Insect Raf kinase inhibition factor

Abstract

The invention discloses an insect Raf kinase inhibition factor, which is a protein coded by a CvBV28-5 gene of polydDNA (deoxyribonucleic acid) virus of cotesia vestalis, and the amino acid sequence is shown as SEQ ID No.22 or SEQ ID No.8. The invention further discloses a preparation method of the insect Raf kinase inhibition factor. The nucleotide sequence of the gene for coding the inhibition factor of the insect Raf kinase is as shown in SEQ ID NO. 21 or SEQ ID NO. 7. The invention proves that CvBV28-5 interacts with Raf protein of plutella xylostella for the first time, so that the peak value of 20E titer in hemolymph of larvae of plutella xylostella is influenced, the ecdysis process of the larvae of plutella xylostella is prolonged, and a new gene resource is provided for improving the biological control efficiency of parasitic wasps and developing novel transgenic insect-resistant crops.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an inhibitory factor of insect Raf kinase. Background Art

[0002] The mitogen-activated protein kinase (MAPK) signaling pathway is a highly evolutionarily conserved intracellular signal transduction system that is widely present in a variety of organisms from fungi to mammals.

[0003] MAPKs belong to the serine / threonine (Ser / Thr) protein kinases. The MAPK signaling pathway mediated by these kinases serves as a central signal transduction pathway and can be activated by various stimuli such as cytokines, growth factors, neurotransmitters, hormones and cell stress, thereby regulating gene expression and affecting various physiological and pathological processes such as cell growth, development, proliferation and differentiation (Tong, SM and MGFeng. (2019). Insights into regulatory roles of MAPK-cascaded pathways in multiple stress responses and life cycles of insect and nematode mycopathogens. Applied Microbiology and Biotechnology 103:577–587).

[0004] The ERK pathway is the most classic of the MAPK signaling pathways, primarily involved in cell growth, proliferation, and differentiation. The upstream of the ERK pathway is usually mediated by receptor tyrosine kinase (RTK).

[0005] When growth factors or hormones bind to receptors on the cell membrane, RTK activates downstream Ras proteins through autophosphorylation. Activated Ras recruits and activates Raf kinase. Raf is a Ser / Thr protein kinase and the first MAP3K in the ERK pathway. Activation of Raf kinase is an important link in the ERK pathway. It activates ERK by phosphorylating and activating MAPK / ERK kinase (MAPK / ERK kinase, MEK). Activated ERK then translocates to the cell nucleus and phosphorylates a series of transcription factors and other target proteins to regulate gene expression, cell cycle progression, and other important cellular activities (Shilo, BZ. (2014). The regulation and functions of MAPK pathways in Drosophila. Methods 68(1): 151–159).

[0006] Insect molting and metamorphosis are primarily regulated by hormonal signaling. ERK phosphorylation directly promotes the synthesis of ecdysteroids in prothoracic cells, initiating the molting process and thus regulating insect molting and metamorphosis. Therefore, targeting proteins associated with the MAPK signaling pathway could serve as potential targets for pest control (Pan, XY, RP Connacher and MB O'Connor. (2021). Control of the insect metamorphic transition by ecdysteroid production and secretion. Current Opinion in Insect Science 43:11–20).

[0007] Polydnaviruses (PDVs) are endosymbiotic viruses of some parasitic wasps of the superfamily Ichneumonoidae in the order Hymenoptera, playing an important role in the control of host pests by parasitic wasps. As the dominant natural enemy of the important lepidopteran vegetable pest Plutella xylostella, Cotesia vestalis Bracovirus (CvBV) is a key factor in regulating the growth and development of Plutella xylostella. CvBV can regulate ecdysone levels in the host by inhibiting prothoracic gland development and reducing steroid levels, thereby prolonging the host's developmental period. How CvBV regulates the developmental process of Plutella xylostella and the related mechanisms remain unclear (Infection by a symbiotic polydnavirus induces wasting and inhibits metamorphosis of the moth Pseudoplusia includens. Journal of Experimental Biology 212(18):2998–3006; 16.).

[0008] Therefore, given the key role of Raf kinase in the MAPK signaling pathway and development, we screened a CvBV-derived RAF kinase inhibitor to provide new ideas for the utilization of parasitic wasps and the development of new pesticides. Summary of the Invention

[0009] The present invention aims to address the above-mentioned deficiencies in the prior art and provides an inhibitor of insect Raf kinase.

[0010] The present invention first provides an insect Raf kinase inhibitor, which is a protein encoded by the CvBV_28-5 gene of the polydna virus of Cotesia plutellae, and the amino acid sequence is shown in SEQ ID No. 22 or SEQ ID No. 8.

[0011] The present invention further provides a gene encoding the insect Raf kinase inhibitor, the nucleotide sequence of which is shown as SEQ ID NO.21 or SEQ ID NO.7.

[0012] The present invention further provides the use of a protein encoded by the CvBV_28-5 gene of the polydna virus of the plutella plutellae as an inhibitor of insect Raf kinase. The amino acid sequence of the protein encoded by the CvBV_28-5 gene of the polydna virus of the plutella plutellae is shown as SEQ ID No.22 or SEQ ID No.8.

[0013] The present invention further provides the use of a compound in controlling Plutella xylostella, where the larvae are parasitized by the wasp Aestivus plutellae, which harbors a polydnavirus. The compound can knock out, silence, or interfere with the expression of the CvBV_28-5 gene of the polydnavirus. This prolongs the molting process of the diamondback moth, helps improve the biological control efficiency of the parasitic wasp, and serves as a potential insect-resistant gene resource.

[0014] Preferably, the compound is any one of the following:

[0015] (1) dsRNA for silencing the expression of the CvBV_28-5 gene of the polydnavirus of Cottontail plutella xylostella;

[0016] (2) siRNA for interfering with the CvBV_28-5 gene of the polydna virus of Cottontail plutellae;

[0017] (3) A gene knockout sequence for knocking out the CvBV_28-5 gene of the polydna virus of Cottontail plutella xylostella.

[0018] The nucleotide sequence of the dsRNA used to silence the expression of the CvBV_28-5 gene of the polydnavirus of Cotesia plutellae in the application is shown in SEQ ID NO.16.

[0019] The present invention also provides a method for controlling Plutella xylostella, wherein the Plutella xylostella larvae are parasitized by the plutella xylostella wasp, which is symbiotic with the plutella xylostella polydna virus, and a compound is used to knock out, silence or interfere with the expression of the CvBV_28-5 gene of the plutella xylostella polydna virus.

[0020] Preferably, the compound is a dsRNA for silencing the expression of the CvBV_28-5 gene of the polydnavirus of Cotesia plutellae, and the nucleotide sequence is shown in SEQ ID NO.16.

[0021] After parasitization, the molting process of diamondback moth larvae was significantly prolonged, and the 20E peak disappeared, consistent with Raf silencing. However, after silencing CvBV_28-5 in parasitized diamondback moths, the molting process was partially restored, and the 20E peak reappeared. This suggests that CvBV_28-5 regulates the molting process of diamondback moth larvae by inhibiting Raf.

[0022] After Raf was effectively silenced, the peak 20E titer before molting in Plutella xylostella larvae disappeared and the molting process was significantly prolonged, indicating that Raf can affect the molting process by regulating the peak 20E titer before molting.

[0023] The present invention proves that the CvBV_28-5 gene of the Cottontail plutella virus interacts with the Raf protein of the diamondback moth through bioinformatics analysis and yeast two-hybrid verification.

[0024] This invention demonstrates for the first time that CvBV_28-5 interacts with the Raf protein of the diamondback moth, thereby affecting the peak 20E titer in the hemolymph of the diamondback moth larvae and prolonging the molting process of the diamondback moth larvae. It also provides new genetic resources for improving the biological control efficiency of parasitic wasps and developing new transgenic insect-resistant crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The role of Raf in the molting process of diamondback moth larvae. Figure 1 A in the figure represents the RNA silencing efficiency of Raf, n = 4; Figure 1 B in the figure is the time of the molting process of the unparasitized diamondback moth larvae after Raf is silenced. The biological replicate number n is marked in the figure. Figure 1 Figure C is a schematic diagram of the sampling time points for 20E titer in the hemolymph of Plutella xylostella larvae after Raf was silenced; Figure 1 D represents the titer of 20E in the hemolymph of unparasitized Plutella xylostella larvae after Raf silencing; n = 3, each biological replicate contained hemolymph from 15–20 Plutella xylostella larvae; error bars are mean ± standard error. All data were compared using the Student's t-test; *: p < 0.05; **: p < 0.01; ***: p < 0.001; ns: not significant.

[0026] Figure 2 The effect of CvBV_28-5 on the molting process of diamondback moth larvae. Figure 2 A in the equation is the interference efficiency of CvBV_28-5, n=4; Figure 2 B in the figure is the time of the molting process of Plutella xylostella larvae, NP: nonparasitized, not parasitized; P: parasitized, parasitized; P+dsGFP: parasitized and injected with dsGFP as a control; P+ds28-5: parasitized and injected with ds28-5; the number of biological replicates n for each sample is marked in the figure; Figure 2 C in the figure is a schematic diagram of the sampling time points for the 20E titer of the hemolymph of Plutella xylostella larvae after CvBV_28-5 was silenced; Figure 2D in the figure represents the 20E titer in the hemolymph of Plutella xylostella larvae at different time points. NP+dsGFP: unparasitized and injected with dsGFP; P+dsGFP: parasitized and injected with dsGFP; P+ds28-5: parasitized and injected with ds28-5; n = 3, each biological replicate containing hemolymph from 15–20 Plutella xylostella. Error bars in the figure are mean ± standard error. All data were compared with the Student's t-test; *: p < 0.05; **: p < 0.01; ***: p < 0.001; ns: not significant.

[0027] Figure 3 The interaction between Raf and CvBV_28-5 was predicted and verified. Figure 3 Figure A is the yeast two-hybrid verification of CvBV_28-5 and Raf, 1: positive control, p53-pGBKT7 and T-pGADT7; 2: negative control, lam-pGBKT7 and T-pGADT7; 3: 28-5-pGBKT7 and Raf-pGADT7; 4: empty pGBKT7 and Raf-pGADT7; Figure 3 B in the figure represents the molecular docking of CvBV_28-5 and Raf. Red and green represent CvBV_28-5 and Raf, respectively; the yellow dotted line represents the hydrogen bond; Figure 3 The C in the figure represents the predicted structure of CvBV_28-5. The amino acids and their numbers below represent the amino acids at the predicted interaction sites; Helix: helix; Coli: random coil; Figure 3 The D in the figure represents the domain structure prediction and domain multiple sequence alignment logo of the diamondback moth Raf protein. The amino acids and their numbers below the domains represent the amino acids at the predicted interaction sites. The multiple sequence alignment logo was aligned using the ClustalW algorithm. Red triangles represent the interaction sites with CvBV_28-5; RBD: Ras-binding domain; C1: protein kinase C conserved region 1; STKc: catalytic domain of the serine / threonine kinase. DETAILED DESCRIPTION

[0028] Example 1: Cloning of the CvBV_28-5 gene of the Codonopsis plutella virus and the Raf gene of the diamondback moth

[0029] 1.1 Rearing of Plutella xylostella and Aetotrichum plutellae

[0030] Plutella xylostella and Cotesia vestalis were collected outdoors in Hangzhou (30.3009°N, 120.0870°E) and maintained and reared in artificial incubators.

[0031] The temperature of the artificial incubator for raising diamondback moths was set at 25 ± 1°C, with a light intensity of L14:D10 (light intensity > 1000 lux), and a humidity control of 60%-80%. The cabbage plant used for raising diamondback moths was Brassica oleracea Lvar. capitata, a Jingfeng No. 1 cabbage variety. The cabbage was grown year-round in a closed vegetable greenhouse, with no pesticides used during the growing season and manual pest control. Five to eight uncored cabbage leaves or the entire plant were used as feed for diamondback moths.

[0032] Place diamondback moth cocoons in an insect cage and wait for them to emerge as adults. Feed the adults with 10% w / v sucrose or honey solution, and use weighing paper to attract females to lay eggs, which are then collected. Finally, place the eggs on fresh cabbage leaves or plants. Once hatched, the larvae feed directly on cabbage, eventually spinning cocoons to complete the generation cycle.

[0033] The diamondback moth is used as a host for the wasp, Corythusias plutellae. Using a brush, place approximately 200 third-instar diamondback moth larvae in a dipping container. Five to ten female wasps are then placed inside. After two hours, the wasps are removed and the diamondback moths are placed in a square takeout container for feeding. After the wasps emerge and form cocoons, spray them with disinfectant, air dry, and place the cocoons in a transparent tissue culture jar. After the wasps emerge, they are fed with 10% w / v honey solution.

[0034] 1.2 TRIzol method for total RNA extraction

[0035] (1) Add the whole parasitized diamondback moth to a grinding tube containing 500 μL TRIzol and grinding beads. Use a grinder to fully homogenize the mixture and proceed directly to the next step or store at -80°C for later use.

[0036] (2) Add 200 μL of chloroform to the above lysate, mix well, and let stand for 5 min;

[0037] (3) Centrifugation at 12000g for 15 min at room temperature;

[0038] (4) Transfer 500 μL of the upper aqueous phase to a new centrifuge tube;

[0039] (5) Add 500 μL of isopropanol, mix well and let stand for 10 min;

[0040] (6) Centrifugation at 12000g for 15 min at room temperature;

[0041] (7) After removal, a white precipitate can be seen. Carefully discard the supernatant.

[0042] (8) Add 500 μL of 75% ethanol (prepared with RNase-free ddH2O), gently flick the bottom of the tube and invert it several times to resuspend the precipitate;

[0043] (9) Centrifuge at 8000 g for 3 min at room temperature and discard the supernatant;

[0044] (10) Repeat steps 8 and 9 and discard the supernatant;

[0045] (11) Allow to air dry at room temperature until the white precipitate becomes translucent (approximately 5-10 min);

[0046] (12) Add 20-30 μL DEPC H2O to dissolve the RNA sample, determine the RNA concentration, and store it in aliquots at -80°C for long-term storage.

[0047] 1.3 Construction of cDNA library

[0048] (1) Prepare the pre-reaction solution: Oligo(dT) 20 1 μL, 10 mM dNTP Mix 1 μL, 1 μg total RNA, and finally make up to 13 μL with DEPCH2O;

[0049] (2) Mix gently, place in a 65°C metal bath for 5 min, and immediately place on ice for 1 min after denaturation.

[0050] (3) Add the following reagents to the reaction solution in (2) in sequence: 4 μL First Strand Buffer, 1 μL 0.1 M DTT, RNase OUT TM (Thermo Fisher Scientific) 1μL, SuperScript TM ⅢRT (Thermo Fisher Scientific) 1μL;

[0051] (4) Mix gently, react at 50°C for 1 h, then at 70°C for 15 min in a PCR instrument, and store at -20°C until use.

[0052] 1.4 PCR reaction

[0053] (1) Prepare the following reaction solution in a 200 μL EP tube: 10 μL 2×KOD One TM PCR Master Mix (TOYOBO), 0.6 μL upstream primer, 0.6 μL downstream primer, 0.2 μL long fragment cDNA template, 8.6 μL double distilled water;

[0054] The primers used are as follows:

[0055] Raf-clone-F (SEQ ID NO.1): ATGGCAGTTACTCGAGACGAG;

[0056] Raf-clone-R (SEQ ID NO. 2): CCTTATGGATGCCGTTGG;

[0057] 28-5-clone-F (SEQ ID NO.3): ATGGTGTTCAAAAAATCTGCGT;

[0058] 28-5-clone-R (SEQ ID NO. 4): TTAAAGCGAAATTGCTTCTTCG.

[0059] Among them, primers Raf-clone-F and Raf-clone-R were used to clone Plutella xylostella Raf, and primers 28-5-clone-F and 28-5-clone-R were used to clone the C. plutellae virus CvBV_28-5.

[0060] (2) Gently mix the above reaction system, and then perform the following PCR reaction: pre-denaturation at 98°C for 3 minutes, followed by denaturation at 98°C for 10 seconds, annealing at 58°C for 5 seconds, extension at 68°C for 10 seconds, 35 cycles, and tail extension at 72°C for 2 minutes for one cycle, and finally cool to 4°C; the PCR product can be used for agarose gel electrophoresis or target fragment recovery, and the product is stored at 4°C.

[0061] 1.5 Agarose gel electrophoresis and recovery of target gene fragments

[0062] (1) Weigh agarose powder and add 50 mL of 1× TAE buffer. Heat in a microwave oven until the powder dissolves. Add 3 μL of ethidium bromide (EB) as the dye for agarose gel electrophoresis and mix thoroughly. Pour the liquid onto a dedicated agarose gel plate with a comb inserted. Allow to cool for 30 minutes until solidified and set aside.

[0063] (2) Place the prepared gel in an electrophoresis tank filled with 1×TAE buffer, and add 1 μL of sample to the small gel well. The electrophoresis instrument is operated at 140V for 20-30 minutes. The gel is then placed in a device with a UV lamp, and the results are observed and photographed. The results show that bands of approximately 500 bp and 2000 bp appear in the lanes containing CvBV_28-5 and Raf products, respectively, which is consistent with the prediction.

[0064] (3) Take 25 μL and add it to the large gel well. Run the electrophoresis instrument at 140 V for 20-30 min. Then place it in a device with a UV lamp. Observe the results, take a picture, cut out the gel block containing the target DNA, and place it in a centrifuge tube.

[0065] (4) Use FastPure Gel DNA Extraction Mini Kit (Vazyme) to recover the target nucleic acid fragment.

[0066] 1.6TA connection and conversion

[0067] (1) Use the 5-min TA / Blunt-Zero Cloning Kit (Vazyme) and prepare the following experimental system: 1 μL 5-min TA / Blunt-Zero Cloning Mix, [0.05 × target fragment base number] ng of the above-mentioned PCR purified product and add double-distilled water to 5 μL, mix gently with a pipette, then react at 37°C for 5 min. After the reaction, quickly place on ice to complete TA ligation;

[0068] (2) Take out 100 μL of TG1 E. coli competent cells stored in a -80°C refrigerator and place on ice. After the competent cells are completely thawed, add the ligation product to the competent cells, gently stir with a pipette tip, and place the centrifuge tube on ice for incubation for 10 minutes.

[0069] (3) The centrifuge tube was heat-shocked in a 42°C water bath for 60 seconds and then immediately incubated on ice for 5 minutes;

[0070] (4) Add 1 mL of antibiotic-free LB liquid medium to the centrifuge tube containing competent E. coli and incubate at 37°C in a shaker at 180 rpm for 60 min.

[0071] (5) Centrifuge the tube at 3500 rpm for 5 min at room temperature. Pour the culture supernatant into a clean bench until only 100 μL remains. Use a sterile pipette to blow the bacterial mass evenly, then spread it on a LB solid plate containing ampicillin. Incubate the plate upside down at 37°C for 10-12 h until E. coli colonies appear.

[0072] (6) A single colony was picked and added to LB liquid medium containing ampicillin. The culture was cultured at 37°C and 250 rpm for 3-5 hours. The bacterial solution was then sent for Sanger sequencing. The sequencing results showed that the CDS of Plutella xylostella Raf was shown in SEQ ID NO.5, and the translated amino acid sequence was shown in SEQ ID NO.6; the CDS of the plutella xylostella virus CvBV_28-5 was shown in SEQ ID NO.7, and the amino acid sequence was shown in SEQ ID NO.8.

[0073] (7) The plasmid was extracted using the FastPure Plasmid Mini Kit (Vazyme) and stored in a -20°C refrigerator for future use.

[0074] Example 2: Effects of Raf gene on peak ecdysone titer and molting process of diamondback moth larvae

[0075] 2.1 Synthesis of Raf dsRNA

[0076] To investigate the effect of Raf on the molting process of Plutella xylostella, we used in vitro synthesized dsRNA to perform RNAi. The steps are as follows:

[0077] (1) Design dsRNA based on the cloned Raf CDS using the Thermofisher tool (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ). Select a 361 bp fragment as the dsRNA, as shown in SEQ ID NO. 9.

[0078] (2) Using the plasmid containing the CDS of Raf as a template, a DNA fragment with a T7 promoter sequence was synthesized by PCR reaction as a template for synthesizing dsRNA. Using the DNA fragment of the EGFP gene as a template, a control dsGFP was synthesized.

[0079] The primer sequences used are as follows:

[0080] Raf-ds-F (SEQ ID NO. 10):

[0081] TAATACGACTCACTATAGGGG AGACAGAAAACTGTTCAAGAAA;

[0082] Raf-ds-R (SEQ ID NO.11):

[0083] TAATACGACTCACTATAGGGG ACGAGTGAGGGTATCATAGTT;

[0084] GFP-ds-F (SEQ ID NO. 12):

[0085] TAATACGACTCACTATAGGG CAGTGCTTCAGCCGCTACCC;

[0086] GFP-ds-R (SEQ ID NO. 13):

[0087] TAATACGACTCACTATAGGG CTTCTCGTTGGGGTCTTTGCT;

[0088] (3) The target nucleic acid fragment product was then recovered using the FastPure Gel DNA Extraction Mini Kit (Vazyme);

[0089] (4) Synthesize and purify dsRNA according to the instructions of T7 RNAi Transcription kit (Vazyme).

[0090] (5) The concentration of dsRNA was measured using Nanodrop and then diluted to 5000 ng / μL using DEPC water (Coolaber).

[0091] 2.2 Microinjection of dsRNA

[0092] The experimental subjects were Plutella xylostella 4-6 hours after molting and entering the third instar and not parasitized. The synthesized Raf dsRNA was microinjected into the bodies of the non-parasitized Plutella xylostella larvae to silence Raf and explore the role of Raf in the molting process of Plutella xylostella larvae.

[0093] The injection method is as follows:

[0094] (1) Preparation of agar: Prepare 2% agar with ddH2O, heat and melt, pour into a mold and cool for later use;

[0095] (2) Pulling: A P-97 Flaming / Brown Micropipette Puller (Sutter) was used for capillary puller. The pulling parameters were: heat = 580, pull = 100, vel = 100, time = 80.

[0096] (3) Diamondback moth larvae were anesthetized in a 59-122BC CO2 anesthesia device (Genesee Scientific);

[0097] (4) Cut the gel with a blade and fix the diamondback moth in the gap of the gel;

[0098] (5) Add the injection solution into the injection needle through the microinjection head;

[0099] (6) Connect the injection needle to the injection connector;

[0100] (7) Adjust the instantaneous injection pressure according to the specific caliber of the needle so that the injection volume is approximately 0.1 μL. Therefore, based on the dsRNA synthesis step in 2.1, the injection volume per larva is estimated to be approximately 500 ng;

[0101] (9) Under a stereoscope, insert the needle at an angle of approximately 10° into the intersegmental membrane of the diamondback moth larva for injection. The diamondback moth body should swell slightly after injection.

[0102] (10) Transfer the injected diamondback moth larvae to a new dipping box for rearing.

[0103] 2.3 Raf silencing efficiency detection

[0104] (1) Take whole Plutella xylostella larvae about 24 hours after parasitization and extract RNA according to the steps in 1.2;

[0105] (2) RNA was reverse transcribed into a cDNA library using ReverTra Ace qPCR RT Master Mix (TOYOBO).

[0106] (3) According to The qPCR system was configured according to the instructions of qPCR Master Mix (TOROIVD). The instrument was CFX Connect (Bio-Rad) and the program was The two-step method recommended in the qPCR Master Mix manual was used. A melting curve program was added after the qPCR reaction to ensure that the melting curve for each gene was a sharp single peak with a peak position greater than 65°C to exclude nonspecific amplification and primer dimers. The internal reference was β-actin from Plutella xylostella (GenBank sequence number: NM_001309101). -ΔΔCt The relative quantification results were calculated by the method.

[0107] like Figure 1 The interference efficiency of A and Raf is 80%.

[0108] The primer sequences used are as follows:

[0109] Raf-qF (SEQ ID NO.14):CGAAGGCTCTCAACTTCCGTAAC;

[0110] Raf-qR (SEQ ID NO. 15): CCAGGTTTCGCACTGTCAC.

[0111] 2.4 Effects of Raf gene on the molting process of Plutella xylostella

[0112] Diamondback moth larvae stop eating and climb to a higher position in their breeding container before molting. Based on this characteristic, we selected diamondback moths about to molt, placed them in petri dishes, numbered them, and recorded their molt start time. We then filmed the larvae using a Sony FDR AX-100 camera until they completed their molt. The videos were analyzed using Windows Media Player 2011, and the duration of the molt process was calculated.

[0113] When Raf was silenced in unparasitized Plutella xylostella larvae, the duration of their molt was significantly prolonged ( Figure 1 B) in the figure is consistent with the interference experiment results of CvBV_28-5 in parasitized diamondback moth.

[0114] Effects of 2.5Raf on 20E Titer in Hemolymph of Plutella xylostella

[0115] Since the initiation of the molting process requires the 20E titer in the hemolymph to rise rapidly and then fall rapidly, forming a peak as a signal for the initiation of the molting process, we further explored the effect of Raf on the ecdysone titer.

[0116] The start time of molting of diamondback moth was 0h, and hemolymph was collected at the following time points: -8h, -4h, 0h, +6h and +12h. Three biological replicates were taken for each of the control and Raf silencing groups, and hemolymph of approximately 20-40 diamondback moths was collected for each biological replicate ( Figure 1 For ease of understanding, “-” is referred to as “before molting begins” and “+” is referred to as “after molting begins” below.

[0117] The specific experimental methods are as follows:

[0118] (1) Take a diamondback moth and wash its body surface with 75% ethanol for about 20 seconds to disinfect it. Then quickly wash away the ethanol with PBS to prevent the moth from dying. Transfer the moth to filter paper to absorb the water.

[0119] (2) Place a parafilm on a pre-cooled metal plate, tear the cuticle of the diamondback moth with tweezers to allow the hemolymph to flow out naturally, aspirate the hemolymph with a glass needle, add it to 10 μL of PBS, measure the volume with a pipette, and mix thoroughly by pipetting.

[0120] (3) Centrifuge at 1000 g for 10 min at 4°C to remove blood cells;

[0121] (4) Add the supernatant to 200 μL of methanol, vortex mix, and store at -80°C until assayed.

[0122] (5) According to the instructions of the 20-Hydroxyecdysone Enzyme Immunoassay kit (Bertin), the 20E titer in the hemolymph was determined.

[0123] The experiment found that the ecdysone titer of the control group of diamondback moth was high at 8 hours and 4 hours before the start of molting, and then decreased at the next three time points, forming a peak. After Raf was silenced, the 20E titer was significantly reduced at 8 hours and 4 hours before the start of molting, and the peak of 20E disappeared ( Figure 1 D) in.

[0124] Since the initiation of molting requires a peak 20E titer as a starting signal, and Raf regulates the ecdysone synthesis gene, thereby affecting ecdysone synthesis, Raf-silencing in Plutella xylostella weakens or even eliminates the peak 20E titer, thus affecting the molting process.

[0125] Example 3: CvBV_28-5 regulates the molting process of parasitized diamondback moth larvae

[0126] 3.1 Prediction of interaction between CvBV_28-5 and Raf

[0127] Using Raf as the target protein, ESMFold and MEGADOCK were used to predict the interaction between genes encoding the plutella xylostella virus and Raf. The ppiscore was 7.19, exceeding the baseline value of 6.0, indicating a protein-protein interaction between Raf from Plutella xylostella larvae and the CvBV_28-5 gene of the Plutella xylostella virus. The CvBV_28-5 gene is the fifth gene in the 28th ring of the 30 genomic segments of the Plutella xylostella polydnavirus, hence the name CvBV_28-5.

[0128] SpeedPPI was further used to directly predict the interaction between CvBV_28-5 and Raf protein, and the pDockQ was 0.34, which is greater than the interaction benchmark of 0.23, indicating that CvBV_28-5 and Raf are likely to interact.

[0129] 3.2 Synthesis of dsRNA of CvBV_28-5

[0130] To investigate the effect of CvBV_28-5 on the molting process of Plutella xylostella, we used in vitro synthesized dsRNA to perform RNAi. The steps are as follows:

[0131] (1) Design dsRNA based on the cloned CDS of CvBV_28-5 using the Thermofisher tool (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ). Select a 249 bp fragment as the dsRNA, as shown in SEQ ID NO. 16.

[0132] (2) Using the plasmid containing the CDS of CvBV_28-5 as a template, a DNA fragment with a T7 promoter sequence was synthesized by PCR. Using the DNA fragment of the EGFP gene as a template, a control dsGFP was synthesized.

[0133] The primer sequences used are as follows. The GFP dsRNA synthesis primers are the same as those in 2.2:

[0134] 28-5-ds-F (SEQ ID NO. 17):

[0135] TAATACGACTCACTATAGGG CCACTCTCCCACCCATCAAAT;

[0136] 28-5-ds-R (SEQ ID NO. 18):

[0137] TAATACGACTCACTATAGGG GAATGACTCGGTCGTCCACTG;

[0138] (3) The target nucleic acid fragment product was then recovered using the FastPure Gel DNA Extraction Mini Kit (Vazyme);

[0139] (4) Synthesize and purify dsRNA according to the instructions of T7 RNAi Transcription kit (Vazyme).

[0140] (5) The concentration of dsRNA was measured using Nanodrop and then diluted to 5000 ng / μL using DEPC water (Coolaber).

[0141] 3.3 Microinjection

[0142] Using diamondback moths 4-6 hours after molting into the third instar, CvBV_28-5 dsRNA was microinjected into unparasitized diamondback moth larvae to silence CvBV_28-5. The injection method was the same as in 2.3.

[0143] 3.4 Single-head parasitism of diamondback moth larvae

[0144] After injection of CvBV_28-5 dsRNA, the larvae were parasitized individually by the wasp Cotesia plutellae to investigate whether CvBV_28-5 affects the molting process of the parasitized diamondback moth larvae. The method is as follows:

[0145] (1) Place 5–10 fully mated female bees 2–3 days after eclosion into a finger-shaped tube, place the tube upside down on an A4 paper, and then place a diamondback moth larva injected with CvBV_28-5 dsRNA into the tube.

[0146] (2) After observing that the female bee has pricked the diamondback moth with its stinger to lay eggs, quickly use a brush to transfer the parasitized diamondback moth larvae to a new dipping box and pick a new one to put into the finger-shaped tube until enough parasitized diamondback moths are obtained for the experiment;

[0147] (3) The single parasitized diamondback moth was placed in a constant temperature incubator for subsequent experiments.

[0148] 3.5 Silencing efficiency detection of CvBV_28-5

[0149] The detection method is the same as 2.4. Figure 2 As shown in Figure A, the interference efficiency of CvBV_28-5 is about 50%.

[0150] The primer sequences used are as follows:

[0151] 28-5-qF (SEQ ID NO. 19): GGTTCAAGCGTTTCCAGAGC;

[0152] 28-5-qR (SEQ ID NO. 20): TGGGTGGGAGAGTGGCAAC.

[0153] 3.6 Effects of CvBV_28-5 on the Molting Process of Plutella xylostella

[0154] The observation method was the same as in 2.5. Compared with unparasitized Plutella xylostella, the total molting time of Plutella xylostella larvae from the third to fourth instar parasitized by the wasp wasp was prolonged by 154 minutes, from 736.9±5.2 minutes to 890.5±6.5 minutes, a 20.9% increase. Compared with the control injected with GFP dsRNA, silencing CvBV_28-5 significantly shortened the total molting time of Plutella xylostella from 889.7±12.4 minutes to 819.6±6.5 minutes, a 70-minute decrease, a 7.8% decrease. Figure 2 B) in.

[0155] Parasitized diamondback moth larvae exhibited significantly prolonged molting, a result consistent with silencing Raf in unparasitized larvae. Silencing CvBV_28-5 in parasitized diamondback moth larvae shortened molting duration, suggesting that CvBV_28-5 inhibits Raf's role in regulating molting in diamondback moth larvae.

[0156] 3.7 Effect of CvBV_28-5 on 20E Titer in Hemolymph of Plutella xylostella

[0157] Since Example 2 has confirmed that Raf can regulate the titer of 20E in diamondback moth larvae, and CvBV_28-5 interacts with Raf, we further explored the effect of CvBV_28-5 on the titer of ecdysone.

[0158] The start time of molting of diamondback moth was defined as 0h, and hemolymph was collected at the following time points: -8h, -4h, 0h, +6h, and +12h for unparasitized diamondback moths; -12h, -6h, 0h, +7h, and +14h after parasitization. Three biological replicates were taken for each of the unparasitized and parasitized groups, and hemolymph was collected from approximately 20-40 diamondback moths for each biological replicate ( Figure 2 For ease of understanding, “-” is referred to as “before molting begins” and “+” is referred to as “after molting begins” below.

[0159] The specific experimental methods are shown in 2.6. The experiment found that the ecdysone titer of the unparasitized diamondback moth was high at 8h and 4h before the start of molting. At the next three time points, the ecdysone titer decreased and formed a peak. After being parasitized by the diamondback wasp, the ecdysone titer decreased significantly at two corresponding time points, namely 12h and 6h before the start of molting. In other words, the ecdysone titer continued to remain at a low level, and the peak value weakened or even disappeared. After CvBV_28-5 was silenced, the ecdysone titer was partially restored 12h and 6h before the start of molting ( Figure 2 The above results are consistent with those after Raf silencing ( Figure 1 D) in.

[0160] Since the initiation of molting requires a peak 20E titer as a trigger, it can be speculated that the molting process of parasitized diamondback moths is affected by the weakening or disappearance of the peak ecdysone level. In this process, CvBV_28-5 regulates the molting process of diamondback moth larvae by inhibiting Raf.

[0161] Example 4: Prediction and verification of interaction between CvBV_28-5 and Raf protein

[0162] 4.1 Yeast two-hybrid verification of the interaction between CvBV_28-5 and Raf

[0163] First, we used SignalP 6.0 (https: / / services.healthtech.dtu.dk / services / SignalP-6.0 / ) to predict whether CvBV_28-5 and Raf have signal peptides. The results showed that the first 22 amino acids at the N-terminus of CvBV_28-5 serve as a signal peptide. After removing the signal peptide, the nucleotide sequence of the mature peptide of CvBV_28-5 is shown in SEQ ID NO. 21, and the amino acid sequence is shown in SEQ ID NO. 22. Raf does not have a signal peptide.

[0164] Subsequently, the mature peptide sequence of CvBV_28-5 with the signal peptide removed was constructed into the pGBKT7 vector by homologous recombination using the ClonExpress Ultra One Step Cloning Kit (Vazyme), and the CDS of Raf was constructed into the pGBKT7 and pGADT7 vectors to obtain the recombinant 28-5-pGBKT7 and Raf-pGADT7 vectors.

[0165] The primers used are as follows:

[0166] Raf-AD-F (SEQ ID NO. 23):

[0167] GTGGGCATCGATACGGGATCCATGGCAGTTACTCGAGACGAG;

[0168] Raf-AD-R (SEQ ID NO. 24):

[0169] ACGATTCATCTGCAGCTCGAGTTATGGATGCCGTTGGTTCG;

[0170] 28-5-BD-F (SEQ ID NO. 25):

[0171] CATGGAGGCCGAATTCTTTCCAGAGCACAGGGGTGAATTT;

[0172] 28-5-BD-R (SEQ ID NO. 26):

[0173] GCAGGTCGACGGATCCCTTAAAGCGAAATTGCTTCTTCGCT.

[0174] Subsequent yeast transformation and yeast one-to-one verification use Yeastmaker TM Yeast Transformation System kit (Clontech) was used. The specific method is as follows:

[0175] (1) Co-transform 28-5-pGBKT7 and Raf-pGADT7 into the Y2H strain as the experimental group, and co-transform the empty pGBKT7 and Raf-pGADT7 vector plasmids into the Y2H strain as the control. Colonies that can grow on double-dropout (DDO) plates after transfection indicate successful co-transfection;

[0176] (2) Pick a single colony, resuspend it in sterile water, and transfer it to a bacterial suspension on a solid plate of SD-Trp-Leu-Ade-His, Quadruple dropout (QDO) or a solid plate of SD-Trp-Leu-Ade-His+X-α-gal (QDO / X / A). Culture at 30°C in the dark for 3-5 days and observe the growth and color of the colony. The results showed that the co-transfected plasmid colony grew normally, indicating that Raf interacts with CvBV_28-5 ( Figure 3 A).

[0177] 4.2 Protein molecular docking and sequence alignment analysis of Raf and CvBV_28-5

[0178] The three-dimensional structure of the protein interaction between CvBV_28-5 and Raf was predicted using SpeedPPI, and the three-dimensional structural model of CvBV_28-5 and Raf was subsequently drawn using PyMOL 3. The Raf domain was identified by Conserved Domain Search on NCBI (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi). According to the molecular model of the CvBV_28-5 / Raf complex, six hydrogen bonds were formed between the four residues Asn127, Arg129, Gln130, and Val136 in CvBV_28-5 and the five residues Glu225, Thr264, Asp623, Trp627, and Arg631 in Raf ( Figure 3 B in the figure). The four residues in CvBV_28-5 are all located on the second helix ( Figure 3 C in the figure). Three of the five residues in the Raf protein, namely Asp623, Trp627, and Arg631, are located in the catalytic domain of serine / threonine kinase. Therefore, it is speculated that CvBV_28-5 may affect the catalytic activity of the Raf protein ( Figure 3 D) in.

[0179] After cloning the Raf CDS from Plutella xylostella, we searched it using tBLASTN from NCBI. We also downloaded amino acid sequences of Raf homologous genes from other species and aligned them using the ClustalW algorithm in MEGA to create a multiple sequence alignment. The organisms used included: Homo sapiens; Bos taurus; Sus scrofa; Ovis aries; Pan troglodytes; Macaca mulatta; Mus musculus; Rattus norvegicus; Drosophila melanogaster; Bombyx mori; Manducasexta; Trichoplusia ni; Spodoptera litura; Spodoptera frugiperda; and Helicoverpa armigera. The results indicate that the Raf sequence is highly conserved among insects and mammals. Among them, the three amino acids located in the catalytic domain are highly conserved in insects and even mammals ( Figure 3 Therefore, it is speculated that CvBV_28-5 has conservative interaction with Raf kinase and has the potential to be developed as a MAPK signaling pathway inhibitor.

Claims

1. An inhibitor of insect Raf kinase, characterized in that It is a protein encoded by the CvBV_28-5 gene of the polydnavirus of Cotesia plutellae, and its amino acid sequence is shown in SEQ ID No.22 or SEQ ID No.

8.

2. The gene encoding the insect Raf kinase inhibitor according to claim 1, characterized in that: The nucleotide sequence is shown in SEQ ID NO.21 or SEQ ID NO.

7.

3. Use of a protein encoded by the CvBV_28-5 gene of the polydnavirus of Cotesia plutellae as an inhibitor of insect Raf kinase, characterized in that: The amino acid sequence of the protein encoded by the CvBV_28-5 gene of the polydnavirus of Cotesia plutellae is shown as SEQ ID No. 22 or SEQ ID No.

8.

4. Use of a compound in controlling Plutella xylostella, wherein the larvae of the Plutella xylostella are parasitized by the wasp Aesthetica plutellae, which is symbiotic with the wasp Aesthetica plutellae polydna virus, characterized in that: The compound can knock out, silence or interfere with the expression of the CvBV_28-5 gene of the polydnavirus of Cotesia plutellae.

5. The use according to claim 4, characterized in that The compound is any of the following: (1) dsRNA for silencing the expression of the CvBV_28-5 gene of the polydnavirus of Cottontail plutella xylostella; (2) siRNA for interfering with the CvBV_28-5 gene of the polydna virus of Cottontail plutellae; (3) A gene knockout sequence for knocking out the CvBV_28-5 gene of the polydna virus of Cottontail plutella xylostella.

6. The use according to claim 5, characterized in that The nucleotide sequence of the dsRNA used to silence the expression of the CvBV_28-5 gene of the polydnavirus of Cotesia plutellae is shown in SEQ ID NO.

16.

7. A method for controlling Plutella xylostella, wherein the larvae of the Plutella xylostella are parasitized by the wasp Aesthetica plutellae, which is symbiotic with the wasp Aesthetica plutellae polydna virus, characterized in that: Compounds are used to knock out, silence or interfere with the expression of the CvBV_28-5 gene of the polydnavirus of the plutella xylostella.

8. The method for controlling Plutella xylostella according to claim 7, characterized in that: The compound is a dsRNA used for silencing the expression of the CvBV_28-5 gene of the polydnavirus of Cotesia plutellae, and the nucleotide sequence is shown in SEQ ID NO.16.

Images