GhDR gene capable of simultaneously regulating and controlling red leaf, dwarf and cold resistance characters of cotton as well as encoding protein and application of GhDR gene
By overexpressing the GhDR gene in the cotton genome, the problems of anthocyanins accumulation, plant height dwarf and insufficient low-temperature tolerance in cotton plants were solved, and the dwarf and low-temperature resistance of cotton plants were enhanced, which promoted the sustainable development and yield improvement of cotton production.
Patent Information
- Application Number
- CN202510667917.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-23
- Publication Date
- 2025-08-05
AI Technical Summary
The prior art lacks genes that can simultaneously regulate anthocyanin accumulation, plant height dwarf and low temperature resistance traits in cotton plants, resulting in high cotton production costs, environmental pollution and low yields.
A GhDR gene and its encoding protein are provided. By overexpressing the GhDR gene in the cotton genome, and transforming it using the vector pCAMBIA2300, a low-rod, red leaves, and low-temperature-resistant transgenic cotton variety is obtained to achieve anthocyanin accumulation, plant height dwarfing and low-temperature tolerance.
It has achieved significant increase in anthocyanin accumulation in cotton plants, increased plant height and low temperature tolerance, provided gene resources and improvement strategies, and promoted the utilization of cotton hybrid advantages and adapted to mechanized production.
Smart Images

Figure CN120424952A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to a GhDR gene for simultaneously regulating the red leaves, dwarf stems and cold resistance traits of cotton, as well as its encoded protein and application. Background Art
[0002] Cotton is one of the important economic crops. Excellent varieties are the basis of yield and quality. High-quality varieties should have the characteristics of ideal plant shape, high group photosynthetic efficiency, strong resistance to adversity, and adaptability to mechanization. Cotton plant height and leaf color are important aspects of this. They play an important role in optimizing the canopy structure and leaf photosynthetic performance of cotton groups, and are an important way to further improve cotton yield and quality.
[0003] Plant height is the primary agronomic trait that determines crop planting density and affects yield. Dwarf and semi-dwarf varieties have stronger population photosynthesis and lodging resistance, and are more resistant to abiotic stresses and pathogens. This is of great significance for saving production costs, improving fertilizer utilization, and increasing yields. Currently, cotton field cultivation measures mainly use chemical control methods to reduce cotton plant height. The use of these chemical growth retardants not only increases production costs, but also leads to increasingly serious environmental pollution problems in the long run, which is contrary to the concept of green and sustainable development. Therefore, the selection and breeding of dwarf and semi-dwarf materials is an important measure to increase yield, improve agricultural production efficiency, and promote sustainable development.
[0004] Anthocyanins are natural, water-soluble pigments, and some red-leaved cotton plants have been shown to be less favored by bollworms and spider mites. Furthermore, traits such as red leaves and stems, which indicate anthocyanin accumulation, are highly intuitive markers of cotton's heterosis and have great potential for production applications. Research on cotton anthocyanins can provide genetic resources and a theoretical foundation for the utilization of heterosis and the breeding of colored cotton.
[0005] Chilling damage primarily occurs during the sowing, emergence, and seedling stages, as well as in the later stages of cotton growth. This damage can cause seed, bud, and root rot, as well as inadequate boll development, impacting cotton yield and quality. Cotton is sown extensively in early April, making it susceptible to cold snaps and other chilling damage, including even freezing damage, leading to low emergence rates and seedling death. Varieties with high tolerance to cold temperatures can not only withstand the effects of cold weather but also enable earlier sowing, extending the growing season, improving emergence rates, and achieving earlier budding, flowering, and boll opening, while increasing the pre-frost flowering rate and boosting yield.
[0006] However, there are currently few studies on genes that can simultaneously regulate anthocyanin accumulation, plant height dwarfing and stress resistance traits (low temperature resistance / low temperature stress tolerance) in cotton plants. Therefore, the present invention provides a GhDR gene, its encoded protein and application that simultaneously regulates red leaves, dwarf stems and cold resistance traits in cotton. Summary of the Invention
[0007] The purpose of the present invention is to provide a GhDR gene and its encoded protein and application for simultaneously regulating the red leaves, short stems and cold resistance traits of cotton in order to solve the above problems.
[0008] The present invention achieves the above-mentioned purpose through the following technical solutions: The present invention provides a GhDR gene, the nucleotide sequence of the GhDR gene is shown in SEQ ID NO.1.
[0009] The present invention also provides a protein encoded by the GhDR gene, the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.
[0010] The present invention also provides an application of a GhDR gene in simultaneously regulating anthocyanin accumulation in cotton plants and / or cotton plant height and / or cotton stress resistance.
[0011] As a further optimization scheme of the present invention, overexpression of the GhDR gene can simultaneously promote the accumulation of anthocyanins in cotton plants, reduce cotton plant height, and enhance cotton stress resistance.
[0012] As a further optimization solution of the present invention, the cotton stress resistance is low temperature stress tolerance.
[0013] The present invention also provides an overexpression vector, which is obtained by transferring the GhDR gene into the vector pCAMBIA2300.
[0014] The present invention also provides an application of the GhDR gene in improving cotton varieties.
[0015] As a further optimization scheme of the present invention, the GhDR gene is introduced as a target gene into the cotton genome for overexpression to cultivate a short-stem, red-leaf, low-temperature-resistant transgenic cotton variety.
[0016] The present invention obtains a gene controlling anthocyanin accumulation and dwarfing in cotton plants in a dwarf red strain of upland cotton through a fine mapping method. The gene ID is GH_A09G2280 (http: / / cotton.zju.edu.cn / download.html). During sequence analysis of the gene, it was found that the GH_A09G2280 gene in the dwarf red strain material had a gene deletion at positions 579-580, resulting in a frameshift mutation in the sequence. The amino acids encoded by the mutated sequence are shown in SEQ ID NO.2, and the corresponding gene sequence is shown in SEQ ID NO.1. The mutated sequence is named GhDR; the nucleotide sequence of the GH_A09G2280 gene is shown in SEQ ID NO.3, and the amino acid sequence of the protein encoded by the GH_A09G2280 gene is shown in SEQ ID NO.4.
[0017] To further clarify the function of the GhDR gene, the present invention overexpressed the GhDR gene and the GH_A09G2280 gene in upland cotton. The transgenic plants were statistically analyzed and tested for plant height, anthocyanin content, and low-temperature tolerance. The results showed that transgenic plants overexpressing the GhDR gene showed significantly shorter plant height, significantly accumulated anthocyanins, and significantly enhanced low-temperature tolerance. However, transgenic plants overexpressing the GH_A09G2280 gene showed no significant changes in plant height, anthocyanin content, or low-temperature tolerance. This suggests that the GhDR gene can simultaneously regulate anthocyanin accumulation, plant dwarfing, and enhanced low-temperature tolerance in cotton.
[0018] The beneficial effects of the present invention are: The present invention overexpresses the GhDR gene and the GH_A09G2280 gene in upland cotton, respectively. Phenotypic investigations show that cotton plants overexpressing the GhDR gene exhibit a phenotype of high anthocyanin accumulation in the stems and leaves, dwarfed plant height, and low-temperature resistance at the seedling stage, while plants overexpressing the GH_A09G2280 gene do not exhibit the above phenotypes, indicating that the GhDR gene has the function of simultaneously regulating cotton plant height, anthocyanin accumulation, and low-temperature resistance at the seedling stage. The use of the GhDR gene and its encoded protein to regulate anthocyanin accumulation, dwarfed plant height, and low-temperature stress resistance provides genetic resources and improvement strategies for improving cotton plant height, adapting to mechanized production, creating cotton marker traits, conducting hybrid identification using hybrid vigor in cotton, cultivating low-temperature-resistant varieties, and timely early sowing to extend the cotton growing period. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1The phenotypic comparison diagram of GhDR-OE, GH_A09G2280-OE overexpression plants (GhDR-OE is a plant overexpressing the GhDR gene, and GH_A09G2280-OE is a plant overexpressing the GH_A09G2280 gene) and wild-type Y688 plants; Figure 2 A comparison of anthocyanin content in GhDR-OE, GH_A09G2280-OE overexpressing plants and wild-type Y688 plants; Figure 3 A comparison of plant heights of GhDR-OE, GH_A09G2280-OE overexpressing plants and wild-type Y688 plants; Figure 4 The figure shows the phenotypic comparison of GhDR-OE, GH_A09G2280-OE overexpressing plants and wild-type Y688 plants after low temperature stress treatment; Figure 5 The graph shows the results of measuring physiological indicators of GhDR-OE, GH_A09G2280-OE overexpressing plants and wild-type Y688 plants after being treated with low temperature stress. DETAILED DESCRIPTION
[0020] The present application is described in further detail below in conjunction with the accompanying drawings. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.
[0021] 1. Materials Unless otherwise specified, the methods used in this example are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified.
[0022] 2. Methods 2.1 Cloning of GhDR and GH_A09G2280 gene sequences To investigate the relationship between the GhDR gene and the red-leaf dwarf trait, leaf RNA was extracted from the Dwarf Red plant (a red-leafed, short-stem variety from the National Cotton Germplasm Resource Medium-term Bank) and from Xinluzao 74 (a green-leafed, tall-stem variety from the National Cotton Germplasm Resource Medium-term Bank) and reverse transcribed into cDNA using the following primers: SEQ ID NO.5: OE-F: GGTACCATGAAAATCCAGTGTGATGTTTGTGA; SEQ ID NO.6: OE-R: GTCGACTCAACCTAGATCAGGGACCGT; KpnI and SalI restriction sites were added to the above primers, respectively. The sequence amplified from the cDNA of the dwarf red strain is shown in SEQ ID NO. 7, which contains the entire coding region of the GhDR gene. The sequence amplified from the cDNA of Xinluzao 74 is the full-length sequence of the Ghdr / GH_A09G2280 gene, shown in SEQ ID NO. 3. The PCR amplification procedure was as follows: ① Initial denaturation at 95°C for 5 minutes; ② Denaturation at 95°C for 30 seconds; ③ Annealing at 58°C for 30 seconds; ④ Extension at 72°C for 30 seconds; 35 cycles of ②-④; ⑤ Final extension at 72°C for 10 minutes; ⑥ Storage of the amplified product at 4°C.
[0023] 2.2 Construction of GhDR-OE and GH_A09G2280-OE overexpression vectors The nucleotide sequences of the GhDR gene and the GH_A09G2280 gene obtained in step 2.1 were constructed into the pCAMBIA2300-35S vector using the double enzyme digestion-T4 DNA ligase ligation method to obtain the overexpression vectors of GhDR-OE and GH_A09G2280-OE. The above vector plasmids were transformed into Agrobacterium EHA105 by electroporation and stored at -80°C for future use.
[0024] 2.3 Agrobacterium-mediated genetic transformation of cotton 1) Genetic transformation of cotton was performed using upland cotton Y668 as the recipient material. Hulled, mature, and plump seeds of upland cotton Y668 were sterilized by soaking them in a 0.1% mercuric chloride solution for 10 minutes. The seeds were then repeatedly rinsed with sterile water to remove any residual mercuric chloride solution. The sterilized seeds were then planted in sterilized seedling culture medium in a clean bench and incubated at 28°C in a sealed container for 7 days to obtain sterile seedlings. 2) Activate the Agrobacterium containing the constructed GhDR-OE and GH_A09G2280-OE overexpression vectors stored at -80°C, and use MGL induction solution to expand the bacteria to an OD600 of about 0.5; 3) Cut the hypocotyls of the sterile seedlings into 0.5-0.7 cm segments in a clean bench and place them in the above-mentioned bacterial cells with shaking for 10 minutes to fully infect them. Then, transfer the infected hypocotyls to sterile filter paper to absorb the residual bacterial solution. Then, place them on the co-cultivation medium and incubate them in the dark at 28°C for 2 days. 4) After 2 days of co-culture, transfer the hypocotyls to a selective medium containing kanamycin resistance and continue subculturing every 3 weeks until resistant calli are produced; 5) Transfer the resulting resistant callus to differentiation medium and continue culturing it every 15 days until adventitious buds appear; 6) The produced adventitious buds are transferred to rooting medium and cultured until cotton seedlings are obtained.
[0025] 2.4 Detection and identification of transgenic seedling phenotypes Anthocyanin content and plant height were measured in GH_A09G2280-OE and GhDR-OE overexpressing cotton plants and wild type Y668. Figure 1 As shown in the figure, the anthocyanin content and plant height of the GH_A09G2280-OE overexpressing plants were not significantly different from those of the wild type Y668; however, the anthocyanin content of the GhDR-OE overexpressing plants was significantly higher than that of the wild type Y668, and their plant height was significantly shorter ( Figure 2 and Figure 3 ).
[0026] GH_A09G2280-OE and GhDR-OE overexpressing cotton plants and wild type Y668 were subjected to 4℃ low temperature stress for 72h, and then the leaves after low temperature stress were stained with DAB, and the survival rate, SOD enzyme activity and MDA content were measured. Figure 4 As shown: After 72 hours of low temperature stress treatment, the phenotypes of wild-type Y668, GH_A09G2280-OE and GhDR-OE were observed and it was found that the leaves of wild-type Y668 and GH_A09G2280-OE overexpression lines wilted severely, while the leaves of GhDR-OE overexpression lines wilted to a lesser extent.
[0027] Then, the cells were cultured at 28°C for 72 h, and then the survival rate, DAB staining, SOD enzyme activity, and MDA content were detected. The results showed that the DAB staining of the GhDR-OE overexpression strain was lighter than that of the wild-type Y668 and GH_A09G2280-OE ( Figure 5 -A), higher plant survival rate ( Figure 5 -B), lower MDA content ( Figure 5 -C), SOD enzyme activity is higher ( Figure 5 -D), indicating that the GhDR-OE overexpressing strain suffered less damage under low temperature stress and had a stronger tolerance to low temperature stress.
[0028] The above results indicate that the GhDR gene can simultaneously regulate anthocyanin accumulation, cotton plant height and low temperature stress tolerance in cotton. When the expression level of the GhDR gene is increased, it will significantly promote the accumulation of anthocyanins in cotton plants, reduce cotton plant height and enhance the low temperature stress tolerance in the cotton seedling stage.
[0029] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.
Claims
1. A GhDR gene, characterized in that The nucleotide sequence of the GhDR gene is shown in SEQ ID NO.
1.
2. A protein encoded by the GhDR gene according to claim 1, characterized in that: The amino acid sequence of the encoded protein is shown in SEQ ID NO.
2.
3. Use of the GhDR gene according to claim 1 in simultaneously regulating anthocyanin accumulation in cotton plants and / or cotton plant height and / or cotton stress resistance.
4. The use according to claim 3, characterized in that Overexpression of the GhDR gene can simultaneously promote the accumulation of anthocyanins in cotton plants, reduce cotton plant height, and enhance cotton stress resistance.
5. The use according to claim 4, characterized in that The cotton stress resistance is low temperature stress tolerance.
6. An overexpression vector, characterized in that The product is obtained by introducing the GhDR gene as claimed in claim 1 into the vector pCAMBIA2300.
7. Use of the GhDR gene according to claim 1 in improving cotton varieties.
8. The use according to claim 7, characterized in that The GhDR gene as claimed in claim 1 is introduced as a target gene into the cotton genome for overexpression to cultivate a short-stem, red-leaf, low-temperature-resistant transgenic cotton variety.
Citation Information
Cited By
Application of cotton natural mutant DR as acceptor material in genetic transformation of cotton stem tip
CN121320424A