Early urine detection target, detection method and kit for Dabetadavirus infected person

Abstract

The invention discloses an early urine detection target, a detection method and a kit for a Databan virus infected person (fever with thrombocytopenia syndrome), and the method comprises the following steps: carrying out sRNA sequencing on urine small RNA of a fever with thrombocytopenia syndrome patient diagnosed by laboratory nucleic acid detection to obtain a series of sRNA sequences; relative quantification is carried out through a tailing method and a qPCR method, and the miR-192-5p sequence which is good in specificity and most significant in relative quantification increase is selected as a detection target. Based on the detection target, a bimetallic super-hydrophilic micropore microarray is developed on the surface of glass, a fluorescence-Raman dual-mode peptide biosensor is constructed, and an early-stage super-sensitive detection kit for patients with fever with thrombocytopenia syndrome is manufactured. The kit can be used for early monitoring and early warning of Dababida virus infection, has the characteristics of high sensitivity, good stability, strong specificity and the like, and has great practical application value.

Description

Technical Field

[0001] The present invention relates to an early urine detection target for Dabie bandavirus-infected patients, a detection method therefor, and a kit, belonging to the technical field of medical detection. Background Art

[0002] Severe fever with thrombocytopenia syndrome (SFTS) is an acute natural epidemic disease caused by infection with Dabie bandavirus [DBV; formerly known as severe fever with thrombocytopenia syndrome bunyavirus (SFTSV)]. This disease is sporadic in mountainous and hilly areas, mostly in summer and autumn, and is often related to tick bites. The main manifestations of SFTS are fever, decreased white blood cell and / or platelet count, lymphadenopathy, fatigue, and gastrointestinal symptoms, etc. The condition is more severe in the elderly, those with underlying diseases, or those with delayed medical treatment, and critically ill patients may die due to multiple organ failure. Currently, most detection methods have the disadvantages of a long incubation period, invasiveness, and inaccurate results, and there is still a lack of a rapid and sensitive diagnostic method. Summary of the Invention

[0003] To solve the above technical problems, the present invention discloses an early urine detection target for Dabie bandavirus-infected patients. The target is obtained by sequencing and relative quantitative differential analysis of small RNAs in the exosomes of the urine of Dabie bandavirus-infected patients, and the small RNA with the most significant difference is obtained, which is the miR-192-5p molecule. The 5'-3' original sequence of the miR-192-5p molecule is: CUGACCUAUGAAUUGACAGCC. By detecting the miR-192-5p sequence in the urine of patients with dengue fever, COVID-19, influenza, and other diseases, it is shown that all are negative, indicating that the potential target has good specificity.

[0004] The above specific target detection method includes the following steps:

[0005] Step 1: Design of fluorescence probe

[0006] Design a fluorescence probe and an anchor sequence that are reverse complementary to the miR-192-5p molecule; the 5'-3' original sequence of the miR-192-5p molecule is: CUGACCUAUGAAUUGACAGCC, the 5'-3' sequence of the fluorescence probe is FAM-GGCTGTCGGTT, and the 5'-3' sequence of the anchor sequence is AuNFs-GGCTGGGTGC;

[0007] Step 2: Construction of superhydrophobic interface and superhydrophilic micropores

[0008] Activate the glass slide to generate multiple independent PAA / PVP microdots on it, create a wettable micropore array with a hydrophobic-hydrophilic interface, and construct a fluorescence-Raman dual-mode peptide sensor;

[0009] Step 3: Reaction process

[0010] For the sensor constructed above, anchor the Ag@AuNFs-Cy5.5-cDNA sequence, sequentially add the extraction sample of small molecule RNA in urine exosomes and the FAM-sDNA solution and elute;

[0011] Step 4: Detection result analysis

[0012] Analysis of the miRNA micropore array, measure the fluorescence and Raman signals of the micropore array under illumination to determine the presence of the target nucleotide.

[0013] Furthermore, the specific operation process of Step 2 is as follows.

[0014] The glass slide is cleaned and hydroxylated, treated in a peroxydisulfuric acid solution (H2SO4 / H2O2 = 7:!3 (v / v)) at 90 °C for 30 minutes, thoroughly rinsed with deionized water, and dried in nitrogen.

[0015] Drop 2 μL of a polyvinylpyrrolidone / polyacrylic acid (PVP / PAA) mixture (using N,N-dimethylformamide as a solvent and adding sulfuric acid) on the dried glass slide to generate the required multiple independent PAA / PVP microdots on the glass slide.

[0016] Immediately immerse the substrate with the deposited PAA / PVP microdots into an OTS solution (in 1% anhydrous toluene) and keep it for 10 minutes; then take out the soaked PAA / PVP, heat it in air at 90 °C for 1 hour to promote the anchoring of OTS molecules, and finally rinse it alternately with toluene, ethanol, and ultrapure water; the prepared sample is coded as OTS-PAA / PVP.

[0017] The substrate with OTS self-assembled on the surface is irradiated through a photomask by a high-pressure mercury lamp UV (150 mW cm -2 ) for 30 minutes to form an interface with different wettabilities.

[0018] Furthermore, the specific operation process of Step 3 is as follows.

[0019] Adjust 3.7 mL of an aqueous HAuCl4 solution to a pH value of 11.0 with 1 mol / L NaOH solution (the final concentration of HAuCl4 is 0.25 mM).

[0020] A mixture of 0.03 mL of NH2OH·HCl solution (40 mM) and 0.3 mL of gold seed solution (25 nm, 0.25 mM) was added to the gold salt solution and reacted at 25 °C (the molar ratio of HAuCl4, NH2OH, and gold seeds was 14:17:1). After reacting for 2 hours, the precipitate was centrifuged at 2400 g for 5 minutes, and the precipitate was dissolved in 200 μL of Millipore-Q water.

[0021] When preparing Ag@AuNFs, 200 μL of hydroxybenzene solution (30 mM), 80 μL of 0.01 M NaOH solution, 120 μL of 0.1 M ascorbic acid, and 0.2 mL of the above AuNFs colloid were successively mixed, and then 10 mM AgNO3 was added under rapid stirring to construct the composite structure Ag@AuNFs-cDNA-tDNA-sDNA in the micro-well.

[0022] Further, the specific operation process of step 4 is as follows.

[0023] Deposit a certain amount of Ag@AuNFs on the micro-well as the active substrate.

[0024] Capture the thiolated cDNA with Cy5.5 dye and couple it to the surface of AuNFs through the thiol group.

[0025] Hybridize different concentrations of cDNA with miRNA capture, then add the probe sDNA-FAM, and incubate in a humid atmosphere chamber at 37 °C for 30 minutes to prevent evaporation of the solution.

[0026] After completion of hybridization, add 0.50 U / mL of Exo I to the micro-well, and then rinse twice with Exo I buffer and PBS buffer respectively to remove any non-specifically adsorbed DNA.

[0027] Measure the fluorescence and Raman signals of the micro-well array under illumination.

[0028] The above detection kit includes the following parts: nucleic acid reaction buffer solution, specific fluorescence probe, fluorescence-Raman dual-mode peptide sensor, and positive control; the nucleic acid reaction buffer solution is a HEPES nucleic acid buffer solution containing sodium and magnesium ions, the specific fluorescence probe is a specific fluorescence probe designed for the nucleic acid sequence of miR-192-5p gene, and the positive control is a DNA fragment consistent with the miR-192-5p sequence.

[0029] Further, the kit also includes a negative blank control.

[0030] Beneficial effects: The present invention conducts early monitoring and warning of Dabie Bandavirus infection through urine, with strong target specificity and low detection limit, and has the advantages of high sensitivity and good stability. Moreover, the person to be tested has no trauma, high cooperation, and low technical requirements for medical staff to collect the detection liquid, and has great practical application value. Description of the Drawings

[0031] Figure 1 It is a schematic diagram of the design process for fabricating micropores on the glass substrate of the present invention.

[0032] Figure 2 It is a schematic diagram of the process for constructing a superhydrophilic micropore array of the present invention.

[0033] Figure 3 It is a schematic diagram of the process for constructing superhydrophilic micropores after ultraviolet irradiation of the present invention.

[0034] Figure 4 It is a detection diagram of the contact angle of the superhydrophilic micropores of the present invention.

[0035] Figure 5 It is a detection diagram of the contact angle of the superhydrophobic interface of the present invention.

[0036] Figure 6 It is a detection schematic diagram of the Zeta potential of gold nanoparticles of the present invention.

[0037] Figure 7 It is a schematic diagram of the production process of gold nanoparticle flowers in the prior art.

[0038] Figure 8A It is a characterization diagram of gold nanoparticles and gold nanoparticle flowers within a 100 nm range under an electron microscope in the examples of the present invention.

[0039] Figure 8B It is a characterization diagram of gold nanoparticles and gold nanoparticle flowers within a 50 nm range under an electron microscope in the examples of the present invention.

[0040] Figure 9A It is the fluorescence absorption spectrum of gold nanoparticle flowers in the examples of the present invention.

[0041] Figure 9B It is the fluorescence Raman scattering spectrum of gold nanoparticle flowers in the examples of the present invention.

[0042] Figure 10 It is a diagram of the identification results of the miRNA sequence with the largest expression difference of the present invention.

[0043] Figure 11 It is a schematic diagram of the fluorescence absorption standard curve prepared from the standard solution in the examples of the present invention.

[0044] Figure 12 It is a schematic diagram of the Raman absorption spectrum intensity standard curve prepared from the standard solution in the examples of the present invention.

[0045] Figure 13 It is a figure showing the sequence-specific identification result of the target miR-192-5p of the present invention. Detailed implementation manners

[0046] The present invention will be further illustrated below in conjunction with the accompanying drawings and specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. After reading the present invention, various equivalent modifications made by those skilled in the art fall within the scope defined by the appended claims of this application.

[0047] Embodiment

[0048] Step 1: Design of fluorescence probe

[0049] Collection, preservation and transportation of samples: In the Department of Infectious Diseases of Jiangsu Provincial People's Hospital, collect 100 ml of early admission urine samples from SFTSV-infected patients; at the same time, collect urine samples from non-SFTSV-infected personnel who come to the Department of Infectious Diseases of this hospital, with 50-100 samples of each category, ensure transportation under biosafety conditions, and store at -80 °C. All urine samples have been approved by the hospital ethics committee and informed consent of the patients, and relevant materials are filed in the collecting hospital.

[0050] Extract total nucleic acid of exosomes from urine samples of Dabie Bandavirus-infected patients and healthy individuals, construct a library and perform non-coding RNA sequencing. After differential sequence alignment, obtain differential miRNA sequences. According to the screening results, has-miR-192-5p has the highest expression level relative to the normal group. As Figure 10 shown, select this molecule as the detection target, which has a lower detection threshold, higher detection sensitivity, and is easier to detect.

[0051] According to the has-miR-192-5p sequence, design an anchor sequence and modify AuNFs-cDNA, design a capture probe and modify sDNA-FAM, and use Clustal X software for alignment. In the design of probe sequences, use Invitrogen tools to analyze the anchor sequence, complementary sequence, capture probe sequence, and the reverse sequence modified with FAM dye as a single DNA to bind to the target sequence to form double-stranded DNA, as shown in Table 1 below.

[0052] Table 1 Probe design scheme for differential miRNA

[0053]

[0054] Step 2: Construction of superhydrophobic interface and superhydrophilic micropores

[0055] Reagents: Sterile water from deionized water (>18 MΩ, RNase-free) was provided by the ultrapure water system of the autoclave.

[0056] Instruments: A contact angle measuring instrument (Jinhe, Jiangsu, China) was used to monitor the changes in the hydrophilic and hydrophobic properties of the HDS-patterned glass slides and spotted micro-wells during the step-by-step preparation process; an inverted fluorescence microscope (Olympus, IX73-DP80, Japan) was used to observe their surface structures; a fluorescence spectrometer (Horiba, FluoroMax-4, Japan) was used to perform fluorescence measurements on miRNAs in the wettable micro-well arrays; a scanning electron microscope (Hitachi E-1010, Horiba Ex-250) and a micro-area analysis system (EDAX) were used to perform elemental mapping measurements on the products; a high-resolution transmission electron microscope (HRTEM, Tecnai G20, FEI) and an X-ray photoelectron spectrometer (Thermo ESCALAB 250XI) were used to characterize AgNCs in the presence and absence of ZIF-8. In addition, the product photos were taken under an ultraviolet lamp at an excitation wavelength of 365 nm.

[0057] Anchoring DNA and probe sequence design scheme

[0058] In the urine samples of patients infected with Dabie Bandavirus, total exosomal nucleic acids were extracted, libraries were constructed and non-coding RNA was sequenced. After differential sequence alignment, differential miRNA sequences were obtained. Capture probe sDNA was designed as the complementary sequence of the target sequence and aligned using Clustal X software. In primer design, Invitrogen tools were used to analyze the new complementary probes. The capture probe sequence was functionalized with a thiol group and a Cy 5.5 dye at the 5' end and was complementary to the 3' end of the target sequence. The reverse sequence modified with a FAM dye served as a single-stranded DNA to bind to the target sequence to form double-stranded DNA.

[0059] Preparation of superhydrophobic interface & superhydrophilic micro-wells

[0060] The preparation steps for the amino-derivatization treatment on the superhydrophilic micro-well array are as Figure 1 shown:

[0061] The glass slides were cleaned and hydroxylated, treated in a peroxymonosulfuric acid solution (H2SO4 / H2O2 = 7:3 (v / v)) at 90 °C for 30 minutes, thoroughly rinsed with deionized water, and dried in nitrogen.

[0062] Add 2 μL of polyvinylpyrrolidone / polyacrylic acid (PVP / PAA) mixture (using N,N-dimethylformamide as a solvent and adding sulfuric acid) onto the glass slide to generate multiple independent PAA / PVP microdots required on the glass slide; the obtained sample is encoded as PAA / PVP microdots.

[0063] The substrate on which the PAA / PVP microdots are deposited is immediately immersed in OTS solution (in 1% anhydrous toluene) for 10 minutes; then the immersed PAA / PVP is taken out and heated with air at 90 °C for 1 hour to promote the anchoring of OTS molecules, and then rinsed alternately with toluene, ethanol, and ultrapure water; the prepared sample is encoded as OTS-PAA / PVP, as Figure 2 shown.

[0064] As Figure 3 shown, the substrate with OTS self-assembled on the surface is irradiated through a photomask with high-pressure mercury lamp UV (about 150 mW cm -2 ) for 30 minutes to form an interface with different wettabilities. Then, further XPS characterization is carried out on the activated glass slide, the substrate with PAA deposited, the substrate with OTS assembled (OTS-PAA / PVP), and the substrate irradiated with UV (UV-OTS-PAA / PVP), as Figure 4 shown. According to the contact angle, the hydrophobic degree of the micropores is judged. Those with a contact angle less than 90 degrees are hydrophilic micropores, and Figure 5 shown. According to the contact angle, the hydrophobic degree of the micropores is judged. Those with a contact angle greater than 90 degrees are hydrophobic micropores. The area without UV irradiation remains superhydrophobic; on the contrary, the area irradiated with UV becomes superhydrophilic due to the photolysis of OTS, constructing a superhydrophobic interface and superhydrophilic micropores.

[0065] Characterization of superhydrophilic micropore arrays

[0066] Based on the established microhole array platform, the glass slide immersed in hydrogen peroxide solution has abundant hydroxyl bonds (-OH), and the water contact angle (WCA) is 31.11°. The PVP / PAA solution dropped on the hydroxylated surface forms PAA microdots after evaporation, and its WCA is 26.18°, indicating that the surface has superhydrophilicity. The prepared PAA / PVP deposition substrate, namely multiple PAA / PVP microdots on the activated glass slide, has many surface hydroxyl groups, and is expected to be used as self-assembly points for inducing OTS molecules, and form a self-assembled monolayer of OTS (OTS-SAM) through Si-O-Si covalent bonds, and obtain a superhydrophobic property with a WCA of 148.55°. The OTS-PAA / PVP substrate was exposed to ultraviolet light to selectively remove the OTS molecules on the surface of the PAA / PVP micro-wells through a photomask, thus creating superhydrophilic micro-wells on the superhydrophobic surface. Since there are still long-chain alkyl groups (C18H37-) preventing water molecule bonding, the glass slide covered with masked OTS remains superhydrophobic, with a WCA of 139.0°. On the contrary, the OTS-PAA / PVP area exposed to ultraviolet light becomes superhydrophilic due to the photolysis of OTS, and the WCA decreases to 28.4°. A PAA / PVP micro-well array surrounded by a superhydrophobic OTS-SAM interface was formed on the glass slide.

[0067] As Figure 6 shown, the PAA / PVP substrate, OTS-PAA / PVP substrate, and ultraviolet-irradiated OTS-PAA / PVP substrate were analyzed by inverted fluorescence microscopy imaging (IFMI), scanning electron microscopy (SEM), atomic force microscopy (AFM), and Fourier transform infrared (FT-IR).

[0068] Synthesis and Characterization of Bimetallic-Gold Nanoparticle Flowers

[0069] As Figure 7Shown are the synthesis of gold nanoparticles and gold nanoflowers in the prior art. This application has made modifications. First, 3.7 mL of an aqueous HAuCl4 solution was adjusted to a pH of 11.0 with 1 mol / L NaOH solution (the final concentration of HAuCl4 was 0.25 mM). Then, a mixture of 0.03 mL of NH2OH·HCl solution (40 mM) and 0.3 mL of gold seed solution (25 nm, 0.25 mM) was added to the gold salt solution, and the reaction was carried out at 25 °C (the molar ratio of HAuCl4, NH2OH, and gold seeds was 14:17:1). After reacting for 2 hours, the precipitate was centrifuged at 2400 g for 5 minutes, and the precipitate was dissolved in 200 μL of Millipore-Q water. When preparing Ag@AuNFs, 200 μL of hydroxybenzene solution (30 mM) was successively mixed with 80 μL of 0.01 M NaOH solution, 120 μL of 0.1 M ascorbic acid, and 0.2 mL of the above AuNFs colloid, and then 10 mM AgNO3 was added with rapid stirring. Five minutes later, the color of the solution changed from purple to pink, depending on the amount of Ag+ added.

[0070] The plasmonic properties of AuNFs and Ag@AuNFs were measured using a UV-visible spectrometer, such as Figure 8A and Figure 8B shown. Their detailed structures were characterized by transmission electron microscopy (TEM) and scanning electron microscopy (SEM), which are the characterization diagrams in the ranges of 100 nm and 50 nm respectively.

[0071] Using the fluorescence and SERS response design principles of the Ag@AuNFs-Cy5.5-cDNA and FAM-sDNA conjugates can pave the way for the dual-mode quantitative detection of the Dabie Bandavirus. As Figure 9A and Figure 9B shown, a composite structure Ag@AuNFs-cDNA-tDNA-sDNA was successfully constructed in the micro-well. Based on the DNA hybridization method, a mixture of Cy5.5-cDNA, miRNA, and FAM-sDNA was added successively. The droplets were directionally attached to the hydrophilic micro-wells and formed spheres, showing high uniformity and repeatability, with uniform fluorescence intensity. The Ag@AuNFs-cDNA-MiRNA-sDNA-FAM complex aggregated on the super-hydrophilic micro-wells due to the super-hydrophobic interface, and the tests between the micro-wells did not interfere with each other, enabling the simultaneous detection of multiple samples.

[0072] Step 3: Reaction process

[0073] Array-based fluorescence and Raman detection

[0074] Different concentrations of miRNA sequences after infection with the Dabiebanda virus were prepared (in PBS buffer). The microwell array analysis of miRNA was as follows: First, a certain amount of Ag@AuNFs was deposited on the microwells as an active substrate, and then the thiolated cDNA with Cy5.5 dye was captured and coupled to the surface of AuNFs through the thiol group. Different concentrations of cDNA were hybridized with the miRNA capture, and then the probe sDNA-FAM was added and incubated in a humidified atmosphere chamber at 37°C for 30 minutes to prevent solution evaporation. After hybridization, 0.50U / mL of Exo I was added to the microwells, and then washed twice with Exo I buffer and PBS buffer respectively to remove any nonspecifically adsorbed DNA. Finally, the fluorescence and Raman signals of the microwell array were measured under illumination.

[0075] Step 4: Analyze test results

[0076] Detection system construction

[0077] Raman and fluorescence standard curve preparation

[0078] Fluorescence and Raman detection were performed using standard concentrations of exosome MiRNA prepared in the laboratory. By preparing a standard concentration of exosome MiRNA solution, after anchoring the Ag@AuNFs-Cy5.5-cDNA sequence on the mature microarray, MiRNA solution and FAM-sDNA solution were added in sequence, eluted twice with PBS buffer, and then the fluorescence absorption intensity was measured to obtain the fluorescence intensity values shown in Table 2. Figure 11 The standard curve reveals the correlation between miRNA sequence concentration and fluorescence absorption intensity.

[0079] Table 2 Fluorescence absorption detection results after gold nanoparticles anchored probe sequence

[0080]

[0081] Similarly, the Ag@AuNFs-Cy5.5-cDNA sequence was anchored on the mature microarray and the standard concentration of MiRNA solution and FAM-sDNA solution were added in sequence and eluted. After the fluorescence absorption intensity was measured, Raman spectroscopy was immediately performed to obtain the intensity values shown in Table 3. Figure 12 The standard curve reveals the correlation between miRNA sequence concentration and Raman absorption spectrum intensity.

[0082] Table 3 Raman spectroscopy detection of gold nanoparticles after anchoring probe sequences

[0083]

[0084] Sensitivity and specificity calculation

[0085] The change in steady-state fluorescence intensity shows a linear relationship with the miRNA concentration. In the range of 10 -13 to 10 -3 mol / L, the R2 value is 0.99, as shown in Figure 11 . The signal intensity of the Raman peak at 725 cm -1 obtained from different target concentrations shows a wide dynamic range of 10 -3 to 10 -13 mol / L, as shown in Figure 12 . The limit of detection (LOD) and limit of quantification (LOQ) can be seen from the standard curve. Both the fluorescence absorption intensity and the Raman spectral absorption intensity can reach 10 -13 M, which are 0.446×10 -13 M and 0.789×10 -13 M respectively. Therefore, we conclude that the sensitivity of the dual-mode peptide detection technique is 10 -13 M for exosomal miRNA concentration.

[0086] Coefficient of variation (also known as imprecision, CV) verification

[0087] According to the limit of detection of the dual-metal fluorescence-Raman dual-mode peptide sensor constructed, low-concentration detection was repeated for imprecision verification. As shown in Table 3 below, multiple measurements were carried out using the "-13" molar concentration, and the values are as follows. The STDEV function in Excel was used to calculate the standard deviation. The syntax of the STDEV function is STDEV(value1,[value2],…), and the calculation formula is as follows.

[0088]

[0089] Table 4. Fluorescence absorption detection results after the gold nanoparticle flower is anchored with the probe sequence

[0090]

[0091] According to the above method, for the limit of detection of the dual-metal fluorescence-Raman dual-mode peptide sensor constructed, low-concentration detection was repeated for imprecision verification. As shown in Table 4 below, multiple Raman intensity measurements were carried out using the "-13" molar concentration, and the values are as follows. The STDEV function in Excel was used to calculate the standard deviation. The syntax of the STDEV function is STDEV(value1,[value2],…), and the calculation formula is as follows.

[0092]

[0093] Table 5. Raman spectrum detection after the gold nanoparticle flower is anchored with the probe sequence

[0094]

[0095] Determination of the limit of detection

[0096] According to the calculation formula of the detection limit, the detection range of the fluorescence-Raman dual-mode peptide biosensor for hsa-miR-192-5p CUGACCUAUGAAUUGACAGCC is determined as follows:

[0097] DL = 3So / S (where: DL - detection limit, S - slope of the standard curve, So - standard deviation).

[0098] Table 6 Detection limits of the two methods

[0099]

[0100] Clinical sample detection

[0101] According to the test detection process, for the constructed bimetallic fluorescence-Raman dual-mode peptide sensor, Ag@AuNFs-Cy5.5-cDNA sequence was sequentially anchored, and the miRNA extraction sample of SFTS patient urine and FAM-sDNA solution were sequentially added and eluted. Five febrile patients with positive diagnosis of Dabiebandavirus nucleic acid collected from the Infectious Disease Department of Jiangsu Provincial People's Hospital were detected, and the results are shown in Table 7 below.

[0102] Table 7 Fluorescence and Raman detection values of urine samples

[0103]

[0104] "+" indicates a positive test result, and "-" indicates a negative test result.

[0105] It can be seen from the results in Table 7 that the detection method of this experiment is accurate and highly reliable, and has great practical application value.

[0106] For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and can be implemented in other specific forms without departing from the spirit or basic characteristics of the present invention. Therefore, from any point of view, the embodiments should be regarded as exemplary and non-limiting. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be encompassed within the present invention. Any reference signs in the claims should not be construed as limiting the claimed rights.

[0107] In addition, it should be understood that although this specification is described according to embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. An early urine detection target for Dabo Bandavirus-infected individuals, characterized in that, The target is the miR-192-5p molecule, and the original sequence of the 5'-3' end of this miR-192-5p molecule is: CUGACCUAUGAAUUGACAGCC. This molecule is the small molecule RNA with the most significant difference obtained after sequencing and relative quantitative difference analysis of small molecule RNAs in the urine exosomes of Dabie Bandavirus-infected individuals.

2. A specific target detection method for the early urine of Dabie Bandavirus-infected patients, characterized in that, The method includes the following steps: Step 1: Design of fluorescent probe Design a fluorescent probe and an anchor sequence that are reverse complementary to the miR-192-5p molecule; the original sequence of the 5'-3' end of the miR-192-5p molecule is: CUGACCUAUGAAUUGACAGCC, the sequence of the 5'-3' end of the fluorescent probe is FAM-GGCTGTCGGTT, and the sequence of the 5'-3' end of the anchor sequence is AuNFs-GGCTGGGTGC; Step 2: Construction of superhydrophobic interface and superhydrophilic micropores Activate the glass slide, generate multiple independent PAA / PVP microdots on it, create a wettable micropore array with a hydrophobic-hydrophilic interface, and construct a fluorescence-Raman dual-mode peptide sensor; Step 3: Reaction process For the sensor constructed above, anchor the Ag@AuNFs-Cy5.5-cDNA sequence, and sequentially add the extraction sample of small molecule RNAs in urine exosomes and the FAM-sDNA solution and elute; Step 4: Analysis of detection results Microarray analysis of miRNA, measure the fluorescence and Raman signals of the micropore array under illumination to determine the presence of the target nucleotide.

3. The detection method according to claim 2, wherein The specific operation process of Step 2 is as follows. The glass slide is cleaned and hydroxylated, treated in a peroxysulfuric acid solution (H2SO4 / H2O2 = 7:3 (v / v)) at 90 °C for 30 minutes, thoroughly rinsed with deionized water, and dried in nitrogen. Drop 2 μL of a polyvinylpyrrolidone / polyacrylic acid (PVP / PAA) mixture (using N,N-dimethylformamide as a solvent and adding sulfuric acid) on the dried glass slide to generate the required multiple independent PAA / PVP microdots on the glass slide. Immediately immerse the substrate deposited with the above PAA / PVP microdots in an OTS solution (in 1% anhydrous toluene) and keep it for 10 minutes; then take out the immersed PAA / PVP, heat it in air at 90 °C for 1 hour to promote the anchoring of OTS molecules, and finally rinse it alternately with toluene, ethanol, and ultrapure water; the prepared sample is encoded as OTS-PAA / PVP. The substrate with an OTS self-assembled surface is irradiated through a photomask for 30 minutes by UV of a high-pressure mercury lamp (150 mW cm -2 ) to form interfaces with different wettabilities.

4. The detection method according to claim 2, wherein The specific operation process of Step 3 is as follows. Adjust the pH value of 3.7 mL of an aqueous HAuCl4 solution to 11.0 with 1 mol / L NaOH solution (the final concentration of HAuCl4 is 0.25 mM). A mixture of 0.03 mL of NH2OH·HCl solution (40 mM) and 0.3 mL of gold seed solution (25 nm, 0.25 mM) was added to the gold salt solution and reacted at 25 °C (the molar ratio of HAuCl4, NH2OH and gold seeds was 14:17:1). After reacting for 2 hours, the precipitate was centrifuged at 2400 g for 5 minutes, and the precipitate was dissolved in 200 μL of Millipore-Q water. When preparing Ag@AuNFs, 200 μL of hydroxybenzene solution (30 mM), 80 μL of 0.01 M NaOH solution, 120 μL of 0.1 M ascorbic acid and 0.2 mL of the above AuNFs colloid were successively mixed, and then 10 mM AgNO3 was added under rapid stirring to construct a composite structure Ag@AuNFs-cDNA-tDNA-sDNA in the micro-well.

5. The detection method according to claim 2, wherein The specific operation process of step 4 is as follows. A certain amount of Ag@AuNFs was deposited on the micro-well as an active substrate. The thiolated cDNA with Cy5.5 dye was captured and coupled to the surface of AuNFs through the thiol group. cDNA with different concentrations was hybridized with miRNA capture, and then the probe sDNA-FAM was added and incubated in a humid atmosphere chamber at 37 °C for 30 minutes. After hybridization was completed, 0.50 U / mL of Exo I was added to the micro-well, and then washed twice with Exo I buffer and PBS buffer respectively to remove any non-specifically adsorbed DNA. The fluorescence and Raman signals of the micro-well array were measured under illumination.

6. An early urine detection kit for Dobrava virus infected patients, characterized in that, It includes the following parts: nucleic acid reaction buffer solution, specific fluorescent probe, fluorescence-Raman dual-mode peptide sensor and positive control; the nucleic acid reaction buffer solution is a HEPES nucleic acid buffer solution containing sodium and magnesium ions, the specific fluorescent probe is a specific fluorescent probe designed for the nucleic acid sequence of miR-192-5p gene, and the positive control is a DNA fragment consistent with the miR-192-5p sequence.

7. The kit according to claim 6, wherein, The kit also includes a negative blank control.

Images