RNA virus SsOLV4-based VIGS vector system and application thereof
By constructing a VIGS vector system based on the RNA virus SsOLV4, the problems of long time consumption and complexity in Sclerotinia sclerotiorum gene silencing were solved, achieving rapid and efficient gene silencing, which is suitable for Sclerotinia sclerotiorum gene function research and prevention and control.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HUBEI HONGSHAN LABORATORY
- Filing Date
- 2026-06-05
- Publication Date
- 2026-06-30
AI Technical Summary
Existing technologies are insufficient for efficiently silencing Sclerotinia sclerotiorum genes, and traditional methods are time-consuming, complex, and prone to causing phenotypic abnormalities.
The VIGS vector system was constructed using the RNA virus SsOLV4. By inserting the target gene fragment into Sclerotium sclerotiorum, the gene silencing of Sclerotium sclerotiorum was achieved using virus-mediated gene silencing technology, avoiding the complexity and phenotypic abnormalities of traditional methods.
This method enables rapid and efficient silencing of Sclerotinia sclerotiorum genes, making it suitable for gene function research and targeted control of Sclerotinia sclerotiorum, while avoiding the complexity and phenotypic abnormalities of traditional methods.
Smart Images

Figure CN122303286A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bio-agriculture and relates to a VIGS vector system based on RNA virus SsOLV4 and its application. Background Technology
[0002] *Sclerotinia sclerotiorum* is a globally distributed, necrotrophic pathogenic fungus capable of infecting over 700 plant species across more than 75 families, posing a serious threat to the safe production of many important economic crops. Current control relies primarily on chemical fungicides; however, long-term application can induce drug resistance in the pathogen and lead to environmental pollution risks. Therefore, elucidating the gene function of *Sclerotinia sclerotiorum* and elucidating its pathogenic molecular mechanisms is of vital strategic value for ensuring my country's food and oil security. Previous studies have established technologies such as Agrobacterium-mediated transformation and PEG-mediated transformation for *Sclerotinia sclerotiorum*; however, the lack of asexual spore production and the multinucleated nature of its hyphae have created significant challenges for gene function research.
[0003] Virus-Induced Gene Silencing (VIGS) is a reverse genetics technique that uses viral vectors to trigger RNA interference (RNAi) pathways within plant cells, inducing posttranscriptional gene silencing of specific genes. VIGS bypasses the time-consuming and technically complex process of stable genetic transformation in plants, providing innovative approaches for exploring plant gene function and elucidating the function of key genes in plant-microbe interactions, as well as for targeted control. In plants, vectors based on RNA viruses (such as tobacco brittle virus TRV) and DNA viruses (such as geminivirus TGMV) can efficiently induce the silencing of target genes (Chen et al., 1999). In 2023, researchers successfully modified the fungal DNA virus FgGMTV1 into a VIGS vector applicable to Fusarium graminearum (Zhan et al., 2023).
[0004] Our research group previously identified a novel RNA virus, SsOLV4 (GenBank Accession No. MN715322), belonging to the Pan-Eurmiviridae family in *Sclerotinia sclerotiorum*. Its genome is a +ssRNA, 2892 nucleotides in length, encoding an RNA-dependent RNA polymerase (RdRp) with a nuclear localization signal. This virus can spread efficiently among different strains of *Sclerotinia sclerotiorum* without causing significant phenotypic abnormalities (Wang et al. A single ssRNA segment encoding RdRp is sufficient for an ourmia-like virus in fungi. Front Microbiol 2020,11: 379). Summary of the Invention
[0005] The purpose of this invention is to address the above-mentioned shortcomings of the prior art by providing the application of the NA virus SsOLV4 in the construction of a VIGS vector system.
[0006] Another object of the present invention is to provide a VIGS vector for silencing target genes in Sclerotinia sclerotiorum.
[0007] Another object of the present invention is to provide a method for silencing the target gene of Sclerotinia sclerotiorum.
[0008] The objective of this invention can be achieved through the following technical solutions:
[0009] The application of an RNA virus in the construction of a VIGS vector system, wherein the RNA virus is selected from viruses whose full-length cDNA sequence has greater than or equal to 80% homology with the sequence shown in SEQ ID NO: 1.
[0010] Preferably, the RNA virus is selected from viruses whose full-length cDNA sequence has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homology with the sequence shown in SEQ ID NO: 1.
[0011] Preferably, the VIGS vector system is used for gene silencing in Sclerotinia sclerotiorum.
[0012] The application of vector pMD18-P1 in constructing a VIGS vector system for silencing Sclerotinia sclerotiorum genes or in silencing Sclerotinia sclerotiorum genes, wherein the vector pMD18-P1 contains the full-length cDNA sequence of RNA virus SsOLV4 as shown in SEQ ID NO: 1 and has Amp resistance.
[0013] The VIGS vector for silencing the target gene of Sclerotinia sclerotiorum is obtained by inserting the target gene fragment in reverse between the CDS stop codon and the 3'UTR of SsOLV4 in the vector pMD18-P1 under the action of homologous recombinase. The vector pMD18-P1 contains the full-length cDNA sequence of the RNA virus SsOLV4 shown in SEQ ID NO: 1 and has Amp resistance.
[0014] Preferably, the target gene fragment is a 39 bp-393 bp fragment of the conserved structural domain of the target gene, and more preferably a 99 bp fragment of the conserved structural domain of the target gene.
[0015] Preferably, the target gene is selected from the endogenous genes Sssfh1, SsareA and Sssre of Sclerotinia sclerotiorum.
[0016] Further preferred sequences include the 99bp Sssfh1 gene fragment sequence as shown in SEQ ID NO: 6, the 99bp SsareA gene fragment sequence as shown in SEQ ID NO: 7, and the 99bp Sssre gene fragment sequence as shown in SEQ ID NO: 8.
[0017] The method for constructing the VIGS carrier includes the following steps:
[0018] (1) Using the DNA of vector pMD18-P1 as a template, the linearized pMD18-P1 vector was obtained by reverse PCR amplification using primers 3'UTR-F1 / CDS3'-R1, wherein the sequence of primer 3'UTR-F1 is shown in SEQ ID NO: 2 and the sequence of primer CDS3'-R1 is shown in SEQ ID NO: 3;
[0019] (2) Cloning a 99bp target gene fragment, and under the action of homologous recombinase, inserting the target gene fragment in reverse between the CDS stop codon of SsOLV4 and the 3'UTR in the linearized vector pMD18-P1 obtained in step (1), to obtain the silencing vector p-GFP99.
[0020] The application of the VIGS vector in silencing the target gene in Sclerotinia sclerotiorum.
[0021] A method for silencing a target gene in Sclerotinia sclerotiorum includes the following steps:
[0022] (1) Using T7SsOLV4- as shown in SEQ ID NO:4 and SsOLV4-R1 as shown in SEQ ID NO:5 as primers, and the VIGS vector as template, the corresponding in vitro transcription template was amplified. RNA was synthesized in vitro by using an in vitro transcription kit under the action of T7 RNA polymerase.
[0023] (2) Using the Sclerotium sclerotiorum to be edited as the starting strain, the RNA obtained by in vitro transcription in step (1) was transfected into the Sclerotium sclerotiorum to be edited by PEG-mediated protoplast transfection method. The viral components of the transfected strain were verified, and the expression level of the target gene of the transfected strain was quantitatively analyzed by fluorescence quantitative PCR to obtain the positive strain with the target gene silenced.
[0024] Beneficial effects:
[0025] SsOLV4 replicates stably within the host *Sclerotinia sclerotiorum* and can spread efficiently among different strains of *Sclerotinia sclerotiorum* without causing significant phenotypic abnormalities. Based on SsOLV4, this invention establishes a virus-induced gene silencing (VIGS) technology. This technology overcomes the difficulties caused by the complexity and time-consuming nature of *Sclerotinia sclerotiorum* genetic transformation techniques and the purification of multinucleate *Sclerotinia sclerotiorum* transformants. It can rapidly silence exogenous and endogenous genes in *Sclerotinia sclerotiorum*, making it suitable for rapid and efficient gene silencing and functional studies in *Sclerotinia sclerotiorum*. Attached Figure Description
[0026] Figure 1 pMD18-P1 spectrum
[0027] The full-length gene is 720 bp. The red arrow points to the target fragment inserted between the CDS region and the 3'UTR of SsOLV4.
[0028] Figure 2 eGFP gene structure
[0029] Figure 3 Obtaining the target eGFP fragment and validating the p-GFP99 vector via PCR.
[0030] Figure 4 In vitro transcription template and in vitro transcribed RNA of SsOLV4-GFP99
[0031] Figure 5 p-GFP99 vector was successfully transfected into *Sclerotinia sclerotiorum*.
[0032] Figure 6 Observation of GFP fluorescence in Sclerotium sclerotiorum
[0033] FITC indicates the green fluorescent channel, TD indicates the non-fluorescent channel, and merged indicates channel overlap. The scale bar represents 50 µm.
[0034] Figure 7 Validation of the effect of SsOLV4-VIGS vector in silencing eGFP in Sclerotinia sclerotiorum.
[0035] The expression level of the eGFP gene in *Sclerotinia sclerotiorum* strains was detected by quantitative real-time PCR. The expression level of DT-8VF-eGFP was used as the baseline. Multi-sample significance analysis was performed using SPSS, with a p-value < 0.01 for each letter.
[0036] Figure 8 Schematic diagram of the structures of Sclerotium sclerotiorum Sssfh1, SsareA, and Sssre
[0037] A. Schematic diagram of the Sssfh1 gene structure. The full-length gene is 1841 bp, with conserved domains located between 325 and 1323 bp. B. Schematic diagram of the SsareA gene structure. The full-length gene is 3135 bp, with conserved domains located between 1936 and 2703 bp. C. Schematic diagram of the Sssre gene structure. The full-length gene is 2907 bp, with conserved domains located between 420 and 1157 bp. The red arrow indicates the target fragment inserted between the CDS region and the 5' UTR of SsOLV4.
[0038] Figure 9 Obtaining the Sssfh1, SsareA, and Sssre gene fragments and PCR verification of the p-Sssfh199, p-SsareA99, and p-Sssre99 vectors.
[0039] A. Obtaining the target gene fragment. Both upstream and downstream primers contained homologous fragments upstream and downstream of the pMD18-P1 vector insertion site, and the amplified target band size was 139 bp. B. PCR verification of the silencing vector. The inserted fragment was detected using specific primers M13-FF and SsOLV4-R1 on pMD18-P1. Using the pMD18-P1 vector as a control, the amplified target band sizes were no band, 580, 590, and 794 bp, respectively.
[0040] Figure 10 Obtaining in vitro transcription templates for SsOLV4-Sssfh199, SsOLV4-SsareA99, and SsOLV4-Sssre99 and detecting the quality of in vitro transcribed RNA.
[0041] In vitro transcription templates and transcription products of SsOLV4-Sssfh199, SsOLV4-SsareA99, and SsOLV4-Sssre99.
[0042] Figure 11 Validation of Sclerotinia sclerotiorum candidate transfectants Sssfh1, SsareA, and Sssre
[0043] A. RT-PCR verification of Sssfh1 silenced culture. B. RT-PCR verification of SsareA silenced culture. C. RT-PCR verification of Sssre silenced culture. Lanes 1-9 represent candidate transfection strains for each gene, with the corresponding vector serving as a positive control, DT-8VF strain as a negative control, and DEPC water as a blank control. The marker is DL2000.
[0044] Figure 12 The effect of SsOLV4-VIGS vector on silencing Sssfh1, SsareA and Sssre in Sclerotinia sclerotiorum.
[0045] The expression levels of Sssfh1 (A), SsareA (B), and Sssre (C) in *Sclerotinia sclerotiorum* strains were detected by real-time PCR. Using the expression level of the corresponding genes in strain DT-8VF as a threshold, multi-sample differential significance analysis was performed using SPSS. The expression levels of each letter were statistically significant.
[0046] The significance level P < 0.01. Detailed Implementation
[0047] Sclerotium sclerotiorum strain DT-8VF: A highly pathogenic strain of Sclerotium sclerotiorum (Yu et al. A Geminivirus-related DNA mycovirus that confers hypovirulence to a plant pathogenic fungus. ProcNatl Acad Sci USA 2010, 107: 8387-8392).
[0048] Sclerotium sclerotiorum strain DT-8VF-eGFP: GFP-labeled strain DT-8VF.
[0049] All strains were cultured on PDA medium at the optimal growth temperature of 20℃ and stored on PDA slants at 4℃. The transfected strains obtained in this experiment were all cultured on half PDA medium at 20℃ and stored on half PDA slants at 4℃.
[0050] PDA medium: potato extract, glucose 20 g / L, agar 12 g / L, add distilled water to 1 L, sterilize at 121℃ for 30 min; potato extract: 200 g of potato slices are added to 1 L of distilled water, heated to boiling, filtered to remove residue, and the filtrate is collected to obtain potato extract.
[0051] 1 / 2 PDA medium: The composition is the same as PDA, but the amount of potato extract and glucose is halved.
[0052] Sclerotinias clerotiorum ourmia-like virus 4 (SsOLV4): a fungal virus of clerotiorum with +ssRNA, GenBank Accession No. MN715322.
[0053] pMD18-P1: Contains full-length cDNA of SsOLV4 as shown in SEQ ID NO: 1, Amp resistant. Disclosed in Wang et al. A single ssRNA segment encoding RdRp is sufficient for an ourmia-like virus in fungi. Front Microbiol 2020, 11: 379.
[0054] Example 1: Silencing of the eGFP gene in *Sclerotinia sclerotiorum* using the VIGS vector based on SsOLV4
[0055] 1.1 Construction of the p-GFP99 vector
[0056] Using the DNA of vector pMD18-P1 as a template, linearized pMD18-P1 vector was obtained by reverse PCR amplification using primers 3'UTR-F1 (5'-TATAAGCAATACCATTGTGAAGCTATG-3', SEQ ID NO: 2) / CDS3'-R1 (5'-CTACACATCAGTCAGACTGACATATCCG-3', SEQ ID NO: 3). Figure 1 (Showing the spectrum of vector pMD18-P1 and primer positions).
[0057] Using the genomic DNA of *Sclerotinia sclerotiorum* strain DT-8VF-eGFP as a template, a 99 bp fragment GFP99 from positions 75 to 173 of the eGFP gene was amplified using primers GFP99-F (5'-tcacaatggtattgcttataCCATAAGTTCTCAGTCAGCGG-3') and GFP99-R (5'-tcagtctgactgatgtgtagCAAGGTACAGGCAATTTAC-3'). (The lowercase letter sequences in the primer sequences are the flanking sequences on both sides of the intended insertion site of the exogenous fragment on vector pMD18-P1.) Figure 2 This shows the structure and primer positions of eGFP. Figure 3A shows the amplified fragment. Under the action of homologous recombinase, a 99 bp eGFP gene fragment was inserted in reverse into the vector pMD18-P1 between the CDS stop codon and the 3' UTR of SsOLV4, obtaining the silencing vector p-GFP99. PCR detection was performed using specific primers M13-FF (5'-TCCCCGTCGTTCCAGT-3') and SsOLV4-R1 (5'-GGGGGTTACCTCCAACGG-3') upstream and downstream of the inserted fragment on pMD18-P1. Figure 3 B indicates that the p-GFP99 insert fragment is the correct size.
[0058] 1.2 Preparation of DNA templates for in vitro transcription and acquisition of RNA for in vitro transcription
[0059] To terminate the in vitro transcription reaction at an appropriate site, the above-mentioned vector p-GFP99 was amplified by PCR using T7SsOLV4-F (5'-TAATACGACTCACTATAGGGgggggtgtccttacggac-3', the lowercase sequence of which corresponds to the T7 promoter (SEQ ID NO: 4)) / SsOLV4-R1 (5'-GGGGGTTACCTCCAACGGTACCCAT-3' (SEQ ID NO: 5)) to obtain the T7-SsOLV4-GFP99 transcription template. After gel extraction and recovery of the target band, agarose gel electrophoresis was performed to ensure that it was a single band. Figure 4 (Left). In vitro transcription was performed according to the instructions of the NEB In vitro transcription kit (HiScribe™ T7 ARCAmRNA Kit). RNA was synthesized in vitro using T7 RNA polymerase. The quality of the RNA obtained from in vitro transcription was determined by agarose gel electrophoresis. Figure 4 right).
[0060] 1.3 Preparation of Sclerotinia sclerotiorum protoplasts
[0061] Protoplast preparation solution: 0.04 g of snail enzyme and 0.06 g of lyase were dissolved in 40 mL of 0.7 M NaCl, centrifuged at 10000 r / min and 4℃ to remove impurities, and then filtered through a 0.45 µm bacterial filter for sterilization.
[0062] Sclerotinia sclerotiorum strain DT-8VF-eGFP was cultured on cellophane-lined PDA for 2 days at 20℃. All hyphae were scraped off and added to PDA, and cultured at 20℃ and 150 r / min for 16–24 h with shaking. The hyphae were collected by filtering the PDA medium through three layers of sterile lens paper in a laminar flow hood. The hyphae were transferred to protoplast preparation solution and incubated with shaking at 28℃ and 100 r / min for 1 h. The enzyme digest was filtered through three layers of sterile lens paper in a laminar flow hood, and the process was performed on ice. The filtrate was centrifuged at 4℃ and 5000 r / min for 10 min, the supernatant was discarded, and 1.5 mL of STC (1.2 M Sorbitol, 10 mM Tris-HCl, 50 mM CaCl2) was added to resuspend the precipitate. The mixture was then incubated at 4℃ and 5000 r / min for 10 min. The supernatant was discarded, and 1.5 mL of STC was added to obtain protoplasts.
[0063] 1.4 PEG-mediated protoplast transfection
[0064] 40 µL of in vitro transcribed viral RNA was added to 2 µL of 50 mM spermidine, 5 µL of 2.5 mg / mL heparin sodium, 15 µL of recombinant RNase inhibitor (40 U / µL), and 200 µL of protoplasts. The mixture was incubated on ice for 30 min. 1 mL of protoplast transformation buffer (60% PEG 4000 (w / v), 50 mM CaCl2, 50 mM Tris-HCl, pH 7.5) was added, and the mixture was gently pipetted 20 times, avoiding air bubbles. The mixture was incubated in the dark at 20°C for 30 min. The resulting fragments were then plated onto RM medium (240 g sucrose, 1 g yeast extract, 12 g agar powder, water added to 1000 mL, autoclaved for 30 min) and incubated in the dark at 20°C for 3–4 days until mature hyphae covered the RM surface. Hyphae fragments were then transferred to 1 / 2 PDA plates to obtain candidate transfectants.
[0065] 1.5 Validation of Sclerotinia sclerotiorum transfectants
[0066] Total RNA extraction from *Sclerotinia sclerotiorum* using the Trizol method: 0.1 g of transfectant hyphae were collected from a 1 / 2 PDA plate lined with cellophane, ground into powder in liquid nitrogen, and 1 mL of Trizol was added. The mixture was immediately inverted and incubated on ice for 15 min; centrifuged at 12000 r / min for 10 min at 4 °C. 200 µL of chloroform was added to the supernatant, and the mixture was vigorously mixed and incubated on ice for 15 min; centrifuged at 12000 r / min for 15 min at 4 °C; an equal volume of isopropanol was added to the upper aqueous phase, and the mixture was mixed and incubated at -20 °C for 10 min; centrifuged at 12000 r / min for 15 min at 4 °C; the supernatant was discarded, and the precipitate was washed with 75% ethanol prepared with DEPC water and centrifuged at 12000 r / min for 5 min at room temperature; the supernatant was discarded, and the precipitate was dried; 30–50 µL of DEPC water was added to dissolve the RNA, and the mixture was stored at -80 °C for long-term storage.
[0067] cDNA synthesis: Reverse transcription was performed using a reverse transcription kit from Beijing TransGen Biotech Co., Ltd. The reaction mixture was 20 µL as follows:
[0068] reagents Dosage Total RNA ≤5 µg Random Primer (0.5 µg / µL) 1 µL GSP (0.5 µg / µL) 1 µL 2×ES Reaction Mix 10 µL RI Enzyme Mix 1 µL gDNA Remover 1 µL RNase-free Water up to 20 µL
[0069] Reverse transcription reaction conditions: Mix the RNA template, primers and RNase-free water, incubate at 65°C for 5 min, then incubate on ice for 2 min, add other reaction components, mix gently, react at 25°C for 10 min, at 42°C for 30 min, and incubate at 85°C for 5 s to terminate the reaction.
[0070] RT-PCR verification of viral nucleic acid: The presence of SsOLV4 in candidate transfectants was verified using primers M13-FF and SsOLV4-R1. Strains DT-8VF-eGFP and p-GFP99 were used as negative and positive controls, respectively. Results showed that SsOLV4 was detectable in 3 out of 6 candidate transfectants. Figure 5 This indicates that the RNA transcribed from the p-GFP99 vector in vitro can be successfully transfected into *Sclerotinia sclerotiorum*.
[0071] 1.6 Validation of the effect of silencing eGFP using the SsOLV4-based VIGS vector
[0072] GFP fluorescence observation in *Sclerotinia sclerotiorum*: A sterilized coverslip was placed on the edge of a 1 / 2 PDA plate inoculated with transfectants. After the hyphae covered the coverslip, it was removed and placed on a slide for confocal microscopy observation. The DT-8VF-eGFP strain was used as a control. Under the same parameters, the fluorescence signal intensity of the SsOLV4-GFP99 transfected strain was significantly weaker than that of the DT-8VF-eGFP strain. Therefore, the constructed vector p-GFP99 successfully silenced the GFP gene in *Sclerotinia sclerotiorum* as a VIGS vector.
[0073] Quantitative real-time PCR was used to verify GFP gene expression: To further verify the silencing effect of the GFP gene, RNA was extracted from GFP99-3, GFP99-4, and GFP99-6, and cDNA was obtained by reverse transcription, using the same method as above. Primers Actin-qpcr-F / Actin-qpcr-R were designed using the Actin gene as an internal control gene, and primers GFP-qpcr-F / GFP-qpcr-R were designed using the eGFP gene as the target gene. The expression level of the eGFP gene in the transfected strains was quantitatively analyzed by quantitative real-time PCR, with four technical replicates and three independent replicates for each sample. Ct values were calculated by real-time quantitative PCR, and the expression level was analyzed using 2... -△△Ct The relative expression levels were calculated using the method described above. Data were statistically analyzed and plotted using Prism 8. One-way ANOVN tests were performed using SPSS to analyze the significance (P < 0.01 indicated extremely significant differences). The results showed that the expression levels of the eGFP gene in the GFP99-3, GFP99-4, and GFP99-6 silenced cultures decreased by 41.55%, 79.53%, and 82.76%, respectively, which were significantly different from the expression levels in the DT-8VF-eGFP strain. Figure 7 (P < 0.01). Further confirmation that the constructed SsOLV4-based VIGS vector can successfully achieve gene silencing of eGFP in Sclerotinia sclerotiorum.
[0074] Primers sequence GFP-qpcr-F tggtgatggtccagtcttgc GFP-qpcr-R ccggctgctgtgacaaattc Actin-qpcr-F CCAGAGGAGCACCCAGTTTT Actin-qpcr-R GGACGGCTTGGATAGAGACG
[0075] Example 2: Silencing of endogenous genes in Sclerotinia sclerotiorum using the VIGS vector based on SsOLV4
[0076] GATA transcription factor-related genes Sssfh1 (SS1G_01151), SsareA (SS1G_05040), and Sssre (SS1G_08523) are involved in the growth and development of *Sclerotinia sclerotiorum*, the formation of infection pads, and the pathogenicity of the strain. Silencing these genes slows down the growth rate of *Sclerotinia sclerotiorum*, affects the formation of infection pads, and thus influences the pathogenicity of *Sclerotinia sclerotiorum* (Liu Ling, Functional Study of GATA Transcription Factors in the Growth, Development, and Pathogenicity of *Sclerotinia sclerotiorum*, Doctoral Dissertation, Jilin University, 2019). The structures of the three genes are shown below. Figure 8 .
[0077] 2.1 Construction of VIGS vector based on SsOLV4
[0078] To further verify the silencing effect of the SsOLV4-based VIGS vector on endogenous genes in *Sclerotinia sclerotiorum*, the endogenous genes Sssfh1, SsareA, and Sssre were selected as target genes. Conserved 99 bp fragments of Sssfh1, SsareA, and Sssre were amplified from *Sclerotinia sclerotiorum* strain DT-8VF using primers fh199-F / fh199-R, areA99-F / areA99-R, and sre99-F / sre99-R, respectively. Figure 9 A) pMD18-P1 was linearized by reverse PCR amplification using 3'UTR-F1 / CDS3'-R1 primers.
[0079] Under the action of homologous recombinase, a 99 bp gene fragment was inserted in reverse into the vector pMD18-P1 between the CDS stop codon and the 3' UTR of SsOLV4, obtaining the corresponding silencing vectors p-Sssfh199, p-SsarA99, and p-Sssre99. PCR detection was performed using specific primers M13-FF and SsOLV4-R1 upstream and downstream of the inserted fragment on pMD18-P1. Figure 9 B indicates that the size of the inserted fragment is correct.
[0080]
[0081] Note: Lowercase letters represent sequences consistent with the carrier.
[0082] 2.2 Obtaining in vitro transcription templates and in vitro transcribed RNA
[0083] Using the constructed p-Sssfh199, p-SsareA99, and p-Sssre99 vectors as templates, and T7SsOLV4-F (5'-TAATACGACTCACTATAGGGgggggtgtccttacggac-3', the lowercase sequence is the sequence corresponding to the T7 promoter) / SsOLV4-R1 (5'-GGGGGTTACCTCCAACGGTACCCAT-3') as primers, the corresponding in vitro transcription templates were amplified using high-fidelity enzymes. Figure 10 Left). RNA was synthesized in vitro using an in vitro transcription kit from NEB, mediated by T7 RNA polymerase. The quality of the RNA obtained from in vitro transcription was determined by agarose gel electrophoresis. Figure 10 right).
[0084] 2.3 PEG-mediated protoplast transfection
[0085] Using *Sclerotium sclerotiorum* DT-8VF as the starting strain, RNA transcribed in vitro from p-Sssfh199, p-SsareA99, and p-Sssre99 vectors was transfected into the strain via PEG-mediated protoplast transfection, yielding nine candidate transfectants from each vector. Viral component verification of the transfected strain was performed, and RT-PCR results showed that RNA transcribed in vitro from all three VIGS vectors could successfully transfect the DT-8VF strain.
[0086] 2.4 Validation of the effect of silencing Sssfh1, SsareA, and Sssre using the SsOLV4-based VIGS vector
[0087] To further verify the silencing effect of the SsOLV4 silencing vector, 3-4 transfectants were randomly selected for each gene. RNA was extracted, and cDNA was obtained by reverse transcription. Specific primers Actin-qpcr-F / Actin-qpcr-R were designed for the internal reference gene Actin, Sssfh1-qpcr-F / Sssfh1-qpcr-R for the Sssfh1 gene, SsareA-qpcr-F / SsareA-qpcr-R for the SsareA gene, and Sssre-qpcr-F / Sssre-qpcr-R for the Sssre gene. The expression levels of the target genes in the transfected strains were quantitatively analyzed by real-time PCR. Four technical replicates and three independent replicates were set for each sample. Ct values were calculated using real-time quantitative PCR, and the expression levels were analyzed using 2... -△△Ct The relative expression levels were calculated using the method, and the data were statistically analyzed and plotted using Prism 8. The significance of the data was analyzed using SPSS one-way ANOVN test (P < 0.01 indicates extremely significant difference). The results showed that the expression levels of the target genes in the SsOLV4-Sssfh199, SsOLV4-SsareA99, and SsOLV4-Sssre99 transformants were all significantly reduced (P < 0.01). The expression levels of the Sssfh1 gene in the SsOLV4-Sssfh199 transfectant decreased by 89.36%, 84.11%, and 84.69%, respectively; the expression levels of the SsareA gene in the SsOLV4-SsareA99 transfectant decreased by 88.88%, 91.51%, 59.88%, and 73.44%, respectively; and the expression levels of the Sssre gene in the SsOLV4-Sssre99 transfectant decreased by 90.83%, 34.46%, 75.35%, and 94.48%, respectively. Figure 12 The constructed SsOLV4-based VIGS vector was confirmed to successfully silence endogenous genes in Sclerotium sclerotiorum.
[0088]
Claims
1. The application of an RNA virus in constructing a VIGS vector system, characterized in that, The RNA virus is selected from viruses whose full-length cDNA sequence has greater than or equal to 80% homology with the sequence shown in SEQ ID NO:
1.
2. The application according to claim 1, characterized in that, The RNA virus is selected from viruses whose full-length cDNA sequence has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% homology with the sequence shown in SEQ ID NO:
1.
3. The application according to claim 1, characterized in that, The VIGS vector system described above is used for gene silencing in Sclerotinia sclerotiorum.
4. The application of vector pMD18-P1 in constructing a VIGS vector system for silencing Sclerotinia sclerotiorum genes or in silencing Sclerotinia sclerotiorum genes, characterized in that, The vector pMD18-P1 contains the full-length cDNA sequence of the RNA virus SsOLV4 shown in SEQ ID NO: 1 and has Amp resistance.
5. A VIGS vector for silencing target genes in Sclerotinia sclerotiorum, characterized in that, The VIGS vector is obtained by inserting the target gene fragment in reverse between the CDS stop codon and the 3'UTR of SsOLV4 in the vector pMD18-P1 under the action of homologous recombinase. The vector pMD18-P1 contains the full-length cDNA sequence of the RNA virus SsOLV4 shown in SEQ ID NO: 1 and has Amp resistance.
6. The VIGS carrier according to claim 5, characterized in that, The target gene fragment is a 39 bp-393 bp fragment located in a conserved structural domain of the target gene, preferably a 99 bp fragment located in a conserved structural domain of the target gene.
7. The VIGS carrier according to claim 5, characterized in that, The target genes were selected from the endogenous genes Sssfh1, SsareA and Sssre of Sclerotinia sclerotiorum; the 99 bp Sssfh1 gene fragment sequence is shown in SEQ ID NO: 6, the 99 bp SsareA gene fragment sequence is shown in SEQ ID NO: 7, and the 99 bp Sssre gene fragment sequence is shown in SEQ ID NO:
8.
8. The method for constructing the VIGS carrier according to claim 5, characterized in that, Includes the following steps: (1) Using the DNA of vector pMD18-P1 as a template, the linearized pMD18-P1 vector was obtained by reverse PCR amplification using primers 3'UTR-F1 / CDS3'-R1, wherein the sequence of primer 3'UTR-F1 is shown in SEQ ID NO: 2 and the sequence of primer CDS3'-R1 is shown in SEQ ID NO: 3; (2) Cloning a 99 bp target gene fragment, and under the action of homologous recombinase, inserting the 99 bp target gene fragment in reverse between the CDS stop codon of SsOLV4 and the 3'UTR in the linearized vector pMD18-P1 obtained in step (1), to obtain the silencing vector p-GFP99.
9. The application of the VIGS vector according to claim 4 in silencing the target genes of Sclerotinia sclerotiorum, preferably in silencing the endogenous genes Sssfh1, SsareA and Sssre of Sclerotinia sclerotiorum.
10. A method for silencing a target gene in *Sclerotinia sclerotiorum*, characterized in that, It includes the following steps: (1) Using T7SsOLV4- as shown in SEQ ID NO:4 and SsOLV4-R1 as shown in SEQ ID NO:5 as primers, and using the VIGS vector described in claim 4 or 5 as template, the corresponding in vitro transcription template is amplified, and RNA is synthesized in vitro by using an in vitro transcription kit under the action of T7 RNA polymerase. (2) Using the Sclerotium sclerotiorum to be edited as the starting strain, the RNA obtained by in vitro transcription in step (1) was transfected into the Sclerotium sclerotiorum to be edited by PEG-mediated protoplast transfection method. The viral components of the transfected strain were verified, and the expression level of the target gene of the transfected strain was quantitatively analyzed by fluorescence quantitative PCR to obtain the positive strain with the target gene silenced.