Genetic structure variation of IGF2BP1 gene regulatory region and application thereof

Abstract

The invention provides a genetic structure variation of an IGF2BP1 gene regulatory region and application of the genetic structure variation. Specifically, the invention provides a structural variation molecular marker related to duck growth and development, the structural variation molecular marker is located at upstream 1.7 kb of an IGF2BP1 gene on a chromosome Chr28, and the structural variation molecular marker has a nucleotide sequence as shown in SEQ ID NO: 1. The structural variation molecular marker can up-regulate the expression of the IGF2BP1 gene so as to promote the growth and development of ducks, provides a theoretical basis and a genetic basis for breeding or cultivating duck varieties with excellent growth traits, and is beneficial to improving the breeding efficiency and accelerating the duck breeding process.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to a genetic structural variation in the regulatory region of the IGF2BP1 gene and its application. Background Art

[0002] China is one of the countries with the richest waterfowl genetic resources in the world. The waterfowl genetic resources are not only numerous in quantity, but also diverse in germplasm characteristics. Based on the different characteristics of local breeds, some specialized breeds have been cultivated. In traditional breeding, seeds are usually selected based on phenotypic traits determined by individual measurement, sib measurement or progeny measurement. However, the traditional breeding method cannot perform early seed selection, which increases the generation interval and reduces the selection response.

[0003] Molecular markers are developed based on polymorphic motifs within functional genes that cause phenotypic trait variations. Once the genetic effect is mapped to a specific functional motif, functional markers developed based on this correlation can determine the presence or absence of the target gene in different genetic backgrounds without further verification, reflecting the performance of the target trait. Therefore, the target gene can be accurately detected and tracked, and its genetic effect value has universality and high reliability, which is effective for both artificial breeding populations and natural populations. Currently, there is still a lack of molecular markers that can be used for early seed selection.

[0004] Traditional breeding methods have problems of low efficiency and too long cycle. The rapid development of duck genomics and molecular biology technologies has brought new opportunities for the improvement of its production efficiency. Exploring and verifying candidate genes and molecular markers related to important economic traits of ducks using genomics and molecular biology technologies can not only improve breeding efficiency, shorten the breeding cycle, but also enhance the economic benefits of duck production.

[0005] Therefore, developing a breeding strategy based on molecular markers is of great significance for accelerating the cultivation of excellent duck local breeds with good production performance and improving the economic efficiency of the duck industry. Summary of the Invention

[0006] The present invention aims to solve at least one of the technical problems existing in the prior art to some extent. The present invention provides a structural variation (SV) molecular marker related to duck growth and development. This structural variation molecular marker can regulate the expression of the IGF2BP1 gene, and thus has a certain influence on the growth and development of ducks. Therefore, this molecular marker provides a theoretical basis and genetic foundation for breeding or cultivating duck breeds with excellent growth traits, which is beneficial to improving breeding efficiency and accelerating the duck breeding process.

[0007] Therefore, in the first aspect of the present invention, the present invention provides a structural variant molecular marker related to duck growth and development. According to an embodiment of the present invention, the structural variant molecular marker is located 1.7 kb upstream of the IGF2BP1 gene on chromosome Chr28, and the structural variant molecular marker has a nucleotide sequence as shown in SEQ ID NO:2. Through a large number of experiments, the inventors found that the structural variant molecular marker of the present invention can regulate the expression of the IGF2BP1 gene, and the IGF2BP1 gene can regulate duck growth and development. Thus, by identifying the type of this molecular marker existing in the duck genome, the growth traits of ducks can be judged through molecular screening at an early stage, and early selection and breeding of duck individuals can be carried out. While reducing the breeding cost, the growth traits can be improved, and the breeding process of ducks can be accelerated.

[0008] In the second aspect of the present invention, the present invention provides a primer pair for amplifying the structural variant molecular marker described in the first aspect. According to an embodiment of the present invention, the primer pair includes: an upstream primer and a downstream primer; the sequence of the upstream primer is as shown in SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7, and the sequence of the downstream primer is as shown in SEQ ID NO:4, SEQ ID NO:6 or SEQ ID NO:8. Using the primer pair of the present invention for amplification experiments can specifically amplify the structural variant molecular marker described in the first aspect. Thus, using this primer pair, the genomic DNA of the duck to be tested can be amplified, and based on the amplified product, the duck to be tested with the sequence of SEQ ID NO:1 or SEQ ID NO:2 can be selected for breeding or cultivation, which accelerates the duck breeding process.

[0009] In the third aspect of the present invention, the present invention provides a kit. According to an embodiment of the present invention, the kit includes the primer pair described in the second aspect. The kit provided by the present invention can quickly, simply and conveniently perform PCR amplification on the genomic DNA of ducks to obtain molecular markers, and select the duck to be tested with the sequence of SEQ ID NO:1 or SEQ ID NO:2 for breeding or cultivation according to the sequence of the molecular marker, which accelerates the duck breeding process.

[0010] In the fourth aspect of the present invention, the structural variant molecular marker described in the first aspect, the primer pair described in the second aspect or the kit described in the third aspect has at least one of the following uses: for predicting or assisting in predicting the growth and development phenotype of ducks; for determining or assisting in determining duck strains or duck breeds; for screening or assisting in screening duck individuals, duck strains or duck breeds with fast growth and development.

[0011] In the fifth aspect of the present invention, a method for evaluating the growth and development of ducks is proposed. According to an embodiment of the present invention, the method includes: using the genomic DNA of the duck to be tested as a template, performing PCR amplification with the primer pair described in the second aspect, and comparing the amplification result with the structural variation molecular marker described in the first aspect; based on the comparison result, determining the growth and development status of the duck to be tested. As described above, the structural variation molecular marker of the present invention can regulate the expression of the IGF2BP1 gene, and the IGF2BP1 gene can regulate the growth and development of ducks. Therefore, the method of the present invention can quickly and simply evaluate the growth and development status of the duck to be tested, thereby improving the breeding efficiency and accelerating the duck breeding process.

[0012] In the sixth aspect of the present invention, a method for duck breeding is proposed. According to an embodiment of the present invention, the method includes: using the genomic DNA of the duck to be tested as a template, performing PCR amplification with the primer pair described in the second aspect, and comparing the amplification result with the structural variation molecular marker described in the first aspect; selecting the duck to be tested with the sequence shown in SEQ ID NO:1 or SEQ ID NO:2 for breeding or cultivation. As described above, the structural variation molecular marker of the present invention can regulate the expression of the IGF2BP1 gene, and the IGF2BP1 gene can regulate the growth and development of ducks. Therefore, the method of the present invention can quickly and simply screen out the ducks to be tested with excellent growth traits for breeding, thereby improving the breeding efficiency and accelerating the duck breeding process.

[0013] In the seventh aspect of the present invention, the use of the structural variation molecular marker described in the first aspect, the primer pair described in the second aspect, the kit described in the third aspect, the method for evaluating the growth and development of ducks described in the fourth aspect, or the method for duck breeding described in the fifth aspect in assisted breeding is proposed.

[0014] In the eighth aspect of the present invention, a method for cultivating duck breeds is proposed. According to an embodiment of the present invention, the method includes: using gene editing technology to insert the structural variation molecular marker described in the first aspect into the upstream 1.7 kb of the IGF2BP1 gene on chromosome Chr28 of the duck to be cultivated. The structural variation molecular marker of the present invention can up-regulate the expression of the IGF2BP1 gene and promote the growth and development of ducks. Therefore, through this method, duck breeds with relatively excellent growth traits can be cultivated, which is beneficial to improving the breeding efficiency and accelerating the duck breeding process.

[0015] In the ninth aspect of the present invention, a method for determining duck breeds is proposed. According to an embodiment of the present invention, the method includes: using the genomic DNA of the duck to be tested as a template, performing PCR amplification with the primer pair described in the second aspect, and comparing the amplification result with the structural variation molecular marker described in the first aspect; based on the comparison result, determining the breed of the duck to be tested. As described above, the structural variation molecular marker of the present invention mainly exists in Pekin ducks and can regulate the expression of the IGF2BP1 gene in ducks. Therefore, the method of the present invention can quickly and simply determine the breed of the duck to be tested, thereby improving the breeding efficiency and accelerating the duck breeding process.

[0016] Additional aspects and advantages of the present invention will be given in part in the following description, become apparent in part from the following description, or be understood through the practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The above and / or additional aspects and advantages of the present invention will become apparent and be readily understood from the following description of the embodiments in conjunction with the accompanying drawings, in which:

[0018] Figure 1 is a distribution diagram of the genetic differentiation index (FST value) of structural variations among five population groups according to an embodiment of the present invention;

[0019] Figure 2 is a grouping diagram of dividing 185 duck samples into 15 combinations according to an embodiment of the present invention (sub-pre is the abbreviation of subcutaneous preadipocyte, indicating subcutaneous fat pre-cells; sebum indicates sebum; liver indicates liver; breast-muscle indicates pectoralis major muscle; brain indicates brain);

[0020] Figure 3 is an expression diagram of genes downstream of adjacent highly differentiated structural variations (SVs) according to an embodiment of the present invention; wherein, from left to right in the figure are: the normalized FPKM values of genes in different samples; the P values of 15 pairs of RNA-seq data sets between Pekin ducks or domestic ducks and mallards;

[0021] Figure 4 is the relative position of the structural variation molecular marker and its adjacent genes according to an embodiment of the present invention;

[0022] Figure 5 is the expression of the IGF2BP1 gene in different tissues of Pekin ducks (Pekin) and mallards (MA) according to an embodiment of the present invention;

[0023] Figure 6The figure shows the results of gel electrophoresis of PCR products of Pekin ducks and Mallard ducks according to an embodiment of the present invention;

[0024] Figure 7 The figure shows the results of a dual-luciferase reporter assay for structural variations in DF-1 cells according to an embodiment of the present invention. The data are expressed as the mean ± standard deviation, representing the activity difference between the Pekin allele (SV) and the Mallard allele (non-SV) at these four SV sites. *** The p value < 0.001. Detailed implementation manners

[0025] Embodiments of the present invention will be described in detail below. The following described embodiments are exemplary and are only used to explain the present invention and should not be construed as a limitation of the present invention.

[0026] It should be noted that the terms "first" and "second" are only used for descriptive purposes and cannot be construed as indicating or implying relative importance or implicitly indicating the quantity of the indicated technical features. Thus, the features defined with "first" and "second" may explicitly or implicitly include one or more of such features. Further, in the description of the present invention, unless otherwise specified, the meaning of "plural" is two or more.

[0027] Detailed description of the present invention

[0028] Definitions and general terms

[0029] To make it easier to understand the present invention, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention pertains.

[0030] In this document, the term "comprising" or "including" is an open expression, that is, it includes the content specified by the present invention, but does not exclude other aspects.

[0031] In this document, the terms "optionally", "optional" or "option" generally mean that the subsequent event or condition may or may not occur, and this description includes the case where the event or condition occurs and the case where the event or condition does not occur.

[0032] In this document, the term "domestic" refers to domesticated ducks or domesticated ducks, simply referred to as domestic ducks, which may specifically include Pekin ducks, Shaoxing ducks and other local breed ducks.

[0033] In this document, the term "MA" is Mallard, referring to Mallard ducks.

[0034] In this article, the term "IND" refers to indigenous ducks, which may specifically include Shaoxing ducks or other local breed ducks.

[0035] In this article, "Pekin" refers to Pekin ducks.

[0036] Structural variations (SVs), also known as genetic structural variations, are variations in the structure of biological chromosomes, consisting of multiple variations in a species' genome, usually including deletions, duplications, copy number variations, insertions, inversions, and translocations, etc. Research has shown that genomic structural variations are related to individual phenotypic variations and the occurrence of diseases. Structural variations (SVs) are widely present in animal genomes. Wanhong Li et al (Liwanhong.et al, 2015) used PCR technology to detect the inhibin α-subunit gene fragment in the genomic DNA of Large White pigs and found that there was a 283bp structural variation in the inhibin α-subunit gene. When the 283bp was present, it would increase the risk of sows developing follicular cysts. The structural variations of genes can regulate the production traits and disease resistance of livestock and poultry. For example, there is a 110kb fragment deletion in the MIMT1 gene that causes bovine abortion and stillbirth, a 450kb replicative insertion in the KIT gene that determines the white coat color of pigs, and a 176kb fragment containing the PRLR and SPEF2 genes that is present in multiple copies and is related to the chicken feather growth rate (Zhao Pengju, 2015). These research results indicate that structural variations play an important role in the phenotypic diversity of livestock and poultry.

[0037] The IGF2BPs (Insulin-like growth factor 2 mRNA-binding proteins) family is a class of RNA-binding proteins, including IGF2BP1, IGF2BP2, and IGF2BP3. IGF2BPs participate in post-transcriptional regulation by binding to the 3'untranslated region (3'UTR) of mRNA. Existing studies on the analysis of the IGF2BP1 gene have found that IGF2BP1 is related to body size, and the high expression of IGF2BP1 is positively correlated with body size. In the study of mice, it was found that the knockout of mouse IGF2BP1 led to mild active colitis, mild to moderate active enteritis, impaired intestinal epithelial barrier function, and weight loss. In the study of pigs, it was confirmed by RNA immunoprecipitation experiments that IGF2BP1 targets 76 genes involved in muscle development-related pathways, including the key marker genes MYH2 and MyoG. In the study of broiler chickens, it was found that the upstream variation of IGF2BP1 could explain 2-4% of the phenotypic variation. In the study of meat ducks, it was found that IGF2BP1 was mainly highly expressed during the embryonic development period of ducks, with basal expression after hatching. For fast-growing white-feathered meat ducks, the expression of this gene continued until 4-6 weeks after hatching, and the contribution rate to the early growth of meat ducks was as high as 15%. That is, the expression level of the IGF2BP1 gene after hatching determines the weight of meat ducks, that is, increasing the expression level of the IGF2BP1 gene helps to promote the weight of ducks. Evidence from genome-wide association studies (GWASs) and QTL mapping indicates that the genomic region upstream of IGF2BP1 is significantly associated with the body weight, head weight, gizzard weight, chest width, leg weight, and wing weight of chickens and ducks. However, the causal variants of the IGF2BP1 gene that affect the body size of chickens and ducks are still unclear. Therefore, the IGF2BP1 gene was selected as a candidate gene to screen structural variant molecular markers that affect its expression level, providing a direct technical means for duck breeding.

[0038] The present invention provides structural variant molecular markers, primer pairs, kits, and their uses related to the growth and development of ducks, which will be described in detail below.

[0039] Structural variant molecular markers, primer pairs, kits

[0040] Therefore, in one aspect of the present invention, the present invention provides a structural variation molecular marker related to the growth and development of ducks. According to an embodiment of the present invention, the structural variation molecular marker is located 1.7 kb upstream of the IGF2BP1 gene on chromosome Chr28, and the structural variation molecular marker has a nucleotide sequence as shown in SEQ ID NO:2. Through a large number of experiments, the inventors found that the structural variation molecular marker of the present invention can regulate the expression of the IGF2BP1 gene, and the IGF2BP1 gene can regulate the growth and development of ducks. Thus, by identifying the type of the structural variation molecular marker present in the duck genome, the growth traits of ducks can be judged through molecular screening at an early stage, and early selection and breeding of duck individuals can be carried out. While reducing the breeding cost, the growth traits can be improved, and the breeding process of ducks can be accelerated.

[0041] In some embodiments of the present invention, the structural variation molecular marker has a nucleotide sequence as shown in SEQ ID NO:1.

[0042] In some embodiments of the present invention, the locus of the structural variation molecular marker sequence is on the reference genome Pekin_C18, GCA_037218355.1, Chr28: 216,884 - 223,980, and the corresponding assembled chromosome number is CM074418.1.

[0043] In some embodiments of the present invention, the IGF2BP1 gene is CM074418.1: 178,374 - 215,169 in the reference genome Pekin_C18.

[0044] In some embodiments of the present invention, the growth and development or growth traits include growth rate, body size, meat quality, etc.

[0045] In another aspect of the present invention, the present invention provides a primer pair for amplifying the aforementioned structural variation molecular marker. According to an embodiment of the present invention, the primer pair includes: an upstream primer and a downstream primer; the upstream primer has at least one of the sequences as shown in SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:7, and the downstream primer has at least one of the sequences as shown in SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8. By using the primer pair of the present invention for amplification experiments, the aforementioned structural variation molecular marker can be specifically amplified. Thus, the primer pair can be used to amplify the genomic DNA of the duck to be tested. Based on the amplified product, the duck to be tested with the sequence of SEQ ID NO:1 or SEQ ID NO:2 can be selected for breeding or cultivation, which accelerates the duck breeding process.

[0046] In some embodiments of the present invention, the primer pair includes: an upstream primer with a sequence as shown in SEQ ID NO:3 and a downstream primer with a sequence as shown in SEQ ID NO:4.

[0047] Upstream primer: 5’-TCACCAGAGTTTTTGTAGAACTGCC-3’ (SEQ ID NO:3)

[0048] Downstream primer: 5’-TCACCAGAGTTTTTGTAGAACTGCC-3’ (SEQ ID NO:4)

[0049] In some embodiments of the present invention, the primer pair includes: an upstream primer with a sequence as shown in SEQ ID NO:5 and a downstream primer with a sequence as shown in SEQ ID NO:6.

[0050] Upstream primer: 5’-TGGCTTGAAGTGCAGTTTCC-3’ (SEQ ID NO:5)

[0051] Downstream primer: 5’-CAAAAACAACATTTCTATTCCCACACTACCAATGAATAATCCATGCTCA-3’ (SEQ ID NO:6)

[0052] In some embodiments of the present invention, the primer pair includes: an upstream primer with a sequence as shown in SEQ ID NO:7 and a downstream primer with a sequence as shown in SEQ ID NO:8.

[0053] Upstream primer: 5’-CGGGGTACCTGGCTTGAAGTGCAGTTTCCA-3’ (SEQ ID NO:7)

[0054] Downstream primer: 5’-CCCAAGCTTTCACCAGAGTTTTTGTAGAACTGCC-3’ (SEQ ID NO:8)

[0055] It should be noted that a primer pair composed of an upstream primer having the sequence shown in SEQ ID NO: 3 or SEQ ID NO: 5 and a downstream primer having the sequence shown in SEQ ID NO: 4 or SEQ ID NO: 6 is used to amplify the genomic DNA of domestic ducks, such as the genomic DNA of Pekin ducks. A primer pair composed of an upstream primer having the sequence shown in SEQ ID NO: 7 and a downstream primer having the sequence shown in SEQ ID NO: 8 is used to amplify the genomic DNA of wild ducks, such as the genomic DNA of mallards. The amplified result is compared with the sequence SEQ ID NO: 1 or SEQ ID NO: 2 of the structural variation molecular marker of the present invention. Ducks having the sequence SEQ ID NO: 1 or SEQ ID NO: 2 have better growth traits.

[0056] The growth traits or growth and development described in the present invention include body weight and body type, such as birth weight, 1-week body weight, 2-week body weight, 3-week body weight, 4-week body weight, 5-week body weight, 6-week body weight, 7-week body weight, or 8-week body weight.

[0057] In another aspect of the present invention, the present invention provides a kit. According to an embodiment of the present invention, the kit includes the aforementioned primer pair. The kit provided by the present invention can quickly, simply, and conveniently perform PCR amplification on duck genomic DNA to obtain molecular markers, and select the test ducks having the sequence SEQ ID NO: 1 or SEQ ID NO: 2 according to the sequence of the molecular markers for breeding or cultivation, thus accelerating the duck breeding process.

[0058] In some embodiments of the present invention, the kit further includes one or several of dNTPs, PCR reaction buffer, and DNA polymerase.

[0059]

[0060] In another aspect of the present invention, the present invention provides a method for evaluating the growth and development of ducks. According to an embodiment of the present invention, the method includes: using the genomic DNA of the test duck as a template, performing PCR amplification with the aforementioned primer pair, and comparing the amplification result with the aforementioned structural variation molecular marker; based on the comparison result, determining the growth and development of the test duck. As described above, the structural variation molecular marker of the present invention can regulate the expression of the IGF2BP1 gene, and the IGF2BP1 gene can regulate the growth and development of ducks. Therefore, the method of the present invention can quickly and simply evaluate the growth and development status of the test duck, thereby improving the breeding efficiency and accelerating the duck breeding process.

[0061] In some embodiments of the present invention, the amplified result having the aforementioned structural variation molecular marker is an indication that the test duck has fast growth and development. ​

[0062] In some embodiments of the present invention, the growth and development include body weight and body shape, such as birth weight, 1-week weight, 2-week weight, 3-week weight, 4-week weight, 5-week weight, 6-week weight, 7-week weight or 8-week weight.

[0063] In yet another aspect of the present invention, a method for duck breeding is proposed. According to an embodiment of the present invention, the method includes: using the genomic DNA of the duck to be tested as a template, performing PCR amplification with the aforementioned primer pair, and comparing the amplification result with the aforementioned structural variation molecular marker; selecting the duck to be tested having the sequence shown in SEQ ID NO:1 or SEQ ID NO:2 for breeding or cultivation. As described above, the structural variation molecular marker of the present invention can regulate the expression of the IGF2BP1 gene, and the IGF2BP1 gene can regulate the growth and development of ducks. Therefore, by using the method of the present invention, ducks to be tested with excellent growth traits can be quickly and simply screened for breeding, thereby improving the breeding efficiency and accelerating the duck breeding process.

[0064] In yet another aspect of the present invention, a method for determining the duck breed is proposed. According to an embodiment of the present invention, the method includes: using the genomic DNA of the duck to be tested as a template, performing PCR amplification with the primer pair described in the second aspect, and comparing the amplification result with the structural variation molecular marker described in the first aspect; determining the breed of the duck to be tested based on the comparison result. As described above, the structural variation molecular marker of the present invention mainly exists in Pekin ducks and can regulate the expression of the IGF2BP1 gene in ducks. Therefore, by using the method of the present invention, the breed of the duck to be tested can be quickly and simply determined, thereby improving the breeding efficiency and accelerating the duck breeding process.

[0065] In some embodiments of the present invention, the amplification result having the aforementioned structural variation molecular marker is an indication that the duck to be tested is a Pekin duck.

[0066] In yet another aspect of the present invention, a method for cultivating a duck breed is proposed. According to an embodiment of the present invention, the method includes: using gene editing technology to insert the aforementioned structural variation molecular marker into the upstream 1.7 kb of the IGF2BP1 gene on chromosome Chr28 of the duck to be cultivated. The structural variation molecular marker of the present invention can up-regulate the expression of the IGF2BP1 gene and promote the growth and development of ducks. Therefore, by this method, a duck breed with relatively excellent growth traits can be cultivated, which is beneficial to improving the breeding efficiency and accelerating the duck breeding process.

[0067] In some embodiments of the present invention, the gene editing techniques include, but are not limited to, CRISPR-Cas9, combined with homologous directed repair (HDR), prime editing, transposon systems (such as PiggyBac, Sleeping Beauty, etc.).

[0068] It should be noted that inserting the structural variant molecular marker 1.7 kb upstream of the IGF2BP1 gene on chromosome Chr28 of the duck to be cultivated may mean inserting the sequence of the structural variant molecular marker, i.e., SEQ ID NO:1, into 1.7 kb upstream of the IGF2BP1 gene on chromosome Chr28 of the duck by using gene editing techniques, or generating the structural variant molecular marker with the sequence of SEQ ID NO:1 automatically at 1.7 kb upstream of the IGF2BP1 gene on chromosome Chr28 of the duck through gene editing techniques. As long as the precise positioning of the structural variant molecular marker can be ensured to effectively play its role.

[0069] Use

[0070] In another aspect of the present invention, the present invention provides that the foregoing structural variant molecular marker, the foregoing primer pair, or the foregoing kit has at least one of the following uses: for predicting or assisting in predicting the growth and development phenotypes of ducks; for determining or assisting in determining duck lines or duck breeds; for screening or assisting in screening duck individuals, duck lines, or duck breeds with fast growth and development. As described above, the structural variant molecular marker of the present invention mainly exists in Pekin ducks, which can regulate the expression of the IGF2BP1 gene, and the IGF2BP1 gene can regulate the growth and development of ducks. Therefore, by using this molecular marker, duck individuals with relatively good growth and development can be screened.

[0071] In another aspect of the present invention, the present invention provides the use of the foregoing structural variant molecular marker, the foregoing primer pair, the foregoing kit, the foregoing method for evaluating duck growth and development, or the foregoing method for duck breeding in assisted breeding. As described above, the structural variant molecular marker of the present invention can regulate the expression of the IGF2BP1 gene, and the IGF2BP1 gene can regulate the growth and development of ducks. Therefore, by using this molecular marker, duck individuals with relatively good growth and development can be screened for breeding.

[0072] The embodiments of the present invention will be described in detail below. The following described embodiments are exemplary and are only used to explain the present invention, and should not be construed as a limitation to the present invention. For technologies or conditions not specified in the embodiments, they shall be carried out according to the technologies or conditions described in the literature in the art or according to the product specifications. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0073] Example 1: Detection of IGF2BP1 gene structural variation (SV)

[0074] The inventors utilized the Beijing Duck genome (SKLA1.0 in the literature, Pekin_C18, GCA_037218355.1 in NCBI), the newly constructed Shaoxing Duck and wild duck genomes, and constructed a pan-genome of the genus Anas through the Minigraph pipeline. Using the variant detection pipeline of the pan-genome, SV variant information of 200 re-sequencing data from 22 breeds / lines was obtained, and population-specific SVs of different lines were obtained.

[0075] Subsequently, highly differentiated SVs were divided into the following five groups to calculate the genetic differentiation index (Fixation index, Fst) between populations: domestic-MA (domestic breed ducks - mallards), Pekin-MA (Beijing ducks - mallards), IND-MA (Shaoxing ducks - mallards), Pekin-IND (Beijing ducks - Shaoxing ducks), Pekin-IND&MA (Beijing ducks - Shaoxing ducks and mallards). SVs with Fst > 0.5 were selected for these 5 groups, and the results are shown in Figure 1 As shown, the number of SVs in Pekin-IND&MA is 32, the number of SVs in IND-MA is 35, the number of SVs in domestic-MA is 39, the number of SVs in Pekin-IND is 102, and the number of SVs in Pekin-MA is 171. At the same time, 185 duck samples (including domesticated ducks, green-headed wild ducks) were grouped as shown in Figure 2 and divided into 15 combinations, and then differential expression analysis was performed. The results are shown in Figure 3 As shown, 77.7% (101 / 130) of the genes associated with these SVs showed significant differential expression between domestic ducks (domestic breed ducks, Beijing ducks, Shaoxing ducks, etc.) and wild ducks (mallards, etc.).

[0076] One SV that exists in Beijing ducks and is rare in green-headed wild ducks was selected. It is located 1.7 kb upstream of the IGF2BP1 gene, as shown in Figure 4 As shown. Through the genomic sequence and annotation information (Pekin_C18), the specific location of this SV was obtained, as shown in Table 1. At the same time, the specific sequence of this SV was detected, as shown in SEQ ID NO:1.

[0077] Table 1

[0078] Chr Start End Near gene SV 28 216,884 223,980 DUCK_15071IGF2BP1

[0079] It should be noted that the IGF2BP1 gene and the SV upstream of it are located on the negative strand of chromosome 28, and its transcription direction is opposite to the chromosome reference direction. Among them, the sequence SEQ ID NO:1 of SV has been reverse complemented to ensure the direction from 5'-3'.

[0080] Specific sequence of SV:

[0081]

[0082] Example 2: Expression of IGF2BP1 Gene in Different Duck Breeds

[0083] To determine whether there are differences in the expression of the IGF2BP1 gene between Pekin ducks and mallards, the inventors performed transcriptome expression in multiple tissues, that is, using the high-quality RNA-Seq sequencing data of 185 duck samples (including domesticated ducks and mallards), and aligned them to the Pekin duck reference genome SKLA1.0 using HISAT2. The effective reads mapped to the genome were counted using the featureCounts software (version 2.0.3), and the FPKM (fragments per kilobase of exon per million reads) value was calculated using the Python bioinformatics toolkit bioinfokit (v0.9.1). To identify the differentially expressed genes between mallards and domesticated ducks, a total of 15 pairs of RNA-seq datasets were analyzed. Samples with low correlation with other samples (criterion for determination: R 2 <0.95) were excluded (regarded as invalid biological replicates). The fold change in the expression of each gene and the adjusted p-value were calculated using the DESeq2 software (v1.24.0). The gene expression level was visualized after normalizing the FPKM value to the maximum FPKM value of each gene in the 15 RNA-seq datasets. The experimental results are shown in Figure 5 As shown, there are significant differences in the expression levels of IGF2BP1 between Pekin ducks and mallards. In the liver and sebum data of 2- to 6-week-old ducks, the expression level of the IGF2BP1 gene in Pekin ducks was significantly higher than that in mallards. This indicates that the SV upstream of IGF2BP1 can affect the expression of the IGF2BP1 gene in some tissues.

[0084] Example 3: Experimental Verification of Structural Variant SV Sequence Insertion

[0085] 1. PCR primers were designed based on the genomic sequences before and after the SV in Example 1. The specific primer information is as follows:

[0086] The upstream primer F1 is 5’-TGTGGGAATAGAAATGTTGTTTTTG-3’ (SEQ ID NO:3);

[0087] The downstream primer R1 is 5’-TCACCAGAGTTTTTGTAGAACTGCC-3’ (SEQ ID NO:4);

[0088] The upstream primer F2 is 5’-TGGCTTGAAGTGCAGTTTCC-3’ (SEQ ID NO:5);

[0089] The downstream primer R2 is 5’-CAAAAACAACATTTCTATTCCCACACTACCAATGAATAATCCATGCTCA-3’ (SEQ ID NO:6);

[0090] The upstream primer F3 is 5’-CGGGGTACCTGGCTTGAAGTGCAGTTTCCA-3’ (SEQ ID NO:7);

[0091] The downstream primer R3 is 5’-CCCAAGCTTTCACCAGAGTTTTTGTAGAACTGCC-3’ (SEQ ID NO:8);

[0092] Among them, the upstream primers F1, F2 and the downstream primers R1, R2 are primers for amplifying the Pekin duck sequence. Since the structural variant sequence of the Pekin duck is relatively long, two segments of primers are set, and fusion PCR is used to obtain the target sequence; the upstream primer F3 and the downstream primer R3 are primers for amplifying the mallard sequence.

[0093] It should be noted that the specific sequence obtained by fusion PCR amplification using the upstream primers F1, F2 and the downstream primers R1, R2 is shown as SEQ ID NO:2:

[0094] 5’-TGTGGGAATAGAAATGTTGTTTTTGCAGAGTTACATTGTTTAGAAGGAGGGAATGTGGTACTGAGATATGCTTACAGTGATAAGAAAGTTTAGCAGGCGACCTAGTAAAATGCAGACAACCAGTCTCCTTAGGACAATTAGGTGAAAATCACGGTGTTAAGTCAAGTCAGATAAGTGAAGAAACATTACCACTTCAAACAGTAAAAATGTCAAAAGAAATTTGAAATTTAACAGGCCGGCAACTGAAGGCCATGCATTGTTTGTGAAGCATCAGATAGATTGTGAACCTGGATTACCCACTCAGTGGGGAAACAGGGGAGGGTCCTGCCATCAAAAGGTATATAAACTGTGTTTTGGAACTAGTAGATGCGCTCTCTCCTGCTTCTGGGGCGCCCGCCATTGCAATCGCGAATAAATTACTACTTCACTGAGATCCTCGCCTGAGCCTAAGTTATTGGCTACGGAGTGTTTCTCACAGTAGC-3’ (SEQ ID NO:2)

[0095] 2. Extract the genomic DNA of Pekin ducks and mallards. Then, use Es Taq DNA Polymerase and set up the reaction system according to the official instruction manual. The PCR reaction system is shown in Table 2, and the PCR reaction conditions are shown in Table 3. After the reaction, PCR products are obtained.

[0096] Table 2

[0097]

[0098]

[0099] Table 3

[0100]

[0101] 3. Use a part of the PCR products for gel electrophoresis and a part for vector construction:

[0102] (1) Electrophorese the PCR products in 1.5% agarose gel. The electrophoresis results are as Figure 6 shown, and analyze the target band length (SV length ≈ Pekin band length - Mallard band length). The gel results show that the band lengths basically meet the expectations.

[0103] (2) Use RNAKit kit to purify the PCR products according to the instruction manual. Then, use pGL3-basic vector and use the method of double digestion with KpnI / HindIII for vector ligation according to the instruction manual to obtain the ligation products pGL3-Pekin-SV vector and pGL3-MA-control vector.

[0104] Next, add 5 μl of the ligation products (pGL3-Pekin-SV vector, pGL3-MA-control vector, and pGL3-basic control vector) to 50 μl of competent cells in an EP tube respectively, and process them according to the following steps: 1) Incubate on ice for 30 minutes; 2) Heat in a 42°C water bath for 30 seconds and then immediately place on ice for 1 - 2 minutes; 3) Add 700 μl of LB medium, resuscitate by shaking at 37°C for 60 minutes; 4) Centrifuge at 4000g for 5 minutes, discard 650 μl of the supernatant, and blow the remaining liquid at the bottom evenly and spread it on an LB plate containing 01.% (V / V) ampicillin or kanamycin. 5) Incubate at 37°C for 12 hours.

[0105] (3) After the cultivation is completed, the competent cells containing different vectors are subjected to plasmid DNA extraction, and then the extracted plasmid DNA is subjected to vector transfection. The specific process is as follows: After subculturing DF-1 (chicken embryo fibroblasts) at 37 °C and 5% CO2, the plasmid DNA is transfected into the vector using the Lipofectamine 3000 (Invitrogen) transfection kit strictly according to the instructions. Three replicates of each vector are set up, and finally the cells are cultured for another 48 hours at 37 °C and 5% CO2.

[0106] (4) After the cultivation is completed, the cells are detected for luciferase activity according to the instructions of the Luciferase Assay System (Promega). Finally, the ratio of Firefly Luciferase / Renilla Luciferase (F / R) is used as the relative reporter gene activity.

[0107] The results of the dual-luciferase reporter gene assay are as Figure 7 shown. In mallards (MA), the absence of SV reduces the expression of the IGF2BP1 gene, while there is no significant difference between the SV of Pekin ducks and the control (Basic). Some studies have found that the continuous expression of the IGF2BP1 gene after birth increases the body size and feed utilization rate of Pekin ducks. This result indicates that this structural variation (SV) can regulate the growth and development of ducks by changing the gene expression level.

[0108] In the description of this specification, the description with reference to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples" means that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0109] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention.

Claims

1. A structural variation molecular marker related to duck growth and development, characterized in that, The structural variation molecular marker is located 1.7 kb upstream of the IGF2BP1 gene on chromosome Chr28, and the structural variation molecular marker has a nucleotide sequence as shown in SEQ ID NO:

2.

2. The structural variant molecular marker according to claim 1, wherein The structural variation molecular marker has a nucleotide sequence as shown in SEQ ID NO: 1; Optionally, the site of the structural variation molecular marker sequence is in the reference genome Pekin_C18, GCA_037218355.1, Chr28: 216,884-223,980.

3. A primer pair for amplifying the structural variant molecular marker according to claim 1 or 2, characterized in that, include: Upstream primer and downstream primer; The upstream primer has at least one of the sequences shown in SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7; The downstream primer has at least one of the sequences shown in SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:

8.

4. A kit, characterized in that, Comprising the primer pair according to claim 3.

5. The structural variation molecular marker according to claim 1 or 2, the primer pair according to claim 3, or the kit according to claim 4 has at least one of the following uses: Used to predict or assist in predicting the growth and development phenotype of ducks; Used to determine or assist in determining duck strains or duck breeds; Used to screen or assist in screening fast-growing duck individuals, duck strains or duck breeds.

6. A method for evaluating the growth and development of ducks, characterized in that, include: Using the genomic DNA of the duck to be tested as a template, PCR amplification is performed using the primer pair described in claim 3. Comparing the amplification results with the structural variation molecular marker according to claim 1 or 2; Based on the comparison results, the growth and development status of the duck to be tested is determined.

7. The method according to claim 6, wherein The amplification result has the structural variation molecular marker according to claim 1 or 2, which is an indication that the duck to be tested grows and develops quickly.

8. A method for duck breeding, characterized in that, include: Using the genomic DNA of the duck to be tested as a template, PCR amplification is performed using the primer pair described in claim 3. Comparing the amplification results with the structural variation molecular marker according to claim 1 or 2; Select the test duck having the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 for breeding or cultivation.

9. Use of the structural variation molecular marker according to claim 1 or 2, the primer pair according to claim 3, the kit according to claim 4, the method for evaluating duck growth and development according to claim 6 or 7, or the method for duck breeding according to claim 8 in assisted breeding.

10. A method for cultivating a duck breed, characterized in that, include: Using gene editing technology, the structural variation molecular marker according to claim 1 or 2 is inserted into the 1.7 kb upstream of the IGF2BP1 gene on chromosome Chr28 of the duck to be bred; Optionally, the gene editing technology includes CRISPR-Cas9, prime editing, and transposon system.

Images