase is a Cre recombinase. In some embodiments, the fifth recombination and sixth recombination sites comprise Lox sequences. In some embodiments, the recombinase is a Cre recombinase. In some embodiments, the fifth recombination and sixth recombination sites comprise Lox sequences, and the recombinase is a Cre recombinase. In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a Cre recombinase fused to an estrogen receptor ligand binding domain. In some embodiments, the inducible recombinase is a Cre-ERT2 fusion protein. In some embodiments, the inducible recombinase translocates to the nucleus in the presence of a second triggering agent. In some embodiments, the second triggering agent is an estrogen receptor ligand. In some embodiments, the second triggering agent is a selective estrogen receptor modulator (SERM). In some embodiments, the second triggering agent is tamoxifen.
[0346] In some embodiments, the inducible recombinase comprises the nucleotide sequence of SEQ ID NO: 211, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the recombination event between recombination sites is induced in the presence of the first and second triggering agents. In some embodiments, the recombination event between the fifth recombination site and the sixth recombination site is induced in the presence of the first and second triggering agents. In some embodiments, the first triggering agent is doxycycline and the second triggering agent is tamoxifen.
[0347] In other embodiments, the recombination sites in the polynucleotide comprising a sequence encoding AAV Rep proteins and / or the polynucleotide comprising a sequence encoding helper proteins are flippase recognition target (FRT) sites and the inducible recombinase is a flippase (Flp) recombinase. In some embodiments, the fifth recombination and sixth recombination sites comprise FRT sequences. In some embodiments, the recombinase is a Flp recombinase. In some embodiments, the fifth recombination and sixth recombination sites comprise FRT sequences, and the recombinase is a Flp recombinase.
[0348] In some embodiments, presence of the triggering agent activates the activator for activation of an inducible promoter to express AAV Cap proteins from the polynucleotide encoding the AAV Cap proteins.
[0349] In some embodiments, presence of the triggering agent activates the activator for activation of an inducible promoter to express AAV helper proteins from the polynucleotide encoding the AAV helper proteins.66MOFO-359992482324632001140
[0350] In some embodiments, presence of the triggering agent activates the activator for activation of an inducible promoter to express the Rep proteins of the polynucleotide comprising a sequence encoding AAV Rep proteins; if present, the Cap proteins, the inducible recombinase, and the one or more adenoviral helper proteins.
[0351] In some embodiments, upon expression of the inducible recombinase, recombination between the first recombination site and the second recombination site in the polynucleotide comprising a sequence encoding AAV Rep proteins results in excision of the excisable element, and the first part of the AAV Rep proteins coding sequence and the second part of the AAV Rep proteins coding sequence are joined to form a complete AAV Rep proteins coding sequence, wherein the one or more promoters are operably linked to the complete AAV Rep coding sequence to allow expression of an AAV Rep protein of the polynucleotide comprising a sequence encoding AAV Rep proteins and, if present, the Cap Proteins; and recombination between the third recombination site and the fourth recombination site in a polynucleotide comprising a sequence encoding VA-RNA (as described herein) results in excision of the self-excising element comprising the sequence encoding the inducible recombinase, wherein the inducible promoter becomes operably linked to the sequence encoding the one or more adenoviral helper proteins to allow expression of the one or more adenoviral helper proteins.
[0352] In some embodiments, the polynucleotide further comprises a selectable marker operably linked to a third promoter.
[0353] In some embodiments, the first expression cassette comprises the nucleotide sequence of SEQ ID NO: 236, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, In some embodiments, the first expression cassette comprises the nucleotide sequence of SEQ ID NO: 236.
[0354] In some embodiments, the first expression cassette further comprises a sequence encoding a ribozyme as a c is- acting factor to a sequence encoding one or more adenovirus helper proteins. In certain instances, the ribozyme catalyzes a reaction on the mRNA encoding the helper proteins to lead to degradation and / or silencing of the helper proteins. In some instances, the encoded ribozyme is a Hammerhead ribozyme. In various embodiments, the sequence encoding a ribozyme has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 183 or SEQ ID NO: 139, In some embodiments, the sequence encoding a ribozyme is flanked by recombination sites to allow for inducible excision of the sequence encoding a ribozyme
[0355] In some embodiments, the second polynucleotide further comprises a second expression cassette comprising a second constitutive promoter operably linked to a nucleotide sequence encoding an activator.
[0356] In some embodiments, the activator is Tet-on3G. In some embodiments, the activator comprises the nucleotide sequence of SEQ ID NO: 223 or SEQ ID NO: 258, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity67MOFO-359992482324632001140 thereto. In some embodiments, the activator comprises the nucleotide sequence of SEQ ID NO: 223 or SEQ ID NO: 258.
[0357] In some embodiments, the second expression cassette is in an opposite orientation relative to the first expression cassette. In some embodiments, the first expression cassette is oriented 3’ to 5’ and the second expression cassette is oriented 5’ to 3’, or the first expression cassette is oriented 5’ to 3’ and the second expression cassette is oriented 3’ to 5’. In some embodiments, the first expression cassette is separated from the second expression cassette by an intervening sequence. In some embodiments, the intervening sequence comprises a transcriptional blocking element (TBE). In some embodiments, the TBE element comprises the sequence of SEQ ID NO: 200 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the TBE element comprises the sequence of SEQ ID NO: 200.
[0358] In some embodiments, the activator activates transcription from the inducible promoter of the first polynucleotide and / or the second polynucleotide in the presence of a first triggering agent. In some embodiments, the first triggering agent is doxycycline.
[0359] In some embodiments, the second constitutive promoter is an EFla promoter. In some embodiments, the EFla promoter has a TATA box mutation. In some embodiments, the second constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 350, 185 or SEQ ID NO: 224, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the second constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 350, 185 or SEQ ID NO: 224.
[0360] In some embodiments, the second expression cassette comprises the nucleotide sequence of SEQ ID NO: 257, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the second expression cassette comprises the nucleotide sequence of SEQ ID NO: 257.
[0361] In some embodiments, the polynucleotide comprising a sequence encoding adenovirus helper proteins has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 127-129, 231, or 321. In some embodiments, the second polynucleotide comprises the sequence of SEQ ID NO: 231 or SEQ ID NO: 127, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the second polynucleotide comprises the sequence of SEQ ID NO: 231 or SEQ ID NO: 127. In some embodiments, the second polynucleotide is a helper construct comprising a helper expression cassette comprising the nucleotide sequence of SEQ ID NO: 236, an activator expression cassette comprising the sequence of SEQ ID NO: 257, and a VA-RNA expression cassette comprising the nucleotide sequence of SEQ ID NO: 238. In some embodiments, helper construct sequence further comprises 5’ and 3’ ITRs for genome integration by a transposase. In some embodiments, the helper construct sequence is set forth in SEQ ID NO: 127 (pre-68MOFO-359992482324632001140 induction) and SEQ ID NO: 128 (post-induction). In some embodiments, the helper construct is encoded in a plasmid comprising the nucleotide sequence of SEQ ID NO: 129.
[0362] An exemplary helper construct, which is shown in Table E6, encodes adenoviral helper proteins and a selection cassette to select cells with integrated helper construct(s). An excisable CRE is also encoded.1. Polynucleotides Encoding VA-RNA
[0363] Provided herein, in some embodiments, is a polynucleotide comprising an expression cassette comprising a first part of a third constitutive promoter, a third excisable element, a second part of a constitutive promoter and a sequence encoding a viral associated RNA (VA-RNA).
[0364] In some embodiments, the second polynucleotide further comprises a third expression cassette, e.g., a VA RNA expression cassette comprising a first part of a third constitutive promoter, a third excisable element, a second part of a constitutive promoter and a sequence encoding VA RNA.
[0365] Provided herein, in some embodiments, is a second polynucleotide comprising a first expression cassette, wherein the first expression cassette comprises a nucleotide sequence encoding one or more AAV helper proteins, such as described herein; a second expression cassette comprising a second constitutive promoter operably linked to a nucleotide sequence encoding an activator, as described herein; and a third expression cassette comprising a first part of a third constitutive promoter, a third excisable element, a second part of a constitutive promoter and a sequence encoding VA RNA.
[0366] In some embodiments, the third expression cassette is downstream of the second expression cassette and is in the same orientation as the second expression cassette. In some embodiments, the third excisable element is in an opposite orientation relative to the third constitutive promoter. In some embodiments, the third excisable element comprises a second selection cassette flanked by a seventh recombination site and an eighth recombination site. In some embodiments, the second selection cassette is excised following a recombination event between the seventh recombination site and the eighth recombination site thereby generating a functionally complete third constitutive promoter operably linked to the sequence encoding VA RNA.
[0367] In some embodiments, the first part of third the constitutive promoter comprises a U6 promoter distal sequence element (DSE) and the second part of the third constitutive promoter comprises a U6 promoter proximal sequence element (PSE). In some embodiments, the U6 promoter DSE comprises the nucleotide sequence of SEQ ID NO: 234, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the U6 promoter DSE comprises the nucleotide sequence of SEQ ID NO: 234. In some embodiments, the U6 promoter PSE comprises the nucleotide sequence of SEQ ID NO: 235, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the U6 promoter PSE comprises the nucleotide sequence of SEQ ID NO: 235.69MOFO-359992482324632001140
[0368] In some embodiments, the sequence encoding VA RNA comprises the nucleotide the sequence set forth in any one of SEQ ID NOs: 173-176, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the sequence encoding VA RNA is a transcriptionally dead sequence. In some embodiments, the sequence encoding VA RNA comprises at least two mutations in an internal promoter. In some embodiments, the at least two mutations comprise a G16A mutation and a G60A mutation with reference to SEQ ID NO: 173. In some embodiments, the sequence encoding VA RNA comprises the nucleotide sequence of SEQ ID NO: 176 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the sequence encoding VA RNA comprises the nucleotide sequence of SEQ ID NO: 176.
[0369] In some embodiments, the second selection cassette comprises a fourth constitutive promoter operably linked to a nucleotide sequence encoding second selectable marker. In some embodiments, the second selectable marker is an antibiotic resistance gene, such as a puromycin resistance gene. In some embodiments, the second selectable marker is a puromycin resistance gene. In some embodiments, the puromycin resistance gene comprises the nucleotide sequence of SEQ ID NO: 225, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the puromycin resistance gene comprises the nucleotide sequence of SEQ ID NO: 225.
[0370] In some embodiments, the fourth constitutive promoter is a CMV promoter.
[0371] In some embodiments, the second selection cassette comprises the nucleotide sequence of SEQ ID NO: 239, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the second selection cassette comprises the nucleotide sequence of SEQ ID NO: 239.
[0372] In some embodiments, the third expression cassette comprises the nucleotide sequence of SEQ ID NO: 238, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the third expression cassette comprises the nucleotide sequence of SEQ ID NO: 238.
[0373] In some embodiments, the third expression cassette further comprises a sequence encoding a ribozyme as a civ-acting factor to a sequence encoding VA-RNA. In certain instances, the ribozyme catalyzes a reaction on the VA-RNA to lead to degradation and / or silencing VA-RNA. In some instances, the encoded ribozyme is a Hammerhead ribozyme. In various embodiments, the sequence encoding a ribozyme has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 183 or SEQ ID NO: 139. In some embodiments, the sequence encoding a ribozyme is flanked by recombination sites to allow for inducible excision of the sequence encoding a ribozyme.70MOFO-359992482324632001140
[0374] In certain embodiments, the VA-RNA is a mutated VA-RNA. In some embodiments, the VA-RNA is wild-type VA-RNA. In other embodiments, VA-RNA comprises one or more mutations in the VA-RNA internal promoter.
[0375] In some embodiments, the sequence encoding the VA-RNA is operably linked to an inactive promoter comprising a first part of a second constitutive promoter and a second part of the second constitutive promoter separated by a second excisable element comprising a fifth recombination site and a sixth recombination site flanking a staffer sequence, and excision of the second excisable element by the inducible recombinase generates a functional complete second constitutive promoter operably linked to the VA-RNA coding sequence to allow expression of the VA-RNA. In some embodiments, the fifth and sixth recombination sites are oriented in the same direction.
[0376] In some embodiments, the first part of the second constitutive promoter comprises a distal sequence element (DSE) of an RNA polymerase III promoter, and the second part of the second constitutive promoter comprises a proximal sequence element (PSE) of an RNA polymerase III promoter. In other embodiments, the first part of the second constitutive promoter comprises a distal sequence element (DSE) of a U6 promoter, and the second part of the second constitutive promoter comprises a proximal sequence element (PSE) of a U6 promoter. In still other embodiments, the first part of the second constitutive promoter comprises a distal sequence element (DSE) of a U7 promoter, and the second part of the second constitutive promoter comprises a proximal sequence element (PSE) of a U7 promoter.
[0377] In some embodiments, the expression of VA-RNA is constitutive. In some embodiments, the expression of VA-RNA is inducible. In some embodiments, the constitutive promoter is EFlalpha promoter or human cytomegalovirus promoter. In some embodiments, the inducible promoter is a tetracycline-inducible promoter, an ecdysone-inducible promoter, or a cumate-inducible promoter. In some embodiments, a polynucleotide encoding a VA-RNA comprises a sequence coding for a transcriptionally dead (e.g., transcriptionally inactive) VA-RNA. In some embodiments, the sequence coding for the VARNA comprises a deletion of from about 5-10 nucleotides in the promoter region. In some embodiments, the sequence coding for the VA-RNA comprises at least one mutation. In some embodiments, the at least one mutation is in the A Box promoter region. In some embodiments, the at least one mutation is in the B Box promoter region. In some embodiments, the at least one mutation is G16A mutation or a G60A mutation, or a combination thereof. In some embodiments, the VA-RNA comprises a G16A mutation or a G60A mutation, or a combination thereof.
[0378] In some embodiments, the expression of the VA-RNA is under the control of an RNA polymerase III promoter. In some embodiments, the expression of VA-RNA is driven by a EFlalpha promoter. In some embodiments, the expression of the VA-RNA is under the control of an interrupted RNA polymerase III promoter. In some embodiments, the expression of the VA-RNA is under the control of a U6 or U7 promoter. In some embodiments, the expression of the VA-RNA is under the control of an interrupted U6 or U7 promoter. In some embodiments, the expression of VA-RNA is driven by a U6 promoter or a U7 promoter. In some embodiments, the U6 promoter or the U7 promoter comprises a) a71MOFO-359992482324632001140 first part of a U6 or U7 promoter sequence, b) a staffer sequence, and c) a second part of a U6 or U7 promoter sequence. In some embodiments, the staffer sequence is excisable by a recombinase. In some embodiments, the staffer sequence is excisable by a Cre recombinase. In some embodiments, the staffer sequence comprises a sequence encoding a gene. In some embodiments, the staffer sequence comprises a promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is a CMV promoter. In some embodiments, the polynucleotide construct comprises upstream of the VA-RNA gene sequence, from 5’ to 3’: a) a first part of a U6 or U7 promoter sequence; b) a first recombination site; c) a staffer sequence; d) a second recombination site; e) a second part of a U6 or U7 promoter sequence.
[0379] In some embodiments, the gene encodes a detectable marker or a selectable marker. In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR). In some embodiments, PAH comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 272. In some embodiments, GS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 273. In some embodiments, TYMS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 274. In some embodiments, the auxotrophic selection element codes for an inactive protein that requires expression of a second auxotrophic selection element for activity. In some embodiments, the auxotrophic selection element codes for a C- terminal fragment of the auxotrophic protein Z-Cter and the second auxotrophic selection element codes for N-terminal fragment of an auxotrophic protein Z-Nter, or vice a versa. In some embodiments, the auxotrophic selection element codes for DHFR Z-Cter or DHFR Z-Nter. In some embodiments, the selectable marker is DHFR Z-Nter or DHFR Z-Cter. In some embodiments, the DHFR Z-Nter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 275. In some embodiments, the DHFR Z-Cter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 276. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein and the second auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein and the second auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for C- terminal fragment of PAH, GS, TYMS, or DHFR fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of PAH, GS, TYMS, or DHFR fused to a N-terminal intein of a split intein. In some embodiments, the selectable marker is an antibiotic resistance protein. In some embodiments, the selectable marker is a split intein linked to an N-72MOFO-359992482324632001140 terminus of the antibiotic resistance protein or split intein linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the selectable marker is a leucine zipper linked to an N-terminus of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the antibiotic resistance protein is for puromycin resistance or blasticidin resistance. In some embodiments, the split intein is derived from the Nostoc punctiforme (Npu) DnaE intein, the Synechocystis species, strain PCC6803 (Ssp) DnaE intein, or the consensus DnaE intein (Cfa). In some embodiments, an N-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 277. In some embodiments, a C-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 278.
[0380] In some embodiments, the stuffer sequence further comprises a sequence coding for a selectable marker and a helper enzyme, wherein expression of the helper enzyme facilitates growth of the cell in conjunction with the selectable marker. In certain embodiments, the helper enzyme is an enzyme that facilitates production of a molecule required for cell growth. For example, the helper enzyme may be required for production of a cofactor utilized by the functional enzyme to generate the molecule required for cell growth. In certain embodiments, the cell may produce the helper enzyme at low levels and the expression of the helper enzyme from the helper construct can increase helper enzyme levels thereby increasing production of the molecule required for cell growth, by, e.g., increasing levels of a co-factor required for enzyme activity. In some embodiments, the stuffer sequence further encodes a helper enzyme involved in production of tyrosine from phenylalanine. In some embodiments, the helper enzyme facilitates PAH-mediated production of tyrosine from phenylalanine. In some embodiments, the helper enzyme catalyzes production a co-factor required by PAH for converting phenylalanine to tyrosine. In some embodiments, the helper enzyme is GTP cyclohydrolase I (GTP-CH1). ). In some embodiments, the helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 279. In some embodiments, the GT — CHI produces the cofactor (6R)-5,6,7,8-tetrahydrobiopterin (BH4) that is required for conversion of phenylalanine to tyrosine. In some embodiments, expression of GTP- CH1 facilitates growth of the host cell in conjunction with functional PAH upon application of the single selective pressure.
[0381] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 272-274, or 280-305. In some embodiments, the selectable marker and helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 306-314.
[0382] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 182,181, 250, or 334. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 182 or SEQ ID NO: 334. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 181 or SEQ ID NO: 250.73MOFO-359992482324632001140
[0383] In some embodiments, the detectable marker comprises a luminescent marker or a fluorescent marker. In some embodiments, the fluorescent marker is GFP, EGFP, RFP, CFP, BFP, YFP, or mCherry. In some embodiments, an inducible helper construct comprises a polynucleotide construct coding for a VA-RNA or the VA-RNA construct further comprising a sequence coding for a recombinase. In some embodiments, the recombinase is exogenously provided. In some embodiments, the recombinase is a site-specific recombinase. In some embodiments, the recombinase is a Cre polypeptide or a Flippase polypeptide. In some embodiments, the Cre polypeptide is fused to a ligand binding domain. In some embodiments, the ligand binding domain is a hormone receptor. In some embodiments, the hormone receptor is an estrogen receptor. In some embodiments, the estrogen receptor comprises a point mutation. In some embodiments, the estrogen receptor is ERT2. In some embodiments, the recombinase is a Cre- ERT2 polypeptide. In some embodiments, the first recombination site is a first lox sequence and the second recombination site is a second lox sequence. In some embodiments, the first lox sequence is a first loxP site and the second lox sequence is a second loxP site. In some embodiments, the first recombination site is a first FRT site and the second recombination site is a second FRT site.
[0384] In some embodiments, the construct comprising the VA-RNA as described herein further comprises a sequence coding for a selectable marker. In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR). In some embodiments, PAH comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 272. In some embodiments, GS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 273. In some embodiments, TYMS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 274. In some embodiments, the auxotrophic selection element codes for an inactive protein that requires expression of a second auxotrophic selection element for activity. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein Z-Cter and the second auxotrophic selection element codes for N-terminal fragment of an auxotrophic protein Z-Nter, or vice a versa. In some embodiments, the auxotrophic selection element codes for DHFR Z-Cter or DHFR Z-Nter. In some embodiments, the selectable marker is DHFR Z-Nter or DHFR Z-Cter. In some embodiments, the DHFR Z-Nter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 275. In some embodiments, the DHFR Z-Cter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 276. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein and the second auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein and the second auxotrophic selection74MOFO-359992482324632001140 element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for C-terminal fragment of PAH, GS, TYMS, or DHFR fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of PAH, GS, TYMS, or DHFR fused to a N-terminal intein of a split intein. In some embodiments, the selectable marker is an antibiotic resistance protein. In some embodiments, the selectable marker is a split intein linked to an N-terminus of the antibiotic resistance protein or split intein linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the selectable marker is a leucine zipper linked to an N-terminus of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the antibiotic resistance protein is for puromycin resistance or blasticidin resistance. In some embodiments, the split intein is derived from the Nostoc punctiforme (Npu) DnaE intein, the Synechocystis species, strain PCC6803 (Ssp) DnaE intein, or the consensus DnaE intein (Cfa). In some embodiments, an N-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 277. In some embodiments, a C-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 278.
[0385] In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA further comprises a sequence coding for a selectable marker and a helper enzyme, wherein expression of the helper enzyme facilitates growth of the cell in conjunction with the selectable marker. In certain embodiments, the helper enzyme is an enzyme that facilitates production of a molecule required for cell growth. For example, the helper enzyme may be required for production of a cofactor utilized by the functional enzyme to generate the molecule required for cell growth. In certain embodiments, the cell may produce the helper enzyme at low levels and the expression of the helper enzyme from the helper construct can increase helper enzyme levels thereby increasing production of the molecule required for cell growth, by, e.g., increasing levels of a co-factor required for enzyme activity. In some embodiments, the construct comprising the VA-RNA further encodes a helper enzyme involved in production of tyrosine from phenylalanine. In some embodiments, the helper enzyme facilitates PAH-mediated production of tyrosine from phenylalanine. In some embodiments, the helper enzyme catalyzes production a co-factor required by PAH for converting phenylalanine to tyrosine. In some embodiments, the helper enzyme is GTP cyclohydrolase I (GTP-CH1). In some embodiments, the GTP-CH1 produces the cofactor (6R)-5, 6,7,8- tetrahydrobiopterin (BH4) that is required for conversion of phenylalanine to tyrosine. In some embodiments, expression of GTP-CH1 facilitates growth of the host cell in conjunction with functional PAH upon application of the single selective pressure.
[0386] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 181-182, 272-274, or 280-305. In some embodiments, the selectable marker and helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 306-314.75MOFO-359992482324632001140
[0387] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 182, 181, 250, or 334. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 182 or SEQ ID NO: 334. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 181 or SEQ ID NO: 250.
[0388] In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOS: 173-178. In certain embodiments, the polynucleotide comprising a sequence encoding VA-RNA has sequence of SEQ ID NOS: 173-178. In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 173 or 176. In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA comprises the sequence set forth in SEQ ID NO: 173 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence set forth in SEQ ID NO: 173. In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA comprises the sequence set forth in SEQ ID NO: 176 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence set forth in SEQ ID NO: 176.
[0389] In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 177-178.D. Polynucleotides Encoding Payload
[0390] Also provided herein, in some embodiments, is a polynucleotide comprising a payload expression cassette flanked by AAV ITR sequences. Also provided, in some embodiments, is a polynucleotide comprising a payload expression cassette comprising a promoter operably linked to a nucleotide sequence encoding a pay load. Also provided, in some embodiments, is a polynucleotide comprising a payload expression cassette comprising a constitutive promoter operably linked to a nucleotide sequence encoding a payload. In some embodiments, the polynucleotide comprises a payload expression cassette flanked by AAV ITR sequences, wherein the payload expression cassette comprises a fifth constitutive promoter operably linked to a nucleotide sequence encoding a payload.
[0391] The payload can be any payload of interest. In some embodiments, a polynucleotide encoding a payload comprises a reporter gene, a therapeutic gene, or a transgene encoding a protein of interest. In certain embodiments, the payload of the polynucleotide is progranulin. In certain embodiments, the sequence encoding progranulin is provided as an exemplary sequence encoding a payload. In some such embodiments, it is understood that the sequence for any desired pay load can be substituted in place of the sequence encoding progranulin in any of the polynucleotides encoding a payload described herein.76MOFO-359992482324632001140In some embodiments, the polynucleotide encoding adenoviral helper genes comprises the polynucleotide encoding a payload as described herein.
[0392] In some embodiments, the sequence encoding the pay load of the polynucleotide comprises a sequence encoding a reporter gene, a therapeutic gene, or a transgene encoding a protein of interest. In some embodiments, the sequence encoding the pay load of the fourth polynucleotide is a sequence encoding progranulin. In some embodiments, the sequence encoding the payload comprises the nucleotide sequence of SEQ ID NO: 226 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the payload expression cassette comprises the nucleotide sequence of SEQ ID NO: 240, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the payload expression cassette comprises the nucleotide sequence of SEQ ID NO: 252, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the payload expression cassette comprises a sequence having at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 252, wherein the sequence encoding progranulin (SEQ ID NO: 226) is substituted or replaced with a different sequence encoding a payload (e.g., any payload as described herein).
[0393] In some embodiments, the payload expression cassette further comprises a sequence encoding a ribozyme that is cN-acting to the sequence encoding a payload. In certain instances, the ribozyme catalyzes a reaction on the mRNA encoding they payload to lead to degradation and / or silencing the payload. In some instances, the encoded ribozyme is a Hammerhead ribozyme. In various embodiments, the sequence encoding a ribozyme has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 183 or SEQ ID NO: 139. In some embodiments, the sequence encoding a ribozyme is flanked by recombination sites to allow for inducible excision of the sequence encoding a ribozyme.
[0394] In some embodiments, the sequence encoding the payload comprises a sequence encoding a suppressor tRNA, a guide RNA, or a homology region for homology-directed repair.
[0395] In some embodiments, the polynucleotide comprising the sequence encoding the pay load comprises the sequence encoding the pay load flanked by a 5' AAV inverted terminal repeat (5' ITR) and a 3' AAV inverted terminal repeat (3' ITR).
[0396] In some embodiments, the sequence encoding the payload is flanked by a 5' AAV inverted terminal repeat (5' ITR) and a 3' AAV inverted terminal repeat (3' ITR) has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 252. In certain embodiments, the sequence encoding the payload is flanked by a 5' AAV inverted terminal repeat (5' ITR) and a 3' AAV inverted terminal repeat (3' ITR) has sequence of SEQ ID NO: 252.
[0397] In some embodiments, the polynucleotide sequence encoding the pay load is in a self- complementary format. In some embodiments, the polynucleotide comprising the sequence encoding the77MOFO-359992482324632001140 payload has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 130. In certain embodiments, the polynucleotide comprising the sequence encoding the payload has sequence of SEQ ID NO: 130.
[0398] In some embodiments, the polynucleotide comprising the sequence encoding the pay load is a plasmid sequence that comprises the sequence if SEQ ID NO: 130 and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 131. In certain embodiments, the polynucleotide comprising the sequence encoding the payload has sequence of SEQ ID NO: 131.
[0399] In some embodiments, the polynucleotide sequence encoding the pay load is in a singlestranded format. In some embodiments, the polynucleotide comprising the sequence encoding the payload has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 132. In certain embodiments, the polynucleotide comprising the sequence encoding the payload has sequence of SEQ ID NO: 132.
[0400] In some embodiments, the polynucleotide comprising the sequence encoding the pay load is a plasmid sequence that comprises the sequence of SEQ ID NO: 132 and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 133. In certain embodiments, the polynucleotide comprising the sequence encoding the payload has sequence of SEQ ID NO: 133.
[0401] In some embodiments, the polynucleotide sequence encoding the payload comprises a sequence having at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to one or more of SEQ ID NOS: 130-133, wherein the payload sequence encoding progranulin (SEQ ID NO: 226) is substituted or replaced with a different sequence encoding a payload (e.g., any payload as described herein).
[0402] In some instances, the payload is also referred to as an expressible payload. In some embodiments, the polynucleotide comprises a coding sequence for an expressible payload and a mammalian cell selection element. In an exemplary embodiment, the expressible payload is under the control of a constitutive promoter. This construct can be referred to as a payload construct.
[0403] In some embodiments, the expressible payload encodes a guide RNA. In certain embodiments, the guide RNA directs RNA editing. In some embodiments, the guide RNA directs Cas- mediated DNA editing. In some embodiments, the guide RNA directs ADAR-mediated RNA editing. In some embodiments, the fourth integrated synthetic construct comprises a sequence encoding for any of the expressible payloads disclosed herein. For example, said sequence can encode for any therapeutic. For example, the therapeutic may be a transgene, a guide RNA, an antisense RNA, an oligonucleotide, an mRNA, a miRNA, a shRNA, a tRNA suppressor, a CRISPR-Cas protein, any gene editing enzyme, or any combination thereof. In some embodiments, the transgene encodes for progranulin. In some embodiments, the tRNA suppressor is capable of suppressing an opal stop codon. In some embodiments, the tRNA suppressor is capable of suppressing an ochre stop codon. In some embodiments, the tRNA suppressor is78MOFO-359992482324632001140 capable of suppressing an amber stop codon. In some embodiments, the fourth integrated synthetic construct comprises sequences encoding for more than one of the expressible payloads disclosed herein. For example, the fourth integrated synthetic construct comprises 2 gRNA, 3 gRNA, 4 gRNA, 5 gRNA, 6 gRNA, 7 gRNA, 8 gRNA, 9 gRNA, or 10 gRNA. These gRNAs can all be the same, all be different, or any combination of the same and different. For example, the fourth integrated synthetic construct comprises 2 suppressor tRNAs, 3 suppressor tRNAs, 4 suppressor tRNAs, 5 suppressor tRNAs, 6 suppressor tRNAs, 7 suppressor tRNAs, 8 suppressor tRNAs, 9 suppressor tRNAs, or 10 suppressor tRNAs. These suppressor tRNAs can all be the same, all be different, or any combination of the same and different.
[0404] In some embodiments, the expressible payload encodes a protein. In certain embodiments, the expressible payload is an enzyme, useful for replacement gene therapy. In some embodiments, the protein is a therapeutic antibody. In some embodiments, the protein is a vaccine immunogen. In particular embodiments, the vaccine immunogen is a viral protein.
[0405] In some embodiments, the expressible payload is a homology construct for homologous recombination.
[0406] In various embodiments, the third mammalian cell selection element is an auxotrophic selection element.
[0407] In some embodiments, the payload construct comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 315 or SEQ ID NO: 317. In some embodiments, the payload construct comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 315 or SEQ ID NO: 317, wherein SEQ ID NO: 316 in SEQ ID NO: 315 or SEQ ID NO: 317 is replaced with a sequence of the payload of interest. In some embodiments, the payload construct comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to one or more of SEQ ID NOS: 130-133 or 252. In some embodiments, a plasmid comprising the payload construct has at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 131 or SEQ ID NO: 133.
[0408] In some embodiments, the pay load construct comprises a sequence of a pay load flanked by AAV ITR sequences. In some embodiments, expression of the sequence of the payload is driven by a constitutive promoter or an inducible promoter. In some embodiments, the constitutive promoter is an RSV promoter. In some embodiments, the RSV promoter comprises a nucleotide sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 138 or SEQ ID NO: 247. In some embodiments, the promoter and sequence of the payload are flanked by AAV ITR sequences. In some embodiments, the payload construct flanked by ITRs comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 252.
[0409] In some embodiments, the sequence of the payload comprises a polynucleotide sequence coding for a gene. In some embodiments, the gene codes for a selectable marker or detectable marker. In some embodiments, the gene codes for a therapeutic polypeptide or transgene. In some embodiments, the therapeutic polypeptide or transgene is progranulin. In some embodiments, the sequence of the payload79MOFO-359992482324632001140 comprises a polynucleotide sequence coding for a therapeutic polynucleotide. In some embodiments, the therapeutic polynucleotide is a tRNA suppressor or a guide RNA. In some embodiments, the tRNA suppressor is capable of suppressing an opal stop codon. In some embodiments, the tRNA suppressor is capable of suppressing an ochre stop codon. In some embodiments, the tRNA suppressor is capable of suppressing an amber stop codon. In some embodiments, the guide RNA is a polyribonucleotide capable of binding to a protein. In some embodiments, the protein is nuclease. In some embodiments, the protein is a Cas protein, an ADAR protein, or an ADAT protein. In some embodiments, the guide RNA, when bound to a target RNA, recruits an ADAR protein for editing of the target RNA. In some embodiments, the Cas protein is catalytically inactive Cas protein. In some embodiments, the payload construct is stably integrated into the genome of the cell. In some embodiments, a plurality of the payload construct are stably integrated into the genome of the cell. In some embodiments, the plurality of the payload constructs are separately stably integrated into the genome of the cell.
[0410] In some embodiments, the third polynucleotide further comprises a third selection cassette, where in the third selection cassette comprises a sixth constitutive promoter operably linked to a sequence encoding a third selectable marker. In some embodiments, the third selectable marker is an antibiotic resistance gene. In some embodiments, the third selectable marker comprises a second part of an antibiotic resistance gene. In some embodiments, the third selectable marker comprises a second part of a split blasticidin resistance gene.
[0411] In some embodiments, the third polynucleotide comprises a second part of a split antibiotic resistance gene, and the first polynucleotide comprising an expression cassette for expressing Cap and / or Rep proteins comprises the first part of the split antibiotic resistance gene. As such, a cell that includes both the first polynucleotide and the second polynucleotide is capable of containing both parts of the split antibiotic resistance gene, e.g., a blasticidin resistance gene.
[0412] In some embodiments, the third selectable marker comprises the nucleotide sequence of SEQ ID NO: 250 or SEQ ID NO: 181, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
[0413] In some embodiments, the third selectable marker comprises the nucleotide sequence of SEQ ID NO: 334 or SEQ ID NO: 182, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
[0414] In some embodiments, the selection cassette comprises a 3’ UTR downstream of the selectable marker. In some embodiments, the 3’ UTR comprises the nucleotide sequence of SEQ ID NO: 325, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 325.
[0415] In some embodiments, the selection cassette comprises a polyA sequence downstream of the selectable marker. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 328, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 328.80MOFO-359992482324632001140
[0416] In some embodiments, the sixth constitutive promoter is an EFla promoter. In some embodiments, the sixth constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 351 or 251, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the EFla promoter has a TATA box mutation. In some embodiments, the sixth constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 350, 185 or SEQ ID NO: 224, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the third selection cassette comprises the nucleotide sequence of SEQ ID NO: 241, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the third polynucleotide comprises the sequence of any one of SEQ ID NOs: 232, 330 and 130, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
[0417] In some embodiments, the third polynucleotide is a payload construct. In some embodiments, the payload construct comprises the nucleotide sequence of SEQ ID NO: 330. In some embodiments, the payload construct comprises a payload cassette comprising the nucleotide sequence of SEQ ID NO: 252 and a selection cassette comprising the nucleotide sequence SEQ ID NO: 241. In some embodiments, the payload construct further comprises transposon-specific ITR sequences for genome integration of the polynucleotide by a transposase. In some embodiments, the payload construct comprises the nucleotide sequence of SEQ ID NO: 130.
[0418] In some embodiments, the pay load construct further comprises a sequence coding for a selectable marker or detectable marker outside of the AAV ITR sequences. In some embodiments, expression of the selectable marker or detectable marker outside of the ITR sequences is driven by a promoter. The promoter can be a constitutive promoter or an inducible promoter. In some embodiments, the constitutive promoter is EFla (or EFl alpha) promoter or human cytomegalovirus promoter. In some embodiments, the inducible promoter is a tetracycline-inducible promoter, an ecdysone-inducible promoter, or a cumate-inducible promoter. In some embodiments, the selectable marker is a mammalian cell selection element (e.g., a third mammalian cell selection element). In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR). In some embodiments, PAH comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 272. In some embodiments, GS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 273. In some embodiments, TYMS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 274. In some embodiments, the auxotrophic selection element codes for an inactive protein that requires expression of a second auxotrophic selection element for activity. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the81MOFO-359992482324632001140 auxotrophic protein Z-Cter and the second auxotrophic selection element codes for N-terminal fragment of an auxotrophic protein Z-Nter, or vice a versa. In some embodiments, the auxotrophic selection element codes for DHFR Z-Cter or DHFR Z-Nter. In some embodiments, the selectable marker is DHFR Z-Nter or DHFR Z-Cter. In some embodiments, the DHFR Z-Nter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 275. In some embodiments, the DHFR Z-Cter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 276. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein and the second auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein and the second auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for C-terminal fragment of PAH, GS, TYMS, or DHFR fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of PAH, GS, TYMS, or DHFR fused to a N-terminal intein of a split intein. In some embodiments, the selectable marker is an antibiotic resistance protein. In some embodiments, the selectable marker is a split intein linked to an N-terminus of the antibiotic resistance protein or split intein linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the selectable marker is a leucine zipper linked to an N-terminus of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the antibiotic resistance protein is for puromycin resistance or blasticidin resistance. In some embodiments, the split intein is derived from the Nostoc punctiforme (Npu) DnaE intein, the Synechocystis species, strain PCC6803 (Ssp) DnaE intein, or the consensus DnaE intein (Cfa). In some embodiments, an N-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 277. In some embodiments, a C-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 278.
[0419] In some embodiments, the payload construct further comprises a sequence coding for a selectable marker and a helper enzyme, wherein expression of the helper enzyme facilitates growth of the cell in conjunction with the selectable marker. In certain embodiments, the helper enzyme is an enzyme that facilitates production of a molecule required for cell growth. For example, the helper enzyme may be required for production of a cofactor utilized by the functional enzyme to generate the molecule required for cell growth. In certain embodiments, the cell may produce the helper enzyme at low levels and the expression of the helper enzyme from the helper construct can increase helper enzyme levels thereby increasing production of the molecule required for cell growth, by, e.g., increasing levels of a co-factor required for enzyme activity. In some embodiments, the payload construct further encodes a helper enzyme involved in production of tyrosine from phenylalanine. In some embodiments, the helper enzyme facilitates PAH-mediated production of tyrosine from phenylalanine. In some embodiments, the helper enzyme82MOFO-359992482324632001140 catalyzes production a co-factor required by PAH for converting phenylalanine to tyrosine. In some embodiments, the helper enzyme is GTP cyclohydrolase I (GTP-CH1). In some embodiments, the helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 279. In some embodiments, the GTP-CH1 produces the cofactor (6R)-5,6,7,8-tetrahydrobiopterin (BH4) that is required for conversion of phenylalanine to tyrosine. In some embodiments, expression of GTP- CH1 facilitates growth of the host cell in conjunction with functional PAH upon application of the single selective pressure.
[0420] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 181-182, 272-274, or 280-305. In some embodiments, the selectable marker and helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 306-314.
[0421] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 182,181, 250, and 334 . In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 182 or SEQ ID NO: 334. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 181 or SEQ ID NO: 250.
[0422] In some embodiments, the selectable marker is outside of the ITR sequences on the payload construct. In some embodiments, the selectable marker outside of the ITR sequences is a split intein linked to an N-terminus of the auxotrophic protein or split intein linked to a C-terminus of the auxotrophic protein. In some embodiments, the selectable marker outside of the ITR sequences is a leucine zipper linked to an N-terminus of the auxotrophic or leucine zipper linked to a C-terminus of the auxotrophic. In some embodiments, the selectable marker outside of the ITR sequences is a split intein linked to an N-terminus of the antibiotic resistance protein or split intein linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the selectable marker outside of the ITR sequences is a leucine zipper linked to an N-terminus of the antibiotic resistance protein or leucine zipper linked to a C- terminus of the antibiotic resistance protein. In some embodiments, the antibiotic resistance protein is for puromycin resistance or blasticidin resistance. In some embodiments, the payload construct further comprises a spacer between the 5’ ITR and the promoter / selectable marker or promoter / detectable marker outside of the ITR sequences. In some embodiments, the payload construct further comprises a spacer between the 3’ ITR and the promoter / selectable marker or promoter / detectable marker outside of the ITR sequences. In some embodiments, the spacer ranges in length from 500 base pairs to 5000 base pairs, including any length within this range such as 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1250, 1500, 1750, 2000, 2225, 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4750, or 5000 base pairs. In some embodiments, the spacer length is a sufficient length for decreasing reverse packaging of the selectable marker or detectable marker that is outside the ITR sequences.83MOFO-359992482324632001140
[0423] In some embodiments, the polynucleotide comprising a sequence encoding a payload is further engineered to remove locations having the potential for Rep-mediated nicking. For example, a location having the potential for Rep-mediated nicking is a location having the sequence CAGTGAGCGAGCGAGCGCGCAG (SEQ ID NO: 318); a sequence comprising GAGC (SEQ ID NO: 319) repeats; or the sequence GATGGAGTTGGCCACTCCCTC (SEQ ID NO: 320). These sequences can be engineered to prevent binding of Rep proteins for Rep-mediated nicking. In some embodiments, the location having the potential for Rep-mediated nicking that is engineered to prevent binding of Rep proteins for Rep-mediated nicking is in a region within 100 nucleotides of an ITR sequence. In some embodiments, the location having the potential for Rep-mediated nicking that is engineered to prevent binding of Rep proteins for Rep-mediated nicking is in a region within 200 nucleotides of an ITR sequence. In some embodiments, the location having the potential for Rep-mediated nicking that is engineered to prevent binding of Rep proteins for Rep-mediated nicking is in a region within 300 nucleotides of an ITR sequence. In some embodiments, the location having the potential for Rep-mediated nicking that is engineered to prevent binding of Rep proteins for Rep-mediated nicking is in a region within 400 nucleotides of an ITR sequence. In some embodiments, the location having the potential for Rep-mediated nicking that is engineered to prevent binding of Rep proteins for Rep-mediated nicking is in a region within 500 nucleotides of an ITR sequence. In some embodiments, the location having the potential for Rep-mediated nicking that is engineered to prevent binding of Rep proteins for Rep-mediated nicking is in a region within 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1250, 1500, 1750, 2000, 2225, 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4750, or 5000 nucleotides of an ITR sequence.
[0424] In some embodiments, a pay load construct comprising a sequence encoding a pay load has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 232. In certain embodiments, the payload construct has sequence of SEQ ID NO: 232.
[0425] An exemplary construct used to deliver a payload flanked by AAV ITRs and a selection cassette to select cells with integrated payload construct(s) is shown in Table E7.1. Pay loads
[0426] Disclosed herein are payloads that may be encoded for by polynucleotide comprising a sequence which encodes for a payload. As such, in some embodiments, the payload is any payload comprised in any polynucleotide comprising a payload expression cassette comprising a constitutive promoter operably linked to a nucleotide sequence encoding the payload, as described herein. Thus, disclosed herein are stable mammalian cell lines that encapsidate a payload. In some embodiments, the payload may be an expressible payload. In some embodiments, the polynucleotide may encode for any therapeutic. For example, the therapeutic may be a transgene, a guide RNA, an antisense RNA, an oligonucleotide, an mRNA, a miRNA, a shRNA, a tRNA suppressor, a CRISPR-Cas protein, any gene editing enzyme, or any combination thereof. In some embodiments, the payload is a guide RNA, wherein84MOFO-359992482324632001140 the guide RNA, when bound to a target RNA, recruits an ADAR enzyme for editing of the target RNA. In some embodiments, the payload is progranulin. In some embodiments, the stable mammalian cell lines disclosed herein can conditionally produce rAAV virions that encapsidate more than one payload. Any combination of payloads disclosed herein is contemplated.
[0427] The sequence encoding a payload as disclosed herein encompasses any nucleotide sequence that is to be delivered to a cell. The nucleotide sequence may be utilized in the cell for, e.g., insertion of the nucleotide sequence or a part thereof. For example, the nucleotide sequence may be used to repair an endogenous DNA. In such a case, the nucleotide sequence itself is the payload being delivered by the rAAV to a cell.
[0428] In other cases, the polynucleotide payload is transcribed in the cell into an RNA which is not translated into a protein. In such a case, the RNA is the payload that is delivered by the polynucleotide payload present in the rAAV. In other cases, the polynucleotide payload is transcribed in the cell into an mRNA which is translated into a protein. In such a case, the protein is the payload that is delivered by the polynucleotide payload present in the rAAV.
[0429] The polynucleotide payload may include a promoter operably linked to a DNA sequence. The promoter may be any promoter that allows for transcription of the DNA in the cell. A payload disclosed herein may be a therapeutic payload.
[0430] In some embodiments, the payload expression cassette comprises a fifth constitutive promoter operably linked to a nucleotide sequence encoding a pay load. In some embodiments, the fifth constitutive promoter is an RSV promoter. In some embodiments, the RSV promoter comprises the nucleotide sequence of SEQ ID NO: 193, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
[0431] The DNA sequence may be transcribed to produce RNA in the cell. The RNA may be mRNA. The RNA may be a guide RNA (gRNA), a tRNA, a suppressor tRNA, an mRNA, or a circular RNA. The RNA may be a regulatory RNA of interest such as, but not limited to, a microRNA (miRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a small nuclear RNA (snRNA), a long non-coding RNA (IncRNA), an antisense nucleic acid, and the like.
[0432] The polynucleotide payload may be a gene encoding a polypeptide, such as, an antibody, a hormone, a site-specific endonuclease, a reporter gene, a component of a CRISPR / Cas system, an adenosine deaminase acting on RNA (ADAR) enzyme, a transcriptional activator, a transcriptional repressor, a ribozyme, a DNAzyme, or any combination thereof.
[0433] A payload may include any one or combination of the following: a transgene, a tRNA suppressor, a guide RNA, or any other target binding / modifying oligonucleotide or derivative thereof, or payloads may include immunogens for vaccines, and elements for any gene editing machinery (DNA or RNA editing). Payloads may also include those that deliver a transgene encoding antibody chains or fragments that are amenable to viral vector-mediated expression (also referred to as “vectored or vectorized antibody” for gene delivery). See, e.g., Curr Opinion HIV AIDS. 2015 May; 10(3): 190-197, describing85MOFO-359992482324632001140 vectored antibody gene delivery for the prevention or treatment of HIV infection. See also, U.S. Pat. No. 10,780,182, which describes AAV delivery of trastuzumab (Herceptin) for treatment of HER2+ brain metastases. A payload disclosed herein may not be a therapeutic payload (e.g., a coding for a detectable marker such as GFP). In particular, in some instances the polynucleotide pay load refers to a polynucleotide that may be a homology element for homology-directed repair, or polynucleotide transcribed into a guide RNA to be delivered for a variety of purposes. In some embodiments, the transgene refers to a nucleic acid sequence coding for expression of guide RNA for ADAR editing or AD AT editing. In some embodiments, the transgene refers to a transgene packaged for gene therapy. In some embodiments, the transgene refers to synthetic constructs packaged for vaccines. In certain aspects, a polynucleotide payload may be described as encoding an RNA, which is meant to refer to the RNA transcribed from the polynucleotide.
[0434] In certain examples, the sequence encoding the payload comprises two expressible sequences, wherein a first expressible sequence encodes for a first gRNA and a second expressible sequence encodes for a second gRNA. In some embodiments, the first gRNA and the second gRNA are different. In some embodiments, the first gRNA and the second gRNA are the same. In certain examples, the sequence encoding the payload comprises two or more expressible sequences. In some embodiments, the two or more expressible sequences encode for two or more gRNA. In some embodiments, the two or more gRNA are all different gRNA, all the same gRNA, or a combination of the same and different gRNA.
[0435] In some cases, the sequence encoding the payload comprises an expressible sequence encoding both a heterologous RNA and a heterologous polypeptide. In other cases, the expressible sequence encodes two or more heterologous payloads. Where the expressible sequence encodes two heterologous pay loads, in some cases, the nucleotide sequences encoding the two heterologous pay loads are operably linked to the same promoter. Where the expressible sequence encodes two heterologous payloads, in some cases, the nucleotide sequences encoding the two heterologous payloads are operably linked to two different promoters. In some cases, sequence encoding the payload comprises an expressible sequence encoding three heterologous payloads. Where the expressible sequence encodes three heterologous payloads, in some cases, the nucleotide sequences encoding the three heterologous payloads are operably linked to the same promoter. Where the expressible sequence encodes three heterologous pay loads, in some cases, the nucleotide sequences encoding the three heterologous payloads are operably linked to two or three different promoters. In some cases, the fourth polynucleotide construct of the present disclosure comprises two or more expressible sequences, each comprising a nucleotide sequence encoding a heterologous payload.
[0436] In some embodiments, the expressible sequence encodes a polypeptide of interest. The polypeptide of interest may be any type of protein / peptide including, without limitation, an enzyme, an extracellular matrix protein, a receptor, transporter, ion channel, or other membrane protein, a hormone, a neuropeptide, an antibody, or a cytoskeletal protein; or a fragment thereof, or a biologically active domain of interest. In some cases, the payload is a therapeutic polypeptide, e.g., a polypeptide that provides clinical benefit.86MOFO-359992482324632001140
[0437] Where the pay load is an interfering RNA (RNAi), suitable RNAi include RNAi that decrease the level of an apoptotic or angiogenic factor in a cell. For example, an RNAi may be an shRNA or siRNA that reduces the level of a payload that induces or promotes apoptosis in a cell. A payload may be a gene whose gene product induces or promotes apoptosis are referred to herein as “pro-apoptotic genes” and the products of those genes (mRNA; protein) are referred to as “pro-apoptotic gene products.” Pro- apoptotic gene products include, e.g., Bax, Bid, Bak, and Bad gene products. See, e.g., U.S. Patent No. 7,846,730. In another example, the RNAi specifically reduces the level of an RNA and / or a polypeptide product of a defective allele.
[0438] In some embodiments, the payload is an aptamer. In some cases, the aptamer is a therapeutic aptamer. For example, the aptamer may function as an antagonist by blocking interactions at a disease-associated target (e.g., receptor-ligand interactions). Alternatively, an aptamer may serve as an agonist for activating the function of a target receptor. Exemplary aptamers of interest include aptamers against growth factor receptors and growth factors such as aptamers that bind to epidermal growth factor receptor (see, e.g., Wang et al. (2014) Biochem. Biophys. Res. Commun. 453(4):681-5), transforming growth factor-beta type III receptor (see, e.g., Ohuchi et al. (2006) Biochimie 88(7):897-904.), vascular endothelial growth factor (VEGF) (see, e.g., Ng et al. (2006) Nat. Rev. Drug Discovery 5:123; and Lee et al. (2005) Proc. Natl. Acad. Sci. USA 102:18902) or platelet-derived growth factor (PDGF), e.g., E10030 (see, e.g., Ni and Hui (2009) Ophthalmologica 223:401; and Akiyama et al. (2006) J. Cell Physiol. 207:407).
[0439] In some embodiments, the expressible sequence encodes a sequence-specific endonuclease for use in genome editing. The sequence specific endonuclease may be used to create a double-stranded break at a specific site in the genome. The double stranded breaks may then be repaired by non-homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), or homology- directed repair (HDR) pathways. Desired genome edits may be introduced into the genome using donor DNA to repair double-strand breaks by homologous recombination. Various sequence-specific endonucleases may be used in genome editing for creation of double-strand breaks in DNA, including, without limitation, engineered zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, and clustered regularly interspaced short palindromic repeats (CRISPR) Cas9. See, e.g., Targeted Genome Editing Using Site-Specific Nucleases: ZFNs, TALENs, and the CRISPR / Cas9 System (T. Yamamoto ed., Springer, 2015); Genome Editing: The Next Step in Gene Therapy (Advances in Experimental Medicine and Biology, T. Cathomen, M. Hirsch, and M. Porteus eds., Springer, 2016); Aachen Press Genome Editing (CreateSpace Independent Publishing Platform, 2015); herein incorporated by reference. Precise control over the timing of production of the genome editing enzyme may be achieved by inducibly producing recombinant adenovirus associated virus (rAAV) virions with the vector system to allow turning on and off of expression as desired.
[0440] In some cases, a payload of interest is a site-specific endonuclease that provides for sitespecific knock-down of gene function, e.g., where the endonuclease knocks out an allele associated with a87MOFO-359992482324632001140 disease. For example, in a case where a dominant allele encodes a defective copy of a gene, and the wildtype gene provides for normal function, a site-specific endonuclease may be targeted to the defective allele and knock out the defective allele. In some cases, a site-specific endonuclease is an RNA-guided endonuclease.
[0441] A site-specific nuclease may also be used to stimulate homologous recombination with a donor DNA that encodes a functional copy of the protein encoded by the defective allele. Thus, e.g., a subject rAAV virion may be used to deliver a site-specific endonuclease that knocks out a defective allele and also be used to deliver a functional copy of the defective allele, resulting in repair of the defective allele, thereby providing for production of a functional gene product.
[0442] In some cases, the payload is an RNA-guided endonuclease. In some cases, the payload is an RNA comprising a nucleotide sequence encoding an RNA-guided endonuclease. In some cases, the payload is a guide RNA, e.g., a single-guide RNA. In some cases, the payloads are: 1) a guide RNA; and 2) an RNA-guided endonuclease. The guide RNA may comprise: a) a protein-binding region that binds to the RNA-guided endonuclease; and b) a region that binds to a target nucleic acid. An RNA-guided endonuclease is also referred to herein as a “genome editing nuclease.”
[0443] Examples of RNA-guided endonucleases are CRISPR / Cas endonucleases (e.g., class 2 CRISPR / Cas endonucleases such as a type II, type V, or type VI CRISPR / Cas endonucleases). A suitable genome editing nuclease is a CRISPR / Cas endonuclease (e.g., a class 2 CRISPR / Cas endonuclease such as a type II, type V, or type VI CRISPR / Cas endonuclease). In some cases, a suitable RNA-guided endonuclease is a class 2 CRISPR / Cas endonuclease. In some cases, a suitable RNA-guided endonuclease is a class 2 type II CRISPR / Cas endonuclease (e.g., a Cas9 protein). In some cases, a genome targeting composition includes a class 2 type V CRISPR / Cas endonuclease (e.g., a Cpfl protein, a C2cl protein, or a C2c3 protein). In some cases, a suitable RNA-...
Claims
1. 324632001140CLAIMSWhat is claimed is:
1. A polynucleotide comprising an adeno-associated virus (AAV) Rep expression cassette that comprises from 5’ to 3’ : a first promoter, a Rep open reading frame, a first excisable element comprising a sequence encoding a ribozyme flanked by a first recombination site and a second recombination site, and a polyadenylation (poly A) signal sequence, wherein the ribozyme mediates degradation of an RNA encoding the ribozyme.
2. The polynucleotide of claim 1 , wherein the sequence encoding the ribozyme in the first excisable element is excised following a recombination event between the first recombination site and the second recombination site.
3. A polynucleotide comprising: a first promoter operably linked to a large Rep coding sequence, the large Rep coding sequence comprising: an intron comprising a second promoter operably linked to a small Rep coding sequence; and the small Rep coding sequence, a sequence encoding a ribozyme downstream of the large Rep coding sequence, and a polyadenylation (Poly A) signal sequence downstream of the sequence encoding the ribozyme, wherein the ribozyme mediates degradation of an RNA encoding the ribozyme.
4. The polynucleotide of claim 3, wherein the sequence encoding the ribozyme is located upstream or downstream of the small Rep coding sequence.
5. The polynucleotide of claim 3 or claim 4, wherein the large Rep coding sequence and the small Rep coding sequence overlap within a Rep open reading frame.
6. The polynucleotide of any one of claims 1-5, wherein the ribozyme is a self-cleaving ribozyme.
7. The polynucleotide of any one of claims 1-6, wherein the ribozyme is a Hammerhead ribozyme.241MOFO-3599924823246320011408. The polynucleotide of any one of claims 1-7, wherein the ribozyme is selected from: a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, and a RAGATH-1 -hammerhead.
9. The polynucleotide of any one of claims 1-8, wherein the sequence encoding the ribozyme comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 183 or SEQ ID NO: 139.
10. The polynucleotide of any one of claims 1-9, wherein the sequence encoding the ribozyme comprises SEQ ID NO: 183 or SEQ ID NO: 139.
11. The polynucleotide of claim 1, claim 2, or claim 5, wherein the Rep open reading frame comprises a large Rep coding sequence operably linked to the first promoter, and wherein the large Rep coding sequence comprises a small Rep coding sequence.
12. The polynucleotide of claim 11, wherein the large Rep coding sequence encodes one or more large Rep proteins and the small Rep coding sequence encodes one or more small Rep proteins.
13. The polynucleotide of claim 11 or claim 12, wherein the large Rep coding sequence further comprises a pl9 promoter upstream of the small Rep coding sequence.
14. The polynucleotide of claim 13, wherein the small Rep coding sequence is operably linked to the pl9 promoter.
15. The polynucleotide of claim 11, wherein: a) the one or more large Rep proteins comprises Rep78, and the one or more small Rep protein comprises Rep 52, or b) the one or more large Rep proteins comprises Rep78 and Rep68, and the one or more small Rep protein comprises Rep52 and Rep40.
16. The polynucleotide of any one of claims 1, 2, 5-15, where in the Rep open reading frame comprises from 5’ to 3’: a) the large Rep coding sequence, b) an intron comprising: i) a second promoter, and ii) a second excisable element that comprises a coding sequence comprising a stop signaling sequence flanked by a third recombination site and a fourth recombination site, and242MOFO-359992482324632001140 c) the small Rep coding sequence.
17. The polynucleotide of claim 16, wherein the intron is a synthetic intron comprising from 5’ to 3’: i) a 5’ splice donor site, ii) the second promoter iii) the second excisable element further comprising a first 3’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, and iv) a second 3’ splice acceptor site, wherein the splice donor and the first and second acceptor sites are compatible with a cell used for expressing a large Rep protein.
18. The polynucleotide of claim 16, wherein the second promoter is operably linked to the small Rep coding sequence following a recombination event between the third recombination site and the fourth recombination site.
19. The polynucleotide of any one of claims 1, 2, and 5-15, where in the Rep open reading frame comprises from 5’ to 3’: a) the large Rep coding sequence, b) the pl9 promoter, c) a first part of the small Rep coding sequence, d) an intron comprising a second excisable element that comprises a coding sequence comprising a stop signaling sequence flanked by a third recombination site and a fourth recombination site, and e) a second part of the small Rep coding sequence, wherein the first part and second part of the small Rep coding sequence form the small Rep coding sequence.
20. The polynucleotide of claim 19, wherein the intron is a synthetic intron comprising from 5’ to 3’: i) a 5’ splice donor site, ii) the second excisable element further comprising a first 3’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, and iii) a second 3’ splice acceptor site, wherein the splice donor and first and second acceptor sites are compatible with a cell used for expressing a large Rep protein.243MOFO-35999248232463200114021. The polynucleotide of any one of claims 17-20, wherein the first 3’ splice site and the coding sequence comprising a stop signaling sequence in the second excisable element are excised following a recombination event between the third recombination site and the fourth recombination site.
22. The polynucleotide of any one of claims 16-21 , wherein the first and second recombination sites and / or the third and fourth recombination sites comprise Lox sites or flippase recognition target (FRT) sites.
23. The polynucleotide of any one of claims 16-22, wherein the first and second recombination sites and / or the third and fourth recombination sites comprise Lox sites.
24. The polynucleotide of any of claims 16-23, wherein the coding sequence comprising a stop signaling sequence is a detectable marker, optionally wherein the detectable maker is luminescent marker, a radiolabel or a fluorescent marker.
25. The polynucleotide of claim 24, wherein the detectable maker comprises the nucleotide sequence of SEQ ID NO: 193, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
26. The polynucleotide of any one of claims 16-25, wherein the second excisable element comprises the nucleotide sequence of SEQ ID NO: 200 or SEQ ID NO: 219, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
27. The polynucleotide of any one of claims 2, 6-26, wherein the recombination event between the first recombination site and the second recombination site and / or the recombination event between the third recombination site and the fourth recombination site is induced in the presence of a recombinase.
28. The polynucleotide of claim 27, wherein the recombinase is an inducible recombinase.
29. The polynucleotide of any of claims 16-18 and 21-28, wherein the second promoter is heterologous to the small Rep coding sequence, and wherein the second promoter has higher promoter activity as compared to the first promoter.
30. The polynucleotide of any one of claims 1-29, wherein the first promoter is a p5 promoter.
31. The polynucleotide of any one of claims 1-30, wherein the first promoter is heterologous to the large Rep coding sequence.244MOFO-35999248232463200114032. The polynucleotide of any one of claims 16-18 and 21-31, wherein the large Rep coding sequence comprises a pl9 promoter operably linked to the small Rep coding sequence and the intron comprising the second promoter is located downstream of the pl9 promoter and upstream of the transcription start site of the small Rep coding sequence.
33. The polynucleotide of any of claims 13-18 and 21-32, wherein the pl9 promoter is mutated to substantially reduce promoter activity.
34. The polynucleotide of claim 33, wherein the pl9 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or is undetectable as compared to the native pl9 promoter activity.
35. The polynucleotide of any one of claims 1-16 and 21-34, wherein the polynucleotide lacks a functional p5 promoter.
36. The polynucleotide of claim 35, wherein the first promoter replaces the p5 promoter.
37. The polynucleotide of any one of claims 1-36, wherein the first promoter and / or second promoter is a constitutive promoter.
38. The polynucleotide of any one of claims 1-36, wherein the first promoter and / or second promoter is an inducible promoter.
39. The polynucleotide of any one of claims 16-18 and 21-38, wherein the first promoter and the second promoter are selected from the group consisting of: a ubiquitin C (UBC) promoter, a Rous sarcoma virus long terminal repeat (RSV) promoter, a chicken beta actin promoter, a cytomegalovirus (CMV) promoter, a CMV enhancer / chicken beta actin (CAG) promoter, or a phosphoglycerate kinase (PGK) promoter.
40. The polynucleotide of any one of claims 16-18 and 21-39, wherein the first promoter and the second promoter comprise a nucleotide sequence independently selected from any one of SEQ ID NOs: 17, 134-138, 186, 189, 190, 341, 342, 348, and 349 , or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing.
41. The polynucleotide of any one of claims 16-18 and 21-40, wherein (i) the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Rous sarcoma virus long terminal repeat (RSV)245MOFO-359992482324632001140 promoter; (ii) the first promoter is a chicken beta actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken beta actin (CAG) promoter and the second promoter is a RSV promoter; (iv) the first promoter is a chicken beta actin promoter and the second promoter is a RSV promoter; or (v) the first promoter is a UBC promoter and the second promoter is a CAG promoter.
42. The polynucleotide of any one of claims 16-18 and 21-41, wherein the first promoter is a UBC promoter, and the second promoter is a CAG promoter.
43. The polynucleotide of any one of claims 1-42, wherein the PolyA signal sequence is stronger than a native AAV Rep PolyA signal sequence.
44. The polynucleotide of claim 43, wherein the PolyA signal sequence is selected from: a bovine growth hormone (bGH) PolyA signal sequence, a human growth hormone (hGH) PolyA signal sequence, a Simian Virus 40 (SV40) PolyA signal sequence, a Chinese hamster growth hormone PolyA signal sequence, a human neurophilin-1 PolyA signal sequence, a nopaline synthase PolyA signal sequence, an alpha globulin PolyA signal sequence, and a rabbit globin PolyA signal sequence.
45. The polynucleotide of claim 43 or 44, wherein the polyA signal sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2-10, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing.
46. The polynucleotide of any of claims 43-45, wherein the polyadenylation signal sequence comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 2.
47. The polynucleotide of any one of claims 43-46, wherein the polyadenylation signal sequence comprises the nucleotide sequence of SEQ ID NO: 2.
48. The polynucleotide of any one of claims 43-47, further comprising an enhancer downstream of the PolyA signal sequence.
49. The polynucleotide of claim 48, wherein the enhancer is selected from a transcriptional enhancer, a translational enhancer, and a transcriptional and translational enhancer.
50. The polynucleotide of claim 48 or claim 49, wherein the enhancer comprises one or more sequences selected from SEQ ID NOs: 11-116 or 169-172.246MOFO-35999248232463200114051. The polynucleotide of any one of claims 48-50, wherein the enhancer comprises a human telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), or a CMV enhancer.
52. The polynucleotide of any one of claims 48-51, wherein the enhancer is a double enhancer.
53. The polynucleotide of claim 52, wherein the double enhancer comprises two of the following enhancers: a telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), or a CMV enhancer.
54. The polynucleotide of claim 52 or claim 53, wherein the double enhancer comprises two of a telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), or a CMV enhancer.
55. The polynucleotide of any one of claims 52-54, wherein the double enhancer comprises a Simian virus 40 (SV40) and a CMV enhancer.
56. The polynucleotide of any one of claims 52-55, wherein the double enhancer comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 172.
57. The polynucleotide of any one of claims 52-56, wherein the double enhancer comprises the nucleotide sequence of SEQ ID NO: 172.
58. The polynucleotide of any one of claims 48-52, wherein the enhancer is a triple enhancer.
59. The polynucleotide of claim 58, wherein the triple enhancer comprises a telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), or a CMV promoter / enhancer.
60. The polynucleotide of claim 58 or 59, wherein the triple enhancer comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 11.
61. The polynucleotide of any one of claims 58-60, wherein the triple enhancer comprises the nucleotide sequence of SEQ ID NO: 11.
62. The polynucleotide of any one of claims 1-61, wherein the sequence encoding the ribozyme is flanked by a first recombination site and a second recombination site, wherein the first recombination site and the second recombination site are oriented in the same direction and wherein247MOFO-359992482324632001140 recombination between the first and second recombination sites by an inducible recombinase results in excision of the sequence encoding the ribozyme.
63. The polynucleotide of any one of claims 1-62, further comprising an excisable element upstream of the small Rep coding sequence comprising a third recombination site and a fourth recombination site flanking a sequence comprising a stop codon, wherein the third recombination site and the fourth recombination site are oriented in the same direction and wherein recombination between the third and fourth recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon.
64. The polynucleotide of claim 63, wherein: the first and second recombination sites comprise LoxP sequences and the third and fourth recombination sites comprise LoxN sequences, or the first and second recombination sites comprise LoxN sequences and the third and fourth recombination sites comprise LoxP sequences.
65. The polynucleotide of any of claims 28-64, wherein the inducible recombinase comprises a Cre recombinase.
66. The polynucleotide of claim 65, wherein the inducible recombinase is a Cre-ERT2 fusion protein.
67. The polynucleotide of any one of claims 1-66, further comprising a sequence encoding a tag in frame with the large Rep coding sequence and the small Rep coding sequence, wherein large Rep proteins and small Rep proteins each are expressed as a fusion protein comprising the tag.
68. The polynucleotide of claim 67, wherein the tag is a purification tag and / or a detectable tag.
69. The polynucleotide of any one of claims 1-68, wherein the polynucleotide is configured to provide for an expression of the large Rep proteins and / or large Rep transcripts at a level that is lower than the expression level of the large Rep proteins and / or large Rep transcripts from a vector not having the first promoter and / or having a p5 promoter.
70. The polynucleotide of any one of claims 1-68, wherein the polynucleotide is configured to provide for an expression of the small Rep proteins and / or small Rep transcripts at a level that is higher than the expression of the small Rep proteins and / or small Rep transcripts from a vector not having the second promoter and / or having a pl9 promoter.248MOFO-35999248232463200114071. The polynucleotide of any one of claims 1-70, wherein the polynucleotide is configured to provide for an expression of the large Rep proteins and / or large Rep transcripts at a level that is lower than the expression level of the small Rep proteins and / or small Rep transcripts.
72. The polynucleotide of any one of claims 1-71, wherein a ratio of the expression level of the small Rep proteins and / or small Rep transcripts to the expression level of the large Rep proteins and / or large Rep transcripts ranges from 1.5:1 to 10,000:1, including 5:1; 6:1; 7:1; 8:1; 9:1; 10:1; 100:1; 1000:1; or 5000:1.
73. The polynucleotide of any one of claims 1-72, further comprising an AAV Cap coding sequence.
74. The polynucleotide of claim 73, wherein the AAV Cap coding sequence is operably linked to a native promoter.
75. The polynucleotide of claim 74, wherein the native promoter is a p40 promoter.
76. The polynucleotide of claim 73, wherein the AAV Cap coding sequence is operably linked to a heterologous promoter.
77. The polynucleotide of claim 76, wherein the heterologous promoter is an inducible promoter.
78. The polynucleotide of claim 73, wherein the Cap coding sequence is comprised in an AAV Cap expression cassette comprising a third promoter, wherein the Cap coding sequence is operably linked to the third promoter.
79. The polynucleotide of claim 78, wherein the third promoter is an inducible promoter.
80. The polynucleotide of any of claims 1-72, further comprising an AAV Cap expression cassette that comprises, from 5’ to 3’, an inducible promoter and an AAV Cap coding sequence.
81. The polynucleotide of claim 80, where in the AAV Cap expression cassette is in an opposite orientation relative to the AAV Rep expression cassette.249MOFO-35999248232463200114082. The polynucleotide of claim 81, wherein the AAV Cap expression cassette is oriented 3’ to 5’ and the AAV Rep expression cassette is oriented 5’ to 3’, or the AAV Cap expression cassette is oriented 5’ to 3’ and the AAV Rep expression cassette is oriented 3’ to 5’.
83. The polynucleotide of any one of claims 78-82, wherein the AAV Cap expression cassette is separated from the AAV Rep expression cassette by an intervening sequence.
84. The polynucleotide of claim 83, wherein the intervening sequence comprises a transcriptional blocking element (TBE).
85. The polynucleotide of claim 84, wherein the TBE element comprises the sequence of SEQ ID NO: 117 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
86. The polynucleotide of any of claims 80-85, wherein the inducible promoter comprises a tetracycline-responsive element (TRE).
87. The polynucleotide of claim 86, wherein the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter.
88. The polynucleotide of claim 87, wherein the tetO sequence concatamers comprises the sequence of SEQ ID NO: 228.
89. The polynucleotide of claim 87 or claim 88, wherein the minimal promoter is a human cytomegalovirus promoter.
90. The polynucleotide of claim 89, wherein the minimal promoter comprises the nucleotide sequence of SEQ ID NO: 229.
91. The polynucleotide of any one of claims 79-90, where in the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 184, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
92. The polynucleotide of any one of claims 79-91 , where in the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 184.
93. The polynucleotide of any of claims 80-92, wherein the inducible promoter is activated in the presence of a first triggering agent.250MOFO-35999248232463200114094. The polynucleotide of claim 93, wherein the first triggering agent is doxycycline.
95. The polynucleotide of any one of claims 79-94, wherein the AAV Cap expression cassette further comprises a polyA signal sequence downstream of the Cap coding sequence, wherein the polyA signal sequence is stronger than a native AAV Cap polyA signal sequence.
96. The polynucleotide of claim 95, wherein the polyA signal sequence comprises a SV40 polyA signal sequence.
97. The polynucleotide of claim 95 or claim 96, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 5, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
98. The polynucleotide of any one of claims 1-97, where in the Rep open reading frame is a sequence of a rep gene of an adeno-associated virus (AAV) selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68.
99. The polynucleotide of any one of claims 1-98, wherein the Rep open reading frame is from AAV2.
100. The polynucleotide of any one of claims 1-99, wherein the large Rep coding sequence comprises a Rep78 and / or Rep 68 coding sequence comprising the nucleotide sequence of SEQ ID NO: 187 or SEQ ID NO: 204, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
101. The polynucleotide of any one of claims 1-100, wherein the small Rep coding sequence comprises a Rep58 coding sequence comprising the nucleotide sequence of SEQ ID NO: 196, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.251MOFO-359992482324632001140102. The polynucleotide of claims 19-101, wherein the first part of the small Rep coding sequence comprises the nucleotide sequence of SEQ ID NO: 210 and the second part of the small Rep coding sequence comprises the nucleotide sequence of SEQ ID NO: 208.
103. The polynucleotide of any one of claims 1-102, wherein the small Rep coding sequence further comprises a Rep40 coding sequence comprising the nucleotide sequence of SEQ ID NO 209, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
104. The polynucleotide of any one of claims 1-18 and 20-101, wherein the AAV Rep expression cassette comprises the nucleotide sequence of SEQ ID NO: 201, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
105. The polynucleotide of any one of claims 73-104, where in the Cap coding sequence is a sequence of a cap gene of an adeno-associated virus (AAV) selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68.
106. The polynucleotide of any one of claims 73-105, wherein the Cap coding sequence is from AAV5, AAV9 or AAV2.
107. The polynucleotide of claim 106, wherein the Cap coding sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 199, 335, and 336, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing108. The polynucleotide of claim 106, wherein the AAV Cap expression cassette comprises the nucleotide sequence of any one of SEQ ID NOs: 202, 338, and 345, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
109. The polynucleotide of any one of claims 1-108, further comprising a sequence encoding a first selectable marker operably linked to a constitutive promoter.252MOFO-359992482324632001140110. The polynucleotide of any one of claims 1-109, further comprising a first selection cassette, wherein the first selection cassette comprises, from 5’ to 3’, a first constitutive promoter operably linked to a nucleotide sequence encoding a first selectable marker.
111. The polynucleotide of claim 110, wherein the first selection cassette is located downstream of the AAV Cap selection cassette and is in the same orientation as the AAV Cap selection cassette.
112. The polynucleotide of claim 111, wherein the first constitutive promoter is an EFla promoter.
113. The polynucleotide of claim 112, wherein the EFla promoter has a TATA box mutation.
114. The polynucleotide of claim 112 or 113, wherein the first constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 350, 185 or SEQ ID NO: 224, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
115. The polynucleotide of any of claims 110-114, wherein the first selectable marker is an antibiotic resistance gene.
116. The polynucleotide of claim 115, wherein the antibiotic resistance gene is selected from the group consisting of: a blasticidin resistance gene, a hygromycin resistance gene, a puromycin resistance gene, and an ampicillin resistance gene.
117. The polynucleotide of any of claims 110-116, wherein the first selectable marker is a split selectable marker comprising: a) a first part of a blasticidin resistance gene linked to an N-intein, or b) a C-intein linked to a second part of a blasticidin resistance gene.
118. The polynucleotide of claim 117, wherein the first selectable marker comprises the nucleotide sequence of SEQ ID NO: 334 or SEQ ID NO: 250 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
119. The polynucleotide of any of claims 110-118, wherein the first selection cassette comprises the nucleotide sequence of SEQ ID NO: 243, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.253MOFO-359992482324632001140120. A polynucleotide comprising an AAV Rep expression cassette, wherein the AAV Rep expression cassette comprises the nucleotide sequence of SEQ ID NO: 201 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
121. A polynucleotide comprising: i) an AAV Rep expression cassette comprising the nucleotide sequence of SEQ ID NO: 201 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, ii) an AAV Cap expression cassette comprising the nucleotide sequence of any one of SEQ ID NOs: 202, 338, and 345 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing, and iii) a selection cassette comprising the nucleotide sequence of SEQ ID NO: 243, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
122. A polynucleotide comprising the nucleotide sequence of any one of SEQ ID NOs: 329, 343, and 346, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
123. A polynucleotide comprising the nucleotide sequence of SEQ ID NO: 329.
124. A system of polynucleotides comprising: a) a first polynucleotide comprising the polynucleotide of any of claims 73-122; and b) a second polynucleotide comprising a first expression cassette, wherein the first expression cassette comprises a nucleotide sequence encoding one or more AAV helper proteins.
125. The system of polynucleotides of claim 124, wherein the first expression cassette further comprises an inducible promoter.
126. The system of polynucleotides of claim 124 or claim 125, wherein the first expression cassette comprises, from 5’ to 3’: a) an inducible promoter, b) a self-excising element that comprises a sequence encoding a recombinase that is flanked by a fifth recombination site and a sixth recombination site, and c) a nucleotide sequence encoding one or more helper proteins, wherein the recombinase is operably linked to the inducible promoter.254MOFO-359992482324632001140127. The system of polynucleotides of claim 125 or claim 126, wherein the inducible promoter comprises a tetracycline response element (TRE).
128. The system of polynucleotides of claim 127, wherein the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter.
129. The system of polynucleotides of claim 128, wherein the tetO sequence concatamers comprises the sequence of SEQ ID NO: 228.
130. The system of polynucleotides of claim 128 or claim 129, wherein the minimal promoter is a human cytomegalovirus promoter.
131. The system of polynucleotides of claim 130, wherein the minimal promoter comprises the nucleotide sequence of SEQ ID NO: 229.
132. The system of polynucleotides of any of claims 125-128, where in the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 184 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
133. The system of polynucleotides of any of claims 125-128, where in the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 184.
134. The system of polynucleotides of any of claims 125-133, where in the inducible promoter of the second polynucleotide is the same as the inducible promoter of the first polynucleotide.
135. The system of polynucleotides of any of claims 125-134, wherein the inducible promoter is activated in the presence of a first triggering agent.
136. The system of polynucleotides of claim 135, wherein the first triggering agent is doxycycline.
137. The system of polynucleotides of any of claims 126-136, wherein the sequence encoding the recombinase in the self-excising element is excised following a recombination event between the fifth recombination site and the sixth recombination site.255MOFO-359992482324632001140138. The system of polynucleotides of any one of claimsl26-137, wherein the inducible promoter is operably linked to the sequence encoding one or more AAV helper proteins following a recombination event between the fifth recombination site and the sixth recombination site.
139. The system of polynucleotides of any of claims 126-138, wherein the recombinase is a Cre recombinase or a flippase (FLP) recombinase.
140. The system of polynucleotides of claim 139, wherein the recombinase is a Cre recombinase.
141. The system of polynucleotides of any one of claims 126-140, wherein the fifth recombination and sixth recombination sites comprise Lox sequences.
142. The system of polynucleotides of claim 141, wherein the recombinase is an inducible recombinase.
143. The system of polynucleotides of claim 142, wherein the inducible recombinase is a Cre recombinase fused to an estrogen receptor ligand binding domain.
144. The system of polynucleotides of claim 142 or claim 143, wherein the inducible recombinase is a Cre-ERT2 fusion protein.
145. The system of polynucleotides of any one of claims 142-144, wherein the inducible recombinase is activated in the presence of a second triggering agent.
146. The system of polynucleotides of claim 145, wherein the second triggering agent induces nuclear localization of the inducible recombinase.
147. The polynucleotide of claim 145 or claim 146, wherein the second triggering agent is an estrogen receptor ligand.
148. The polynucleotide of any one of claims 145-147, wherein the second triggering agent is a selective estrogen receptor modulator (SERM).
149. The polynucleotide of claim 148, wherein the second triggering agent is tamoxifen.
150. The system of polynucleotides of any one of claims 142-149, wherein the inducible recombinase comprises the nucleotide sequence of SEQ ID NO: 211, or a nucleotide sequence that has at256MOFO-359992482324632001140 least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
151. The system of polynucleotides of any one of claims 145-150, wherein the recombination event between the fifth recombination site and the sixth recombination site is induced in the presence of the first and second triggering agents.
152. The system of polynucleotides of any of claims 124-151, wherein the sequence encoding the one or more AAV helper proteins is a bistronic open reading frame encoding at least two AAV helper proteins.
153. The system of polynucleotides of any of claims 124-152, wherein the one or more helper proteins comprise E2A and E4.
154. The system of polynucleotides of claim 153, wherein the E2A protein is encoded by a nucleotide sequence comprising SEQ ID NO: 212 and SEQ ID NO: 214, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
155. The system of polynucleotides of claim 153 or 154, wherein the E4 protein is encoded by a nucleotide sequence comprising SEQ ID NO: 217, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
156. The system of polynucleotides of any one of claims 153-155, wherein the sequence coding for E2A and the sequence coding for E4 are separated by an internal ribosome entry site (IRES) or by a cleavable linker.
157. The system of polynucleotides of any one of claims 153-155, wherein the cleavable linker is a 2A peptide, optionally wherein the 2A peptide is P2A, T2A, F2A, or E2A.
158. The system of polynucleotides of any one of claims 153-155, wherein the sequence coding for E2A and the sequence coding for E4 are separated by an internal ribosome entry site (IRES).
159. The system of polynucleotides of claim 158, wherein the IRES comprises that nucleotide sequence of SEQ ID NO: 216, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.257MOFO-359992482324632001140160. The system of polynucleotides of any of claims 124-159, wherein the first expression cassette comprises the nucleotide sequence of SEQ ID NO: 236, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
161. The system of polynucleotides of any of claims 124-160, wherein the second polynucleotide further comprises a second expression cassette comprising a second constitutive promoter operably linked to a nucleotide sequence encoding an activator.
162. The system of polynucleotides of claim 161, wherein the second expression cassette is in an opposite orientation relative to the first expression cassette.
163. The system of polynucleotides of claim 161, wherein the first expression cassette is oriented 3’ to 5’ and the second expression cassette is oriented 5’ to 3’, or the first expression cassette is oriented 5’ to 3’ and the second expression cassette is oriented 3’ to 5’.
164. The system of polynucleotides of any of claims 161-163, wherein the first expression cassette is separated from the second expression cassette by an intervening sequence.
165. The system of polynucleotides of claim 164, wherein the intervening sequence comprises a transcriptional blocking element (TBE).
166. The system of polynucleotides of claim 165, wherein the TBE element comprises the sequence of SEQ ID NO: 117 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
167. The system of polynucleotides of any of claims 161-166, wherein the activator activates transcription from the inducible promoter of the first polynucleotide and / or the second polynucleotide in the presence of a first triggering agent.
168. The system of polynucleotides of claims 167, wherein the first triggering agent is doxycycline.
169. The system of polynucleotides of any one of claims 161-168, wherein the activator is Tet- on3G.
170. The system of polynucleotides of any of claims 161-169, wherein the activator comprises the nucleotide sequence of SEQ ID NO: 223 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.258MOFO-359992482324632001140171. The system of polynucleotides of any one of claims 161-170, wherein the second constitutive promoter is an EFla promoter.
172. The system of polynucleotides of claim 171 , wherein the EFl a promoter has a TATA box mutation.
173. The system of polynucleotides of any one of claims 161-172, wherein the second constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 350, SEQ ID NO: 185 or SEQ ID NO: 224, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
174. The system of polynucleotides of any of claims 161-173, wherein the second expression cassette comprises the nucleotide sequence of SEQ ID NO: 257, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
175. The system of polynucleotides of any of claims 124-174, wherein the second polynucleotide further comprises a third expression cassette comprising a first part of a third constitutive promoter, a third excisable element, a second part of a constitutive promoter and a sequence encoding VA RNA.
176. The system of polynucleotides of claim 175, wherein the third expression cassette is downstream of the second expression cassette and is in the same orientation as the second expression cassette.
177. The system of polynucleotides of claim 175 or claim 176, wherein the third excisable element is in an opposite orientation relative to the third constitutive promoter.
178. The system of polynucleotides of any of claims 175-177, wherein the third excisable element comprises a second selection cassette flanked by a seventh recombination site and an eighth recombination site.
179. The system of polynucleotides of claim 178, wherein the second selection cassette is excised following a recombination event between the seventh recombination site and the eighth recombination site thereby generating a functionally complete third constitutive promoter operably linked to the sequence encoding VA RNA.259MOFO-359992482324632001140180. The system of polynucleotides of any of claims 175-179, wherein the first part of third the constitutive promoter comprises a U6 promoter distal sequence element (DSE) and the second part of the third constitutive promoter comprises a U6 promoter proximal sequence element (PSE).
181. The system of polynucleotides of claim 180, wherein the U6 promoter DSE comprises the nucleotide sequence of SEQ ID NO: 234, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
182. The system of polynucleotides of claim 180 or claim 181, wherein the U6 promoter PSE comprises the nucleotide sequence of SEQ ID NO: 235, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
183. The system of polynucleotides of any of claims 175-182, wherein the sequence encoding VA RNA is a transcriptionally dead sequence.
184. The system of polynucleotides of any of claims 175-183, wherein the sequence encoding VA RNA comprises at least two mutations in an internal promoter, optionally wherein the at least two mutations comprise a G16A mutation and a G60A mutation with reference to SEQ ID NO: 173.
185. The system of polynucleotides of any of claims 175-184, wherein the sequence encoding VA RNA comprises the nucleotide sequence of SEQ ID NO: 176 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
186. The system of polynucleotides of any of claims 178-185, wherein the second selection cassette comprises a fourth constitutive promoter operably linked to a nucleotide sequence encoding second selectable marker.
187. The system of polynucleotides of claim 186, wherein the second selectable marker is a puromycin resistance gene.
188. The system of polynucleotides of claim 187, wherein the puromycin resistance gene comprises the nucleotide sequence of SEQ ID NO: 225, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
189. The system of polynucleotides of any of claims 186-188, wherein the fourth constitutive promoter is a CMV promoter.260MOFO-359992482324632001140190. The system of polynucleotides of any of claims 178-189, wherein the second selection cassette comprises the nucleotide sequence of SEQ ID NO: 239, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
191. The system of polynucleotides of any of claims 175-190, wherein the third expression cassette comprises the nucleotide sequence of SEQ ID NO: 238, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
192. The system of polynucleotides of any of claims 124-191, wherein the second polynucleotide comprises the sequence of SEQ ID NO: 231 or SEQ ID NO: 127, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
193. The system of polynucleotides of any of claims 124-192, further comprising a third polynucleotide comprising a payload expression cassette flanked by AAV ITR sequences, wherein the payload expression cassette comprises a fifth constitutive promoter operably linked to a nucleotide sequence encoding a payload.
194. The system of polynucleotides of claim 193, wherein the fifth constitutive promoter is an RSV promoter.
195. The system of polynucleotides of claim 194, wherein the RSV promoter comprises the nucleotide sequence of SEQ ID NO: 138 or SEQ ID NO: 247, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
196. The system of polynucleotides of any one of claims 193-195, wherein the sequence of the payload comprises a polynucleotide sequence coding for a gene.
197. The system of polynucleotides of claim 196, wherein the gene codes for a selectable marker or detectable marker.
198. The system of polynucleotides of claim 196 or claim 197, wherein the gene codes for a therapeutic polypeptide or transgene.
199. The system of polynucleotides of any one of claims 193-198, wherein the sequence of the payload comprises a polynucleotide sequence coding for a therapeutic polynucleotide.261MOFO-359992482324632001140200. The system of polynucleotides of claim 199, wherein the therapeutic polynucleotide is a tRNA suppressor or a guide RNA.
201. The system of polynucleotides of claim 200, wherein the guide RNA is a polyribonucleotide capable of binding to a protein.
202. The system of polynucleotides of claim 201, wherein the protein is nuclease.
203. The system of polynucleotides of claim 201 or claim 202, wherein the protein is a Cas protein, an ADAR protein, or an AD AT protein.
204. The system of polynucleotides of claim 203, wherein the Cas protein is catalytically inactive Cas protein.
205. The system of polynucleotides of any one of claims 193-204, wherein the third polynucleotide further comprises a third selection cassette, where in the third selection cassette comprises a sixth constitutive promoter operably linked to a sequence encoding a third selectable marker.
206. The system of polynucleotides of claim 205, wherein the third selectable marker is an antibiotic resistance gene.
207. The system of polynucleotides of claim 205 or claim 206, wherein the third selectable marker comprises a second part of a split blasticidin resistance gene.
208. The system of polynucleotides of claim 207, wherein the third selectable marker comprises the nucleotide sequence of SEQ ID NO:250 or SEQ ID NO: 334 , or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
209. The system of polynucleotides of any one of claims 205-208, wherein the sixth constitutive promoter is an EFla promoter.
210. The system of polynucleotides of claim 209, wherein the EFl a promoter has a TATA box mutation.
211. The system of polynucleotides of any one of claims 205-209, wherein the sixth constitutive promoter comprises the nucleotide sequence of SEQ ID NO:351 or 251, or a nucleotide sequence that has262MOFO-359992482324632001140 at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
212. The system of polynucleotides of any of claims 205-211, wherein the third selection cassette comprises the nucleotide sequence of SEQ ID NO: 241, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
213. The system of polynucleotides of any of claims 193-212, wherein the third polynucleotide comprises the sequence of SEQ ID NO: 330 or SEQ ID NO: 130, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
214. A vector comprising the polynucleotide of any one of claims 1-123.
215. A vector comprising the nucleotide sequence of SEQ ID NO: 142, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
216. A vector comprising the nucleotide sequence of SEQ ID NO: 142.
217. A vector comprising the polynucleotide of any one of claims 1-79 and 86-142.
218. A vector system for inducible production of recombinant adeno-associated virus (rAAV) comprising: a first vector comprising the first polynucleotide of any of claims 73-123; a second vector comprising the second polynucleotide of any of claims 124-213; and a third vector comprising the third polynucleotide of any of claims 193-213.
219. A vector system for producing recombinant adenovirus associated virus (rAAV), comprising: the vector of claim 214, wherein the vector is a first vector; a second vector comprising a sequence encoding one or more AAV helper proteins; and a third vector comprising a polynucleotide payload flanked by AAV inverted terminal repeats (ITRs).
220. A vector system for producing recombinant adenovirus associated virus (rAAV), comprising: the vector of claim 55, wherein the vector is a first vector; a second vector comprising a sequence encoding one or more AAV helper proteins;263MOFO-359992482324632001140 a third vector comprising a sequence encoding a payload flanked by AAV inverted terminal repeats (ITRs).
221. A vector system for producing recombinant adenovirus associated virus (rAAV), comprising: the vector of claim 217, wherein the vector is a first vector; a second vector comprising a sequence encoding one or more AAV helper proteins; a third vector comprising a sequence encoding a payload flanked by AAV inverted terminal repeats (ITRs); and a fourth vector comprising an AAV Cap encoding sequence.
222. The vector system of any one of claims 219-221 for inducibly producing rAAV, the second vector comprising an inducible promoter operably linked to a sequence encoding an inducible recombinase; a self-excising element comprising a third recombination site and a fourth recombination site flanking the sequence encoding the inducible recombinase, wherein the third recombination site and the fourth recombination site are oriented in the same direction; the self-excising element separating the inducible promoter from a sequence encoding the one or more AAV helper proteins such that the inducible promoter is not operably linked to the sequence encoding the one or more AAV helper proteins; a constitutive promoter operably linked to a sequence encoding an activator, wherein the activator is unable to activate the inducible promoter in absence of a first triggering agent; and a constitutive promoter operably linked to a sequence encoding a second selectable marker.
223. The vector system of any one of claims 219-222, wherein the first vector comprises a sequence encoding a first portion of the first selectable marker and a constitutive promoter operably linked to the sequence encoding the first portion of the first selectable marker and the third vector comprises a sequence encoding a second portion of the first selectable marker and a constitutive promoter operably linked to the sequence encoding the second portion of the first selectable marker, wherein the first and second portions associate to form a functional first selectable marker.
224. The vector system of claim 222 or claim 223, wherein the sequence coding for one or more AAV helper proteins comprises a bicistronic open reading frame encoding at least two AAV helper proteins.
225. The vector system of any one of claims 222-224, wherein the helper proteins comprise E2a and E4.
226. The vector system of any one of claims 222-225, wherein the inducible promoter in the second vector comprises a tetracycline-responsive promoter element (TRE) and is operably linked to a sequence encoding the inducible recombinase, and the activator is Tet-on 3G.264MOFO-359992482324632001140227. The vector system of any one of claims 222-226, wherein the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus of a cell comprising the second vector in the presence of the second triggering agent.
228. The vector system of claim 227, wherein the first triggering agent is doxycycline and the second triggering agent is tamoxifen.
229. The vector system of any one of claims 219-228, wherein the payload is progranulin.
230. The vector system of any one of claims 219-229, wherein the second vector further comprises a VA-RNA coding sequence.
231. The vector system of claim 230, wherein the second vector further comprises an insert comprising: a first part of a constitutive promoter and a second part of a constitutive promoter separated by a second excisable element comprising a fifth recombination site and a sixth recombination site flanking a staffer sequence, wherein the fifth and sixth recombination sites are oriented in the same direction, and the VA-RNA coding sequence, wherein excision of the second excisable element by the inducible recombinase generates a functional complete fifth constitutive promoter operably linked to the VA-RNA coding sequence thereby allowing expression of the VA-RNA.
232. The vector system of claim 231, wherein the first part of the constitutive promoter comprises a distal sequence element (DSE) of a U6 promoter, and the second part of the constitutive promoter comprises a proximal sequence element (PSE) of a U6 promoter.
233. The vector system of any one of claims 230-232, wherein the sequence coding for VARNA is a transcriptionally dead sequence.
234. The vector system of any one of claims 230-233, wherein the sequence coding for VA RNA comprises at least two mutations in an internal promoter.
235. A cell comprising the polynucleotide of any one of claims 1-123.
236. The cell of claim 235, wherein the polynucleotide is integrated into the genome of the cell.
237. A cell comprising the system of polynucleotides of any one of claims 124-213.265MOFO-359992482324632001140238. The cell of claim 237, wherein the first polynucleotide is integrated into the genome of the cell.
239. The cell of claim 237 or claim 238, wherein the second polynucleotide is integrated into the genome cell.
240. The cell of any one of claims 237-239, wherein the third polynucleotide is integrated into the genome of the cell.
241. The cell of any of claims 237-240, wherein each of the first, second and third polynucleotide is integrated into the genome of the cell.
242. A cell comprising the vector of any of claims 214-217.
243. The cell of claim 242, wherein the vector is integrated into a genome of the cell244. A cell comprising the first vector and the second vector of any one of claims 219-234.
245. The cell of claim 244, wherein the first vector and the second vector are integrated into a genome of the cell.
246. A cell comprising the vector system of any one of claims 218-234.
247. A cell for inducible production of recombinant AAV (rAAV) comprising the system of polynucleotides of any one of claims 193-213 or the vector system of any one of claims 218-234, wherein one or more of the polynucleotides or vectors are stably integrated into the cell.
248. A cell for inducible production of recombinant AAV (rAAV) comprising, comprising:(i) a first polynucleotide comprising: an inducible promoter operably linked to a sequence encoding an inducible recombinase; a self-excising element comprising a first recombination site and a second recombination site flanking the sequence encoding the inducible recombinase, wherein the first recombination site and the second recombination site are oriented in the same direction; the self-excising element separating the inducible promoter from a sequence encoding one or more AAV helper proteins such that the inducible promoter is not operably linked to the sequence encoding the one or more AAV helper proteins; a first constitutive promoter operably linked to a sequence encoding an activator, wherein the cell constitutively expresses the activator and the activator is unable to activate the inducible promoter in absence of a first triggering agent; and a second constitutive 266MOFO-359992482324632001140 promoter operably linked to a sequence encoding a first selectable marker, wherein the cell constitutively expresses the first selectable marker,(ii) a polynucleotide vector comprising: a first promoter operably linked to a large Rep coding sequence, the large Rep coding sequence comprising (i) an intron comprising a second promoter and (ii) the small Rep coding sequence, wherein the second promoter is heterologous to the small Rep coding sequence, wherein the second promoter has higher promoter activity as compared to the first promoter, wherein the small Rep coding sequence comprises a first excisable element comprising a third recombination site and a fourth recombination site flanking a sequence comprising a stop codon, wherein the third recombination site and the fourth recombination site are oriented in the same direction and wherein recombination between the third and fourth recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon, and wherein the second promoter is operably linked to the small Rep coding sequence following a recombination event between the third recombination site and the fourth recombination site; a second excisable element comprising a sequence encoding a ribozyme flanked by a fifth recombination site and a sixth recombination site; an AAV capsid proteins coding sequence; and a third constitutive promoter operably linked to a sequence encoding a first portion of a second selectable marker; and(iii) a third polynucleotide comprising a polynucleotide payload sequence and a fourth constitutive promoter operably linked to a sequence encoding a second portion of the second selectable marker, wherein the polynucleotide payload sequence is flanked by AAV inverted terminal repeats (ITRs).
249. The cell of any one of claims 235-248, wherein the cell is a mammalian cell, optionally wherein the mammalian cell is a HEK293 cell, further optionally, wherein the HEK293 cell expresses AAV helper proteins El A and E1B.
250. The cell of any one of claims 247-249, wherein the vector system is integrated into a genome of the cell.
251. The cell of any one of claims 235-250, wherein the cell further comprises a knockout of one or more genes encoding a protein involved in programmed cell death.
252. The cell of claim 251 , wherein the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight,267MOFO-359992482324632001140 at least nine, at least ten, or fourteen of CASP3, CASP6, CASP7, AIF1, BAK1, BAX, IFNAR1, MYD88, TICAM1, TIRAP, RIGI, CGAS, STING, AIM2, DFFB, and IFI16.
253. The cell of claim 251 or claim 252, wherein the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or eight of CASP3, CGAS, STING1, IFNAR1, MYD88, BAK, BAK1, and DFFB.
254. The cell of any one of claims 251-253, wherein the protein involved in programmed cell death comprises CASP3.
255. The cell of any one of claims 251-254, wherein the knockout comprises a deletion in an exon within each of the one or more genes.
256. The cell of any one of claims 251-255, wherein the knockout was performed using a CRISPR system, optionally wherein the CRISPR system comprises a nuclease and at least one guide RNA.
257. A method for producing recombinant AAV, the method comprising performing transfection of a cell with the vector system of any one of claims 218-234.
258. A method of generating a cell for inducibly producing recombinant AAV (rAAV) comprising a payload, the method comprising:(i) introducing into a cell a first vector comprising: an inducible promoter operably linked to a sequence encoding an inducible recombinase; a self-excising element comprising a first recombination site and a second recombination site flanking the sequence encoding the inducible recombinase, wherein the first recombination site and the second recombination site are oriented in the same direction; the self-excising element separating the inducible promoter from a sequence encoding one or more AAV helper proteins such that the inducible promoter is not operably linked to the sequence encoding the one or more AAV helper proteins; a first constitutive promoter operably linked to a sequence encoding an activator, wherein the cell constitutively expresses the activator and the activator is unable to activate the inducible promoter in absence of a first triggering agent; and a second constitutive promoter operably linked to a sequence encoding a first selectable marker, wherein the cell constitutively expresses the first selectable marker,(ii) selecting for a cell expressing the first selectable marker;(iii) introducing a second vector and a third vector into the cell expressing the first selectable marker, the second vector comprising:268MOFO-359992482324632001140 a first promoter operably linked to a large Rep coding sequence, the large Rep coding sequence comprising (i) an intron comprising a second promoter and (ii) the small Rep coding sequence, wherein the second promoter is heterologous to the small Rep coding sequence, wherein the second promoter has higher promoter activity as compared to the first promoter, wherein the small Rep coding sequence comprises a first excisable element comprising a third recombination site and a fourth recombination site flanking a sequence comprising a stop codon, wherein the third recombination site and the fourth recombination site are oriented in the same direction and wherein recombination between the third and fourth recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon, and wherein the second promoter is operably linked to the small Rep coding sequence following a recombination event between the third recombination site and the fourth recombination site; a second excisable element comprising a sequence encoding a ribozyme flanked by a fifth recombination site and a sixth recombination site; an AAV capsid proteins coding sequence; and a third constitutive promoter operably linked to a sequence encoding a first portion of a second selectable marker; and the third vector comprising a polynucleotide payload sequence and a fourth constitutive promoter operably linked to a sequence encoding a second portion of the second selectable marker, wherein the polynucleotide pay load sequence is flanked by AAV inverted terminal repeats (ITRs); and(iv) selecting for a cell expressing the first selectable marker and the second selectable marker, thereby generating the cell for inducibly producing recombinant AAV (rAAV) virions comprising the payload.
259. The method of claim 258, further comprising expanding a cell expressing the first and second selectable markers.
260. The method of claim 258 or 259, wherein the first and second selectable markers are antibiotic resistance proteins.
261. The method of claim 260, wherein the second selectable marker is a split blasticidin.
262. The method of any one of claims 258-261, wherein the first promoter in the second vector is heterologous to the large Rep coding sequence.269MOFO-359992482324632001140263. The method of any one of claims 258-262, wherein the large Rep coding sequence comprises a pl9 promoter operably linked to the small Rep coding sequence and the intron comprising the second promoter is located downstream of the pl9 promoter and upstream of the transcription start site of the small Rep coding sequence.
264. The method of claim 263, wherein the pl9 promoter is mutated to substantially reduce promoter activity.
265. The method of claim 264, wherein the pl9 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or is undetectable as compared to the native pl9 promoter activity.
266. The method of any one of claims 258-265, wherein the second vector lacks a functional p5 promoter.
267. The method of claim 166, wherein the first promoter replaces the p5 promoter.
268. The method of any one of claims 258-267, wherein the first promoter and / or second promoter in the second vector is a constitutive promoter or an inducible promoter.
269. The method of any one of claims 258-268, wherein in the second vector, (i) the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Rous sarcoma virus long terminal repeat (RSV) promoter; (ii) the first promoter is a chicken beta actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken beta actin (CAG) promoter and the second promoter is a RSV promoter; or (iv) the first promoter is a chicken beta actin promoter and the second promoter is a RSV promoter.
270. The method of any one of claims 258-269, wherein the intron is a synthetic intron comprising a 5’ splice donor site, the second promoter sequence, and a 3’ splice acceptor site compatible with a cell used for expressing the large Rep proteins.
271. The method of any one of claims 258-270, wherein the small Rep coding sequence comprises an excisable element comprising a first recombination site and a second recombination site flanking a sequence comprising a stop codon, wherein the first recombination site and the second recombination site are oriented in the same direction and wherein recombination between the first and second recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon.270MOFO-359992482324632001140111. The method of any one of claims 258-271, wherein the second vector comprises a sequence encoding a tag in frame with the large Rep coding sequence and the small Rep coding sequence, wherein large Rep proteins and small Rep proteins each are expressed as a fusion protein comprising the tag.
273. The method of claim 272, wherein the tag is a purification tag and / or a detectable tag.
274. The method of any one of claims 258-273, wherein the AAV capsid proteins coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence and the polynucleotide further comprises an inducible or constitutive promoter operably linked to the Cap coding sequence.
275. The method of claim 274, wherein the second vector comprises an inducible promoter operably linked to the AAV capsid proteins coding sequence.
276. The method of claim 274 or claim 275, wherein the intervening sequence comprises a transcriptional blocking element (TBE).
277. The method of claim 275 or claim 276, wherein the inducible promoter operably linked to the sequence encoding the inducible recombinase and the inducible promoter operably linked to the AAV capsid proteins coding sequence are the same promoters.
278. The method of claim 277, wherein the promoters comprise a tetracycline-responsive promoter element (TRE).
279. The method of claim 277 or claim 278, wherein the activator that binds to the TRE in the presence of the first triggering agent is Tet-on 3G.
280. The method of any one of claims 258-279, wherein the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus of a cell comprising the second vector in the presence of the second triggering agent.
281. The method of any one of claims 258-280, wherein the first triggering agent is doxycycline and the second triggering agent is tamoxifen.
282. The method of any one of claims 258-281, wherein the sequence encoding the ribozyme in the second excisable element is excised following a recombination event between the fifth recombination site and the sixth recombination site.271MOFO-359992482324632001140283. The polynucleotide of claim 258-282, wherein the sequence encoding the ribozyme is located upstream or downstream of the small Rep coding sequence.
284. The polynucleotide of any one of claims 258-283, wherein the ribozyme is a self-cleaving ribozyme.
285. The polynucleotide of any one of claims 258-284, wherein the ribozyme is a Hammerhead ribozyme.
286. The polynucleotide of any one of claims 258-285, wherein the ribozyme is selected from: a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, and a RAGATH-1 -hammerhead.
287. The polynucleotide of any one of claims 258-286, wherein the sequence encoding the ribozyme comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 183 or SEQ ID NO: 139.
288. The polynucleotide of any one of claims 258-287, wherein the sequence encoding the ribozyme comprises SEQ ID NO: 183 or SEQ ID NO: 139.
289. The method of any one of claims 258-288, wherein the payload is progranulin.
290. The method of any one of claims 258-289, wherein the first vector further comprises a VARNA coding sequence.
291. The method of claim 290, wherein the sequence coding for VA-RNA is a transcriptionally dead sequence.
292. The method of claim 290 or claim 291, wherein the sequence coding for VA RNA comprises at least two mutations in an internal promoter.
293. The method of any one of claims 258-292, further comprising performing a knockout of one or more genes encoding a protein involved in programmed cell death.
294. The method of claim 293, wherein the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or fourteen of CASP3, CASP6, CASP7, AIF1, BAK1, BAX, IFNAR1, MYD88, TICAM1, TIRAP, RIGI, CGAS, STING, AIM2, DFFB, and IFI16.272MOFO-359992482324632001140295. The method of claim 293 or claim 294, wherein the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or eight of CASP3, CGAS, STING1, IFNAR1, MYD88, BAK, BAK1, and DFFB.
296. The method of any one of claims 293-295, wherein the protein involved in programmed cell death comprises CASP3.
297. The method of any one of claims 293-296, wherein the knockout comprises a deletion in an exon within each of the one or more genes.
298. The method of any one of claims 293-297, wherein performing the knockout comprises using a CRISPR system.
299. The method of any one of claims 293-298, wherein performing the knockout comprises contacting the cell with a nuclease and at least one guide RNA, optionally wherein the nuclease is Cas9.
300. The method of claim 299, wherein the nuclease and at least one guide RNA is introduced into the cell by delivering a ribonucleoprotein (RNP) complex by electroporation.
301. A method to increase small Rep proteins expression comprising introducing the polynucleotide of any one of claims 1-123 into a cell, thereby increasing the expression of small Rep proteins compared to introducing the polynucleotide of any one of claims 1-123 having a native p5 promoter instead of the first promoter and a pl9 promoter instead of the second promoter.
302. A method to increase small Rep protein expression comprising introducing the vector system of any one of claims 218-234 into a cell and contacting the cell to the first triggering agent and the second triggering agent, thereby increasing the expression of small Rep protein compared to introducing the vector system of any one of claims 218-234 having a native p5 promoter instead of the first promoter and a pl9 promoter instead of the second promoter.
303. A method to decrease large Rep protein expression comprising introducing the vector of claim 214 or claim 217 into a cell, thereby decreasing the expression of large Rep protein compared to introducing the vector of claim 214 or claim 217 having a native p5 promoter instead of the first promoter.
304. A method to increase small Rep protein expression comprising introducing the vector system of any one of claims 218-234 into a cell and contacting the cell to the first trigger and the second trigger, thereby increasing the expression of small Rep protein compared to introducing the vector system of any273MOFO-359992482324632001140 one of claims 218-234 having a native p5 promoter instead of the first promoter and a pl9 promoter instead of the second promoter.
305. The method of any one of claims 301-304, further comprising contacting the cell with an apoptosis inhibitor.
306. The method of claim 305, wherein the apoptosis inhibitor is zVAD.fmk.274MOFO-359992482
Citation Information
Patent Citations
Extracellular matrix receptor ligands that modulate leukocyte function
EP0595659A2
Fas ANTIGEN DERIVATIVES
EP0965637A1
Methods and compositions for treating metastatic breast cancer and other cancers in the brain
US10780182B2
Nucleic acid comprising or coding for a histone stem-loop and a poly(A) sequence or a polyadenylation signal for increasing the expression of an encoded pathogenic antigen
US10912826B2
Compositions and methods of treating Huntington's disease
US11752181B2