Kit for detecting Leber hereditary optic neuropathy and application

Abstract

The invention provides a kit for detecting Leber hereditary optic neuropathy and application, and relates to the technical field of biology. The kit comprises: (1) an alkaline lysis solution for releasing mitochondrial DNA in a blood sample; (2) an RPA isothermal amplification reaction system for amplifying the target sequence, wherein the RPA isothermal amplification reaction system comprises an RPA amplification primer; (3) a CRISPR-Cas12a (Clustered Regularly Interspaced Short Palindromic Repeats / Cas12a) system for carrying out high-specificity cutting on a mutation site, wherein the CRISPR-Cas12a system comprises crRNA (Complementary Ribonucleic Acid); and (4) lateral flow chromatography test paper for realizing visual detection. By simplifying the detection process, the kit greatly improves the accessibility of gene diagnosis, so that the gene screening technology can break through the limitation of traditional equipment and is popularized to a wider application scene, and the development of the gene diagnosis technology in the direction of portability, low cost and high precision is promoted. The innovation not only brings a convenient detection tool for gene mutation screening, but also lays a foundation for future gene therapy and personalized medical treatment.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a kit for detecting Leber hereditary optic neuropathy and its application. Background Art

[0002] Leber hereditary optic neuropathy (LHON) is a maternally inherited disease of optic nerve degeneration. There are more male patients, and the onset often occurs between 15 and 35 years old. Clinically, it is mainly manifested as acute or subacute painless visual impairment in both eyes simultaneously or successively, and at the same time, it may be accompanied by central visual field defect and color vision disorder. The severity of visual impairment varies greatly, ranging from completely normal, mild, moderate to severe. Since LHON lacks typical clinical signs in the early stage, and some clinicians lack sufficient understanding of this disease, it is easy to misdiagnose it as amblyopia, optic neuritis and optic atrophy. Based on the molecular pathogenic basis of LHON, screening whether there are 3 primary mutations in the mitochondrial genome of patients through gene detection has become the gold standard for LHON diagnosis, and it is also helpful to guide patients and evaluate the prognosis.

[0003] Affected by the high heterogeneity of mitochondrial DNA, there is a high requirement for the specificity of molecular detection technology; during the normal somatic cell division process, daughter cells obtain the same nuclear genetic material as the mother cell. It should be noted that different from nuclear DNA, along with cytoplasmic division, mtDNA will be randomly and unevenly distributed into daughter cells. If there is mutant mtDNA in the mother cell, daughter cells can obtain different proportions of mutant molecules, and wild-type and mutant mtDNA coexist to form heterogeneity. A large number of studies have shown that mtDNA heterogeneity and mtDNA mutations are related to the weakening (or aging) of body functions and a large number of diseases. Among mitochondrial DNA mutations, different mutation sites may be related to different diseases, and of course, there is also the phenomenon of "multiple causes for one disease". The phenomenon of "multiple causes for one disease" may be caused by the loss of function of genes with similar functions due to different mutations, such as LHON; therefore, when performing molecular detection of LHON, attention should be paid to designing specific primers or probes for the primary mutation sites of this disease to ensure the accuracy of detection.

[0004] Based on the clinical misdiagnosis risk caused by the fact that the mitochondrial DNA mutation load in some early or pre-symptomatic patients may be lower than the detection threshold of some technologies, molecular detection technologies need to have higher detection sensitivity; gene mutation abundance generally refers to the proportion of a mutated allele in all alleles in the gene detection result. We should note that the level of gene mutation abundance has a certain impact on the selection of gene detection technologies. As mentioned when introducing the NGS technology above, if there are some mutation sites with extremely low mutation abundance values in the mtDNA of some LHON patients, which are lower than the sensitivity of the selected detection technology, they will not be shown in the test report, resulting in misdiagnosis. This possibility places very high requirements on the sensitivity of gene detection.

[0005] Traditional LHON molecular detection technologies are time-consuming, and it usually takes several days or even weeks to obtain the screening results. If Sanger sequencing of known mutations is used for rapid screening, the results are usually obtained in 3 - 7 days, but only specific regions can be covered, and secondary detection is required for rare mutations. If NGS is used to detect all mtDNA mutations, although it is more comprehensive, it usually takes one to two weeks. The long waiting time for test results may affect the timely intervention of the disease and bring psychological pressure to patients. To diagnose and treat LHON more efficiently, other rapid and efficient technical principles should be found and applied to the detection of this disease.

[0006] Currently, in most cases, the detection methods available for LHON screening are expensive and not easy to operate, making it difficult to popularize in clinical practice and the market; most of the methods currently mainly used for LHON molecular detection require large-scale instrument equipment. For example, RT-qPCR requires a professional fluorescence quantitative PCR instrument, and NGS requires a high-precision sequencing platform. These devices are expensive and have high requirements for the laboratory environment, needing to meet the standards of relevant national clinical gene amplification laboratories. In addition, operating these devices requires professional personnel who need to undergo strict training and certification, and the device operation is difficult. Therefore, the popularization of traditional LHON molecular detection methods in the market is restricted.

[0007] At the same time, there are differences in the detection costs among different regions and medical institutions, and the insurance coverage also varies. New gene detection technologies with higher costs are usually not covered by medical insurance. In most other regions, gene detection projects need to be paid for by patients themselves. The expensive gene detection fees usually force some patients to give up the detection helplessly, making it difficult to promote the subsequent targeted treatment for these patients. Summary of the Invention

[0008] To solve the technical problems existing in the prior art, an embodiment of the present invention provides a kit for detecting Leber hereditary optic neuropathy and its application. The technical solution is as follows:

[0009] A kit for detecting Leber hereditary optic neuropathy, the kit comprising:

[0010] (1) An alkaline lysis solution for releasing mitochondrial DNA in a blood sample;

[0011] (2) An RPA isothermal amplification reaction system for amplifying a target sequence, which includes RPA amplification primers, wherein the RPA amplification primers are at least one of the following primer pairs: a primer pair consisting of the sequences shown in SEQ ID NO.8 and SEQ ID NO.9, a primer pair consisting of the sequences shown in SEQ ID NO.10 and SEQ ID NO.11, or a primer pair consisting of the sequences shown in SEQ ID NO.12 and SEQ ID NO.13;

[0012] (3) A CRISPR-Cas12a system for highly specific cleavage of mutation sites, wherein the CRISPR-Cas12a system includes crRNA, and wherein the DNA sequence of the crRNA is at least one of the sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3;

[0013] (4) A lateral flow chromatographic test strip for realizing visual detection, wherein the lateral flow chromatographic test strip includes a chromatographic membrane and a conjugate pad, and two bands are fixed on the chromatographic membrane: a quality control line C line and a test line T line, wherein an anti-biotin antibody is coated at the C line, and an anti-FAM antibody is coated at the T line, and gold nanoparticles are loaded on the conjugate pad;

[0014] Wherein, the target sequence includes at least one of the following primary mutation sequences of Leber hereditary optic neuropathy patients: m.3460G>A, m.11778G>A, m.14484T>C.

[0015] Optionally, the alkaline lysis solution is 20-30 mM NaOH or KOH, 0.1-0.3 mM EDTA, with a pH of 11.5-12.5; or

[0016] The alkaline lysis solution is 25 mM NaOH, 0.2 mM EDTA, with a pH of 12.

[0017] Optionally, the kit further includes the following components in separate packages: RPA powder, RPA reaction buffer and / or the fluorescent indicator FAM-BIO, wherein the fluorescent indicator FAM-BIO is a non-specific single-stranded DNA labeled with FAM and Biotin at both ends, and the sequence is FAM-TTATT-Biotin.

[0018] Optionally, the CRISPR-Cas12a system further includes: a Cas12a protein.

[0019] Optionally, the Cas12a protein is a Cas12a protein from a bacterium of the family Lachnospiraceae.

[0020] Use of the kit for detecting Leber hereditary optic neuropathy in the preparation of a reaction system for detecting primary mutation sites of Leber hereditary optic neuropathy in a clinical sample.

[0021] Optionally, the primary mutation site of Leber hereditary optic neuropathy is at least one of the following: m.3460G>A, m.11778G>A, m.14484T>C.

[0022] A lateral flow chromatographic strip for detecting Leber hereditary optic neuropathy, wherein the lateral flow chromatographic strip includes a chromatographic membrane and a conjugate pad, and two bands are fixed on the chromatographic membrane: a control line C and a test line T, wherein an anti-biotin antibody is coated at the C line, and an anti-FAM antibody is coated at the T line, and gold nanoparticles are loaded on the conjugate pad.

[0023] Use of the lateral flow chromatographic strip in the preparation of a kit for detecting Leber hereditary optic neuropathy or a reaction system for detecting primary mutation sites of Leber hereditary optic neuropathy in a clinical sample.

[0024] Optionally, the primary mutation site of Leber hereditary optic neuropathy is at least one of the following: m.3460G>A, m.11778G>A, m.14484T>C.

[0025] The beneficial effects brought by the technical solution provided by the embodiments of the present invention at least include:

[0026] First, by combining the RPA isothermal amplification and CRISPR-Cas12a cleavage detection techniques in the same system, the present invention forms a "one-step" detection process. This method not only significantly simplifies the operation steps, avoids complex reagent handling and contamination risks, but also greatly improves the detection efficiency. Through this integrated solution, the inventors of the present invention can complete the whole process from sample extraction to mutation detection in only 30 minutes, which is not only applicable to the clinical site, but also provides a feasible solution for large-scale genetic screening. In addition, this method does not require expensive equipment support and can be completed with only simple reagents and equipment, providing an ideal tool for primary medical care and home detection;

[0027] An innovative strategy of introducing artificial PAM sequences into RPA primers has expanded the scope of application of Cas12a. This artificial PAM optimization enables Cas12a to recognize more potential mutation sites, increasing the flexibility and applicability of the system. In addition, an artificial mismatch strategy in the seed region of crRNA is combined. By introducing specific mismatch sites in the seed region of crRNA, the system's specific recognition ability for single-base mutations is improved. This strategy effectively reduces the off-target rate and improves the accuracy for target mutation sites, enabling this detection technology to maintain high detection sensitivity and accuracy in complex genetic backgrounds, especially suitable for screening of high-frequency mutation sites;

[0028] Secondly, the combination of CRISPR-Cas12a technology with lateral flow test strips enables device-free, plug-and-play, and visual detection of gene mutations. This kit adopts an integrated design, including RPA isothermal amplification, CRISPR-Cas12a cleavage reaction, and a lateral flow test strip detection platform. Users only need to mix the blood sample with the reagent and heat it, then drop it onto the test strip and let it stand for a few minutes to obtain the test result through a visual "double stripe" color reaction. The innovation of the kit lies in combining the high sensitivity of the CRISPR-Cas12a system with the simplicity of the lateral flow test strip, making the detection of gene mutations not only accurate and fast but also device-free. The lateral flow test strip provides intuitive and easy-to-read results through the color reactions of the T line and C line. This simple operation method is particularly suitable for primary healthcare, home self-testing, and remote screening.

[0029] In addition, the kit is designed with low cost and high stability in mind, ensuring its wide applicability in clinical and home applications. By simplifying the detection process, this kit greatly improves the accessibility of gene diagnosis, enabling gene screening technology to break through the limitations of traditional equipment and popularize to a wider range of application scenarios, promoting the development of gene diagnosis technology towards portability, low cost, and high precision. This innovation not only brings a convenient detection tool for gene mutation screening but also lays a foundation for future gene therapy and personalized medicine. Brief Description of the Drawings

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0031] Figure 1 It is the technical roadmap of the present invention;

[0032] Figure 2Schematic diagram of RPA primer design for the present invention;

[0033] Figure 3 Result diagram of RPA isothermal amplification reaction in Example 3 of the present invention;

[0034] Figure 4 Schematic diagram of CRISPR-Cas12a technology for the present invention;

[0035] Figure 5 Result diagram of crRNA primer test in Example 4 of the present invention;

[0036] Figure 6 Schematic diagram of lateral flow strip design for the present invention;

[0037] Figure 7 Diagram showing that the detection results of LHON patient genotypes in Example 5 of the present invention are consistent with Sanger sequencing results. Detailed implementation manners

[0038] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the present invention and should not be construed as limiting the present invention.

[0039] The present invention provides the following technical solution: An LHON detection kit, which releases mitochondrial DNA in a blood sample through an alkaline lysis solution, pre-amplifies a target sequence by combining RPA isothermal amplification technology, uses the CRISPR-Cas12a system to perform highly specific cleavage on a mutation site, and realizes visual "line-vanishing method" detection through a lateral flow chromatography strip. The target sequence includes all primary mutation sequences of patients with Leber hereditary optic neuropathy: m.3460G>A, m.11778G>A, m.14484T>C.

[0040] The present invention is further configured such that the RPA isothermal amplification and CRISPR-Cas12a cleavage detection technologies are combined in the same system to form a "one-step" detection process. In the RPA amplification reaction system, not only the primer reagents required for RPA are added, but also the Cas12a reaction system is added. Since both the RPA and CRISPR-Cas12a reactions are carried out in a unified system, there is no need to replace the test tube again, and various reaction conditions do not need to be changed, which can be called the one-step method.

[0041] The present invention is further configured to design highly specific crRNA for the LHON mutation site to achieve specific recognition of the LHON mutation site.

[0042] The present invention is further configured such that the dual-mode signal system is constructed, which utilizes two modules of fluorescence and test strip. The dual-mode system can: 1. Drop the reaction solution onto the sample application area of the test strip to develop color through the test strip; 2. Also, the fluorescence intensity of the liquid in the test tube can be monitored in real time by a fluorescence detector for accurate quantification. High-sensitivity detection of low mutation load is achieved, and the reliability of the detection result is improved.

[0043] The present invention is further configured such that the one-step integration of RPA isothermal amplification and CRISPR-Cas12a is used. The isothermal amplification technology is used to amplify nucleic acid molecules at low cost, while the exponential amplification, rapid recognition and cleavage of the CRISPR system greatly improve the detection efficiency and achieve rapid gene mutation screening.

[0044] The present invention is further configured such that the sample detection steps include:

[0045] S1. Sample processing: First, collect the blood sample of the suspected patient, then extract a drop of blood from the sample and mix it with the alkaline lysis solution; by heating the mixture to 95 °C and maintaining it for 5 minutes, the cell membrane can be effectively destroyed and mitochondrial DNA can be rapidly released;

[0046] S2. RPA amplification reaction: The core of the RPA technology is that the recombinase recognizes a specific primer sequence and binds to the single-stranded region of the target DNA sequence to form a primer-target DNA complex; at the same time, the single-stranded binding protein will bind to the target sequence to protect the single-stranded DNA from degradation; subsequently, the DNA polymerase can extend along the DNA strand under constant temperature conditions to generate a DNA strand complementary to the target sequence, achieving a cascade amplification effect to enrich the target nucleic acid;

[0047] S3. CRISPR-Cas12a cleavage reaction: The CRISPR array of the CRISPR-Cas12a system is a DNA fragment composed of short repeated spacer sequences; during the expression and maturation of the CRISPR array, the DNA fragment on it is selectively transcribed into the CRISPR RNA precursor (pre-crRNA); Cas12a itself has an RNA-protein nuclease, which can process the transcribed pre-crRNA into mature crRNA through its own guidance; the Cas-crRNA complex first searches for the site of the protospacer adjacent motif (PAM), and then binds the crRNA spacer sequence to the target DNA homologous sequence through the base complementary pairing principle to specifically target and bind Cas12a to the target site; secondly, Cas12a uses the RuvC nuclease domain to cleave the DNA to generate a sticky-end nick; when the target DNA is cleaved, Cas12a will indiscriminately cleave the surrounding single-stranded DNA;

[0048] S4. Signal Enhancement and Sensitivity Improvement: When the target DNA sequence is recognized and cleaved by Cas12a, Cas12a generates highly active single-stranded DNA nicks, which can further promote the cleavage of non-specific DNA strands, thus achieving signal amplification and providing a stronger signal for subsequent detection. Therefore, non-specific single-stranded DNA is added to the CRISPR-Cas12a system, and a dual strategy of FAM labeling and Biotin labeling is adopted. There are two purposes for such labeling: First, the FAM-labeled DNA will react with the anti-FAM antibody in the lateral flow strip test, while the Biotin-labeled DNA will react with the anti-Biotin antibody to promote the precipitation of gold nanoparticles, thereby enhancing the color development effect of the strip. Second, in the dual-mode signal output system, when FAM binds to single-stranded DNA, due to effects such as steric hindrance and fluorescence quenching, no fluorescence signal will be released in the initial state. However, when the single-stranded DNA is cleaved by Cas12a, the fluorophore will release fluorescence, and as the number of cleaved DNA sequences increases, the intensity of the released fluorescence signal will also increase.

[0049] S5. Lateral Flow Strip Test: When an antibody is used as a biorecognition factor, LFA is also called rapid immunochromatographic strip detection technology. It is a solid-phase membrane immunoassay method developed in the 1980s that combines labeled immunoassay technology and chromatographic separation technology. Among them, the test strip based on the antigen-antibody specificity principle usually includes two bands: the control line (C line) at the bottom and the test line (T line) at the top. The lateral flow chromatographic strip includes a chromatographic membrane and a conjugate pad. Two bands are fixed on the chromatographic membrane: the control line C line and the test line T line. Among them, the C line is coated with anti-biotin antibody, and the T line is coated with anti-FAM antibody. The conjugate pad carries gold nanoparticles. When the intact reporter molecule exists, all the gold nanoparticles will be captured at the control line. If the reporter molecule is cleaved by Cas enzyme, the gold nanoparticles bound to the cleavage fragment cannot be captured by the control line, thus forming a color reaction at the test line. By detecting the presence or absence of the test line, it can be judged whether the Cas enzyme is activated.

[0050] The present invention is further configured such that the kit includes an alkaline lysis solution, RPA amplification primers, crRNA of CRISPR-Cas12a, and a test strip.

[0051] The present invention is further configured such that the clinical sample is a clinical blood sample.

[0052] The present invention is further configured such that the kit is of an integrated design, and the kit includes an RPA isothermal amplification, a CRISPR-Cas12a cleavage reaction, and a lateral flow strip detection platform.

[0053] The present invention is further configured such that the kit combines CRISPR-Cas12a technology with a lateral flow test strip, achieving device-free, plug-and-play gene mutation detection.

[0054] S1 Sample processing

[0055] In this study, blood samples from suspected patients were first collected. Then, a drop of blood was extracted from the sample and mixed with an alkaline lysis solution. By heating the mixture to 95°C and maintaining it for 5 minutes, the cell membrane could be effectively disrupted, and mitochondrial DNA was rapidly released. After thorough mixing, the centrifuge tube was left standing for 5 - 10 minutes to precipitate undigested tissue fragments. This process not only ensured the integrity and purity of DNA but also significantly shortened the sample preparation time, providing a convenient and efficient sample processing solution for subsequent molecular detection. In the prior art, a DNA extraction kit (such as those produced by Tiangen Biotech Co., Ltd.) was used to extract DNA from patient blood in this step, which took 2 - 3 hours to complete the DNA extraction. However, in the present invention, only reagents need to be added and heated at 98°C for 5 minutes, greatly shortening the reaction time. This is also one of the beneficial effects of the present invention. The design of this step aims to minimize the time and operation steps in the traditional DNA extraction process, making this detection method more suitable for rapid diagnosis in clinical settings and low-resource environments.

[0056] S2 RPA amplification reaction

[0057] Recombinase Polymerase Amplification (RPA) is a technology that can replace PCR for nucleic acid amplification. Due to its advantages such as fast detection speed, low operation difficulty, and high sample tolerance, it is widely used for exponential amplification of nucleic acids at a constant temperature to make up for the deficiencies of PCR technology in terms of complex equipment and time consumption.

[0058] The core of RPA technology lies in the use of recombinase to recognize specific primer sequences and bind to the single-stranded region of the target DNA sequence to form a primer-target DNA complex. At the same time, single-strand binding protein binds to the target sequence to protect single-stranded DNA from degradation. Subsequently, DNA polymerase can extend along the DNA strand under constant temperature conditions to generate a DNA strand complementary to the target sequence, achieving a cascade amplification effect to enrich the target nucleic acid.

[0059] Compared with traditional PCR technology, the significant advantage of RPA technology is that it can perform amplification at a constant low temperature (usually 37 - 42°C), without the need for a thermal cycler, reducing the requirements for equipment and cost; the amplification speed is very fast, which can shorten the amplification duration of traditional PCR by 4 times, suitable for on-site detection; it has extremely high tolerance to samples and can be applied to various types of samples such as blood, saliva, urine, etc., without complex pretreatment steps. RPA can be widely applied in fields such as molecular diagnosis, pathogen detection, food safety, and environmental monitoring. Its characteristics of being fast, sensitive, and easy to operate are especially suitable for on-site point-of-care testing and resource-limited environments. RPA technology can also be used in combination with various technologies to improve the specificity and sensitivity of its detection.

[0060] Due to the too low initial content of the template in the system, positive fluorescence signals could not be collected in subsequent experiments. Therefore, the inventor needed to pre-amplify the blood lysate samples. RPA technology helps primers bind to the target DNA with the aid of recombinase and performs amplification under isothermal conditions, without the need for high-temperature cycling equipment and with simple operation. Using RPA technology, the inventor was able to enrich the target DNA region within a short time (about 30 minutes).

[0061] The key to this process lies in designing specific primers to ensure that the amplified target region is related to the mutation, thus providing sufficient DNA templates for subsequent CRISPR-Cas12a cleavage. In addition, the cleavage of Cas12a requires the recognition of a specific PAM sequence. Therefore, the upstream and downstream sequences near the mutation site must contain the PAM sequence to facilitate specific cleavage. When designing RPA primers, the inventor analyzed the sequences of three common mutation sites, ND1, ND4, and ND6, and found that the ND1 sequence has a suitable PAM sequence 5 base pairs away from m.3460G>A. However, the other two mutation sites do not have native PAM sequences. Therefore, the inventor introduced PAM sequences into the RPA primers, enabling Cas12a to be activated and perform specific cleavage after recognizing the PAM in the amplification product.

[0062] S3 CRISPR-Cas12a Cleavage Reaction

[0063] Clustered regularly interspaced short palindromic repeats (CRISPR) and its associated proteins (CRISPR-associated proteins, Cas) form the CRISPR-Cas, an adaptive immune system existing in archaea. Among them, the structurally simple CRISPR-Cas12a is a gene editing tool used to identify and cut specific DNA sequences. In recent years, it has been widely used in the development of new nucleic acid detection methods and is regarded as the "new generation of diagnostic technology".

[0064] The CRISPR array of the CRISPR-Cas12a system is a DNA fragment composed of short repetitive spacer sequences. During the expression and maturation of the CRISPR array, the DNA fragments on it are selectively transcribed into CRISPR RNA precursors (pre-crRNA); Cas12a itself has an RNA-protein nuclease, which can process the transcribed pre-crRNA into mature crRNA through its own guidance. The Cas-crRNA complex first locates the site of the protospacer adjacent motif (PAM), and then binds the crRNA spacer sequence to the target DNA homologous sequence through the base complementary pairing principle, specifically targeting and binding Cas12a to the target site. Secondly, Cas12a uses the RuvC endonuclease domain to cut the DNA, generating a sticky-end nick. When the target DNA is cut, Cas12a will indiscriminately cut the surrounding single-stranded DNA. This property can be used to cleave the fluorescent reporter probe, thereby generating a fluorescent signal for mutation screening.

[0065] Compared with the traditional CRISPR-Cas9 system, CRISPR-Cas12a has obvious advantages: it does not require trans-activation of CRISPR RNA, making its gene editing system more concise and easy to operate, and improving the stability and versatility of the system; due to the stricter requirements of Cas12a for the PAM sequence, it has higher specificity and can significantly reduce off-target effects; Cas12a has non-specific cleavage properties, which can enhance the signal and improve the sensitivity, and has broad application potential in molecular diagnosis and high-sensitivity detection.

[0066] The application of the CRISPR-Cas12a system in gene detection is of great innovation. Its high specificity and efficiency make gene detection more sensitive and accurate, especially showing great potential in disease detection, pathogen identification, and gene mutation analysis. CRISPR-Cas12a can be used for precise detection of specific gene mutations, especially small-scale mutations or point mutations. By designing specific guide RNAs, Cas12a can specifically cleave target DNA, helping to identify and analyze specific types of gene mutations. By cleaving other single-stranded DNA probes to amplify the detection signal, even very small amounts of target DNA can be detected, thus obtaining reliable detection results.

[0067] After the RPA amplification reaction was completed, the present inventors then added the CRISPR-Cas12a system. Cas12a is a nuclease with endonuclease activity that can activate its endonuclease activity after recognizing a specific DNA sequence and cleave the DNA strand. To achieve highly specific cleavage of the mutation site, it is crucial to select a suitable Cas12a and precisely design the crRNA.

[0068] The present inventors selected Lachnospiraceae bacterium Cas12a because it can tolerate single-base mismatches in crRNA. For several sites such as m.3460G>A, m.11778G>A, and m.14484T>C, the corresponding crRNAs were designed respectively. The experimental results showed that mutant DNA could be well distinguished from wild-type DNA.

[0069] S4 Signal Enhancement and Sensitivity Improvement

[0070] When the target DNA sequence is recognized and cleaved by Cas12a, Cas12a will generate highly active single-stranded DNA nicks, which can further promote its cleavage of non-specific DNA strands, thereby achieving signal amplification and providing a stronger signal for subsequent detection. Therefore, the present inventors added non-specific single-stranded DNA to the CRISPR-Cas12a system and adopted a dual strategy of FAM labeling and Biotin labeling. There are two purposes for such labeling: First, the FAM-labeled DNA will react with the anti-FAM antibody in the lateral flow strip test, while the Biotin-labeled DNA will react with the anti-Biotin antibody to promote the precipitation of gold nanoparticles, thereby enhancing the strip color development effect. Second, in the dual-mode signal output system, when FAM binds to the single-stranded DNA, due to effects such as steric hindrance and fluorescence quenching, no fluorescence signal will be released in the initial state. However, when the single-stranded DNA is cleaved by Cas12a, the fluorophore will release fluorescence, and as the number of cleaved DNA sequences increases, the intensity of the released fluorescence signal will also increase. This signal enhancement effect helps the instrument accurately capture the fluorescence signal and supports subsequent quantitative analysis of the copy number of mutant DNA.

[0071] S5 Lateral Flow Test Strip Detection

[0072] Lateral Flow Assay (LFA) is a biochemical analysis method commonly used for rapid diagnosis and detection, especially suitable for on-site rapid detection. It qualitatively detects target substances by utilizing the specific interaction between antigens and antibodies. Its core principle is to detect target substances in a sample based on the specific binding of antigens and antibodies or the hybridization reaction between nucleic acid probes and target nucleic acids under capillary chromatography, and finally generate a visual signal in the reaction area. A traditional lateral flow test strip consists of four components: a sample pad, a conjugate pad, a chromatography membrane, and an absorbent pad. Stacking these four components on a support bottom plate forms a simple lateral flow test strip. The sample pad is a treated fiber membrane or glass wool, used to quickly absorb the sample to be tested and make it flow laterally towards the conjugate pad by capillary action; the conjugate pad is a fiber membrane or glass wool, adsorbed with labeled bioactive materials (such as gold-labeled antibodies), which can bind to the detection target in the sample solution to be tested to form a visible immune complex; the chromatography membrane is mostly a nitrocellulose membrane (NC membrane), which is a key material in lateral flow analysis technology and provides a platform for the reaction between analytes. It is fixed with two or more different bioactive substances, the printed test line (T line) and control line (C line), used to intercept the labeled immune complex and visually display the test result; the absorbent pad is an absorbent cardboard, used to absorb the sample to be tested flowing through the chromatography membrane to balance the pressure difference on both sides of the chromatography membrane and promote more sample to be tested to flow laterally on the chromatography membrane.

[0073] When an antibody is used as the biological recognition factor, LFA is also called immunochromatographic test strip rapid detection technology. It is a solid-phase membrane immunoassay method developed in the 1980s that combines labeled immunoassay technology and chromatographic technology. Among them, a test strip based on the antigen-antibody specific principle usually contains two bands: the lower control line (C line) and the upper test line (T line). The lateral flow test strip includes a chromatography membrane and a conjugate pad. The chromatography membrane is fixed with two bands: the control line C line and the test line T line. Among them, the C line is coated with anti-biotin antibody, and the T line is coated with anti-FAM antibody. The conjugate pad carries gold nanoparticles. When intact reporter molecules are present, the gold nanoparticles will all be captured at the control line. If the reporter molecule is cleaved by Cas enzyme, the gold nanoparticles bound to the cleavage fragment cannot be captured by the control line, thus forming a color reaction at the test line. By detecting the presence or absence of the test line, it can be determined whether the Cas enzyme is activated.

[0074] When the lateral flow chromatography technology is combined with the CRISPR-Cas12a system, it can achieve the detection of target substances with higher sensitivity and specificity, expand the conventional antibody or antigen recognition to the field of nucleic acid detection, and bring about more extensive applications, especially in the fields of genetic disease detection, pathogen detection, and other precision medicine fields. The combination of this technology not only improves the performance of traditional lateral flow chromatography test strips but also brings revolutionary progress to rapid diagnostic technology.

[0075] The kit can achieve visual detection through the lateral flow test strip. This is also one of the beneficial effects of the present invention. First, after mixing the reaction solution in the test tube with the diluent, an appropriate amount of the reaction solution is dropped onto the sample application area of the test strip and left to stand for 5 minutes for color development. The test strip adopts the specific binding design of antigen-antibody and is provided with two detection lines: the T line and the C line. The C line is the control line, which is used to verify whether the experiment is carried out normally, and generates a signal by the binding of anti-biotin antibody to gold-labeled biotin-DNA. The T line is used to detect the presence of the target DNA. When the target DNA amplified by RPA is cleaved by the CRISPR-Cas12a system, the antigen labeled with gold-labeled FAM will competitively bind to the anti-FAM antibody in the T line area, resulting in a change in the refractive index and making the detection line turn red. At the same time, another part of the antigen labeled with gold-labeled biotin will bind to the anti-biotin antibody on the C line, and the C line shows color, presenting a "double bar", indicating a positive result. If the target DNA does not mutate, Cas12a will not cleave it, and all antigens will bind to the C line, and the T line will not show color, presenting a "single bar", which is a negative result.

[0076] The working principle of the present invention:

[0077] Materials related to blood sample treatment include: clinically collected blood samples, alkaline lysis solution (25 mM NaOH, 0.2 mM EDTA, pH≈12), neutralization solution (40 mM Tris-HCl, pH≈5), 1.5 ml centrifuge tubes, distilled water, water bath;

[0078] crRNA design and synthesis: The mutant site sequences are obtained from NCBI (m.3460G>A, m.11778G>A, m.14484T>C), the T7 promoter sequence (5’-TAATACGACTCACTATAGGG-3’), HiScribe TM T7 Quick HighYield RNA Synthesis Kit**(NEB, in vitro transcription kit), RNA Cleanup Kit**(NEB, RNA purification kit)

[0079] RPA amplification reaction: RPA primers corresponding to the target mutation site (such as ND1-RPA-F, ND1-RPA-R, etc., synthesized by GenScript, final concentration 10 μM), RPA buffer and powder mixture, template DNA (10 ng / μl), Cas12a enzyme, Mg 2+ solution, real-time quantitative PCR instrument (42 °C, 20 minutes);

[0080] CRISPR-Cas12a cleavage reaction: Cas12a enzyme (2 μl), crRNA (final concentration 400 ng / μl);

[0081] Lateral flow strip color development: C line: anti-biotin antibody, T line: anti-FAM antibody, the conjugate pad is loaded with gold nanoparticles, ddH2O. Gold nanoparticles are used as color development markers in the lateral flow chromatography strip, showing red or purple, which can be directly observed with the naked eye, mainly used for visual detection of target DNA mutations. It has high stability, good biocompatibility, is not easily degraded or inactivated, is suitable for dry storage, and enables the strip to have a long shelf life. Gold nanoparticles are easy to bind to biomolecules, can bind with antigen-antibodies, and achieve specific recognition of target DNA.

[0082] The present invention provides a rapid detection kit for Leber hereditary optic neuropathy and its application. The present invention will be described in detail below with specific examples.

[0083] Example 1: Extraction of mitochondrial DNA by alkaline lysis method

[0084] 1.1 Blood sample collection

[0085] Collect 20 μl of the blood sample of the subject to be tested, and put the sample into a 1.5 ml centrifuge tube. If it needs to be stored temporarily, it should be transferred to an anticoagulant tube containing EDTA anticoagulant, mixed well and placed in a 4 °C refrigerator. If it needs to be stored for a long time, the sample should be placed in a -20 °C refrigerator.

[0086] Table 1 Genotyping of clinical LHON patients

[0087] A1754 A4537 A4541 A3654 A4515 A2910 A4516 A3383 m.3460G>A - - - + + - - - m.11778G>A - - - - - - ++ + m.14484T>C + + - - - + - -

[0088] +: Heterogeneous DNA, ++: Homozygous DNA, -: No mutation

[0089] 1.2 Reagent preparation

[0090] Alkaline lysis solution (stock solution): 25 mM NaOH dissolved in distilled water, 0.2 mM EDTA, pH about 12;

[0091] Neutralization solution: 40 mM Tris-HCl dissolved in distilled water, pH about 5;

[0092] Prepare the alkaline lysis solution (stock solution) and neutralization solution according to the above content. Mix 1 ml of 250 mM NaOH, 4 μl of 0.5 M EDTA, and 9 ml of distilled water to prepare 10 ml of alkaline lysis solution.

[0093] 1.3 Cell Lysis

[0094] Add 50 μl of alkaline lysis solution to the centrifuge tube. Gently mix to ensure full contact between the sample and the lysis solution.

[0095] Heat treatment: Place the centrifuge tube in a 98°C water bath for 5 minutes to ensure complete lysis.

[0096] Remove the centrifuge tube from the water bath and immediately place it on ice for 5 minutes to terminate the reaction.

[0097] Add 50 μl of neutralization solution to the centrifuge tube. Mix well to make the solution neutral.

[0098] After mixing well, let the centrifuge tube stand for 5 - 10 minutes to precipitate undigested tissue fragments.

[0099] Table 2 DNA concentration after alkaline lysis solution treatment of clinical LHON patients

[0100] LHON patients DNA concentration (ng / μl) A1754 185.5 A4537 180.5 A4541 193.2 A3654 176.8 A4515 183.4 A2910 186.7 A4516 182.5 A3383 188.4

[0101] Note: The DNA concentrations of the control group and the corresponding experimental groups are approximately the same.

[0102] Example 2: Design and synthesis of crRNA

[0103] 2.1 crRNA sequence design

[0104] Design crRNA sequences respectively for the common mutation sites m.3460G>A, m.11778G>A, and m.14484T>C of Leber hereditary optic neuropathy. Ensure that the mutation sites are in appropriate regions during design, and introduce mismatched bases in the crRNA sequences to reduce background signals.

[0105] Table 3 DNA sequences of crRNA used in the present invention

[0106]

[0107] The transcription template sequences of the crRNA used in the present invention are shown in Table 4:

[0108] Table 4 Transcription template sequences of crRNA

[0109]

[0110] Note: In the ND1, ND4, and ND6 sequences (ND1: m.3460G>A; ND4: m.11778G>A; ND6: m.14484T>C), the single-underlined markers indicate the positions of PCR primers, and the double-underlined markers indicate the positions of RPA primers.

[0111] 2.2 Preparation of Transcription Template

[0112] Convert the designed crRNA transcription template sequence into an in vitro transcription template (synthesized by GenScript), and simultaneously prepare the T7 promoter sequence 5’-TAATACGACTCACTATAGGG-3’ (SEQ ID No.7) (synthesized by NEB).

[0113] Take 1 μl of crRNA transcription template and 1 μl of T7 promoter template, add 8 μl of ddH2O, and perform a strand annealing reaction (starting at 95°C and decreasing at a rate of 6°C per minute to 20°C) to form the final in vitro transcription template.

[0114] 2.3 Synthesis and Purification of crRNA

[0115] Use the in vitro transcription kit HiScribe TM T7 Quick High Yield RNA Synthesis Kit (NEB) to synthesize crRNA.

[0116] The synthesized crRNA is purified using the RNA purification kit RNA Cleanup Kit (NEB) to achieve a final concentration of crRNA of 400 ng / μl.

[0117] Example 3: RPA Amplification Reaction and CRISPR-Cas12a Cleavage Reaction

[0118] 3.1 Primer Preparation

[0119] According to the target mutation site, select the corresponding RPA primer pair. For example, for the m.3460G>A site, use the ND1-RPA-F and ND1-RPA-R primer pair; for the m.11778G>A site, use the ND4-RPA-F and ND4-RPA-R primer pair; for the m.14484T>C site, use the ND6-RPA-F and ND6-RPA-R primer pair. As shown in Table 5. The primers are synthesized by GenScript and the final concentration is 10 μM.

[0120] Table 5 RPA Amplification Primers

[0121]

[0122]

[0123] 3.2 Reaction System Configuration

[0124] When detecting the m.3460G>A mutation, the corresponding crRNA shown in Table 3 above and the corresponding PRA primer pair shown in Table 5 should be used for the reaction; when detecting the m.11778G>A mutation, the corresponding crRNA shown in Table 3 and the corresponding PRA primer pair shown in Table 5 should be used for the reaction; when detecting the m.14484T>C mutation, the corresponding crRNA shown in Table 3 and the corresponding PRA primer pair shown in Table 5 should be used for the reaction. The reaction system and the addition amounts of other required reagents are as follows.

[0125] Add the following reagents successively into a sterile centrifuge tube: 29.5 μl of RPA buffer and powder mixture (RPA buffer and powder mixture from DNAAmplification Kits, TwistDx), 2.4 μl of RPA forward primer (10 μM), 2.4 μl of RPA reverse primer (10 μM) (both the forward primer and the reverse primer are the RPA primer pairs in Table 5), 4 μl of fluorescent indicator FAM-BIO (sequence: FAM-TTATT-Biotin, the fluorescent indicator is a non-specific single-stranded DNA labeled with FAM and Biotin at both ends, synthesized by Shanghai Bioengineering Co., Ltd., that is, adding FAM and Biotin labels to both ends of the non-specific single-stranded DNA), 1 μl of template DNA (the DNA extracted in Example 1) (10 ng / μl), 2 μl of Cas12a enzyme (LbCas12a, NEB), 2.5 μl of Mg 2+ solution (in the above RPA kit DNA Amplification Kits, there is a ready-prepared Mg 2+ solution reagent), 1 μl of the corresponding crRNA (400 ng / μl, synthesized in Example 2), and finally add ddH2O to a total volume of 50 μl.

[0126] Mix well with a vortex oscillator for 10 seconds, and then briefly centrifuge (3000 rpm, 10 seconds) to remove the liquid droplets on the tube wall.

[0127] 3.3 Reaction Conditions

[0128] Put the prepared reaction tube into a real-time quantitative PCR instrument, and set the program to a constant temperature reaction at 42 °C for 20 minutes, and collect fluorescence signals every 30 seconds (excitation wavelength 485 nm, emission wavelength 520 nm).

[0129] Experimental Results

[0130] The results of the RPA amplification reaction are shown in Figure 3 . It can be seen from Figure 3 that the primers required for RPA can specifically amplify the DNA of the three mutation sites of m.3460G>A, m.11778G>A and m.14484T>C.

[0131] The results of the CRISPR-Cas12a cleavage reaction can be judged by the color development of the test strip in Example 5 below.

[0132] Use of plasmid DNA in Example 4 (mainly for crRNA verification and screening)

[0133] DNA source: Wild-type and mutant plasmids synthesized by GenScript. After the synthesis of the wild-type and mutant gene fragments, they were cloned into the backbone plasmid of PUC57 (addgene, #54338) and can be independently amplified in vitro. Among them, the sequence of the mutant gene fragment refers to the transcription template sequence of crRNA in Table 4, and the sequence of the wild-type gene fragment is as follows:

[0134] Wild-type gene fragment at m.3460 locus:

[0135] ATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGAC G CCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCTCAACCTAGGCCTCCTATTTATTCTAGCCAC (SEQ ID No.14)

[0136] Wild-type gene fragment at m.11778 locus:

[0137] CCCTTCCTTGTACTATCCCTATGAGGCATAATTATAACAAGCTCCATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCATACTCTTCAATCAGCCACATAGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTC G CATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGA(SEQ ID No.15)

[0138] Wild-type gene fragment at position m.14484:

[0139] CACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAAACACTCACCAAGACCTCAACCCCTGACCCCCATGCCTCAGGATACTCCTCAATAGCCATCGCTGTAGTATATCCAAAGACAACCA T CATTCCCCCTAAATAAATTAAAAAAACTATTAAACCCATATAACCTCCCCCAAAATTCAGAATAATAACACACCCGACCACACCGCTAACAATCAATACTAAACCCCCATAAATAGGAGAAGGCT(SEQ ID No.16)

[0140] Objective: Use PCR technology to amplify DNA and use it for testing crRNA after recovery.

[0141] Implementation steps: Use the PCR primer pairs in Table 6 to amplify the wild-type and mutant at different positions. The PCR amplification system is as follows:

[0142] Table 6 PCR amplification primer sequences

[0143]

[0144] Table 7: PCR Amplification System

[0145]

[0146]

[0147] Table 8: PCR Instrument Settings

[0148]

[0149] Among them, in the PCR system, the DNA is derived from the preparation in the previous step, the primers are synthesized by GenScript, and the Taq enzyme comes from 2X Taq Master Mix of Nanjing Novoprotein Scientific Inc. The amplification products are purified by the PCR product purification kit of Tiangen Biotech Co., Ltd. to remove impurities and obtain a high-purity DNA template. Subsequently, the purified PCR products are diluted to 10 ng / μl, and 1 μl is taken as the test sample for the subsequent one-step detection. The specific steps of the subsequent one-step detection are the same as steps 3.2 and 3.3 of Example 3. The only difference is that the template DNA uses the purified PCR products.

[0150] Experimental Results

[0151] See the experimental results in Figure 5 . Figure 5 This is the test result graph of the crRNA primers of the present invention. As can be seen from Figure 5 , the crRNA can effectively distinguish mutant DNA and WT DNA, and no amplification curve is detected in the negative control, further verifying the reliability of the experimental results.

[0152] Color Development of the Lateral Flow Chromatographic Test Strip in Example 5

[0153] Take 10 μL of the reaction product of Example 3 into a new PCR tube, and then add 40 μL of ddH2O and mix. Insert the lateral flow chromatographic test strip, immerse the sample pad end into the liquid, and read the result after standing at room temperature for 5 - 10 minutes. Among them, the composition of the lateral flow chromatographic test strip is as follows: the lateral flow chromatographic test strip includes a chromatographic membrane and a conjugate pad. There are two bands fixed on the chromatographic membrane: the control line C line and the test line T line. Among them, anti-biotin antibody is coated at the C line, and anti-FAM antibody is coated at the T line. The conjugate pad is loaded with gold nanoparticles. It is customized by Aoki Biotechnology Co., Ltd.

[0154] Result Analysis

[0155] Result Interpretation

[0156] Positive determination: The lateral flow chromatographic test strip shows "two bars", and both the C line and the T line are colored, indicating that the target mutation site exists in the sample.

[0157] Negative determination: If the lateral flow chromatographic test strip shows a "single bar", with the C line showing color and the T line not showing color, it indicates that the target mutation site does not exist in the sample.

[0158] Two cases of m.11778G>A mutant, two cases of m.3460G>A mutant, three cases of blood from patients with m.14484T>C mutation, and the blood of one normal person were taken as controls, and the obtained experimental results were as follows. After detection, it was found that for the loci of m.3460G>A, m.11778G>A, and m.14484T>C, mutant DNA and wild-type DNA could be well distinguished. Among them, the result that the lateral flow chromatographic test strip shows a "double bar" is consistent with the samples in Table 1 of Example 1.

[0159] Figure 7 It is the detection result of the genotype of LHON patients in Example 5 of the present invention, and the color depth of the test strip was compared for quantification. Figure 7 The patient genotype results judged after using the "one-step method" for detection are also consistent with those in Table 1, proving the effectiveness of this method. It can be seen from Figure 7 that A3654 and A4515 are patients with m.3460G>A mutation, A4516 and A3383 are patients with m.11778G>A mutation, and A1754, A4537, and A2910 are patients with m.14484T>C mutation.

[0160] The above is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention can easily think of changes or substitutions, which should all be covered by the protection scope of the present invention. Therefore, the protection scope of the present invention should be subject to the protection scope of the claims.

Claims

1. A kit for detecting Leber hereditary optic neuropathy, characterized in that, The kit includes: (1) An alkaline lysis solution for releasing mitochondrial DNA from a blood sample; (2) An RPA isothermal amplification reaction system for amplifying a target sequence, which includes RPA amplification primers, wherein the RPA amplification primers are at least one of the following primer pairs: a primer pair consisting of the sequences shown in SEQ ID NO.8 and SEQ ID NO.9, a primer pair consisting of the sequences shown in SEQ ID NO.10 and SEQ ID NO.11, or a primer pair consisting of the sequences shown in SEQ ID NO.12 and SEQ ID NO.13; (3) A CRISPR-Cas12a system for highly specific cleavage of mutation sites, wherein the CRISPR-Cas12a system includes a crRNA, and wherein the DNA sequence of the crRNA is at least one of the sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3; (4) A lateral flow chromatographic test strip for realizing visual detection, wherein the lateral flow chromatographic test strip includes a chromatographic membrane and a conjugate pad, and two bands are fixed on the chromatographic membrane: a quality control line C line and a test line T line, wherein an anti-biotin antibody is coated at the C line, and an anti-FAM antibody is coated at the T line, and gold nanoparticles are loaded on the conjugate pad; Wherein the target sequence includes at least one of the following primary mutation sequences of patients with Leber hereditary optic neuropathy: m.3460G>A, m.11778G>A, m.14484T>C.

2. The kit for detecting Leber hereditary optic neuropathy according to claim 1, wherein The alkaline lysis solution is 20 - 30 mM NaOH or KOH, 0.1 - 0.3 mM EDTA, with a pH of 11.5 - 12.5; or The alkaline lysis solution is 25 mM NaOH, 0.2 mM EDTA, with a pH of 12.

3. The kit for detecting Leber hereditary optic neuropathy according to claim 1, characterized in that, The kit further includes the following components in independent packages: RPA powder, RPA reaction buffer, and / or the fluorescent indicator FAM-BIO, wherein the fluorescent indicator FAM-BIO is a non-specific single-stranded DNA labeled with FAM and Biotin at both ends, and the sequence is FAM-TTATT-Biotin.

4. The kit for detecting Leber hereditary optic neuropathy according to claim 1, wherein, The CRISPR-Cas12a system further includes: Cas12a protein.

5. The kit for detecting Leber hereditary optic neuropathy according to claim 4, characterized in that, The Cas12a protein is a Cas12a protein of the family Lachnospiraceae.

6. Use of the kit for detecting Leber hereditary optic neuropathy according to any one of claims 1 - 5 in the preparation of a reaction system for detecting primary mutation sites of Leber hereditary optic neuropathy in a clinical sample.

7. The application according to claim 6, wherein The primary mutation sites of Leber hereditary optic neuropathy are at least one of the following: m.3460G>A, m.11778G>A, m.14484T>C.

8. A lateral flow chromatography test strip for detecting Leber hereditary optic neuropathy, wherein, The lateral flow chromatographic test strip comprises a chromatographic membrane and a conjugate pad. Two bands are immobilized on the chromatographic membrane: a control line C and a test line T. An anti-biotin antibody is coated at the C line, and an anti-FAM antibody is coated at the T line. The conjugate pad is loaded with gold nanoparticles.

9. Use of the lateral flow chromatographic test strip according to claim 8 in the preparation of a kit for detecting Leber hereditary optic neuropathy or in a reaction system for detecting the primary mutation site of Leber hereditary optic neuropathy in a clinical sample.

10. The application according to claim 9, characterized in that, The primary mutation site of the Leber hereditary optic neuropathy is at least one of the following: m.3460G>A, m.11778G>A, m.14484T>C.

Images