Cytoplasm DNA imaging method for reducing background interference by using protease K
By using protease K to degrade background interference in cytoplasmic DNA imaging, high sensitivity and high accuracy cytoplasmic DNA imaging is achieved, solving the problem of low signal-to-noise ratio in traditional methods and is suitable for a variety of cell types and experimental conditions.
Patent Information
- Application Number
- CN202510468161.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-08-08
AI Technical Summary
Traditional nucleic acid fluorescent dyes are susceptible to cytoplasmic matrix interference in cytoplasmic DNA imaging, resulting in a reduced signal-to-noise ratio and affecting imaging effect and accuracy.
Cell samples were treated with protease K, proteins were degraded by enzymatic degradation, and background interference fluorescence was reduced, and cytoplasmic DNA imaging was performed in combination with nucleic acid fluorescent dye.
It significantly improves the signal-to-noise ratio and accuracy of cytoplasmic DNA imaging, and can clearly detect cytoplasmic DNA signals in the presence of low concentrations of DNA, which is suitable for a variety of cell types and experimental conditions.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological imaging technology, in particular to a cytoplasmic DNA imaging method utilizing proteinase K to reduce background interference. Background Art
[0002] Cytoplasmic DNA plays a key role in innate immune responses and plays an important role in the complex interplay between cellular integrity and immune surveillance. In recent years, as a key signaling molecule for immune activation, the distribution, content, and dynamic changes of cytoplasmic DNA in cells have attracted widespread attention. The detection of cytoplasmic DNA not only involves the diversity of its sources but is also closely related to the various cellular processes it regulates, including micronucleus formation, mitochondrial DNA leakage, and abnormal activation of endogenous retrotransposons. Although these processes have their own characteristics, they ultimately work together to regulate inflammatory responses and build host immune defense mechanisms. For example, cytoplasmic DNA can trigger antiviral immune responses by activating the cGAS-STING pathway and also plays a key role in cellular senescence and chronic inflammation.
[0003] In fluorescence imaging, nucleic acid fluorescent dyes are widely used due to their sensitivity. However, they are susceptible to interference from the complex intracellular environment during application, resulting in a reduced signal-to-noise ratio and affecting the accurate imaging of cytoplasmic DNA. Therefore, it is urgent to develop new technical means to balance detection sensitivity and specificity, and to establish a cytoplasmic DNA imaging method that can effectively remove interfering substances and ensure good sample staining effect. Summary of the Invention
[0004] The purpose of the present invention is to provide a cytoplasmic DNA imaging method using proteinase K to reduce background interference.
[0005] To achieve the purpose of the present invention, in a first aspect, the present invention provides a method for imaging cytoplasmic DNA using proteinase K to reduce background interference, comprising preparing a cell sample, sequentially treating it with a fixative, a permeabilizing agent, an enzymatic solution, and a nucleic acid fluorescent dye working solution, and finally sealing it with a mounting medium, and imaging (capturing an image) under a fluorescence microscope; Wherein, the enzymatic hydrolysis solution contains proteinase K.
[0006] Furthermore, the enzymatic hydrolysis solution is prepared with PBS, wherein the concentration of proteinase K is 1-20 μg / mL, preferably 1, 4 and 20 μg / mL.
[0007] Furthermore, the fixative is 4% paraformaldehyde.
[0008] Furthermore, the permeabilization agent is 0.25% Triton X-100 or 1% NP40.
[0009] Furthermore, the nucleic acid fluorescent dye working solution is PicoGreen or DAPI.
[0010] Furthermore, the mounting medium is 50% glycerol or a commercial anti-fluorescence quenching mounting medium.
[0011] In the present invention, the cells are derived from animals.
[0012] Specifically, the method comprises the following steps: (1) Prepare cell samples, wash the samples, and add fixative to treat the samples; (2) Aspirate the fixative, wash the sample, and add a permeabilizing agent to treat the sample; (3) Aspirate the permeabilization agent, wash the sample, and add the enzymatic solution for incubation; (4) Aspirate and discard the enzymatic solution, wash the sample, and add nucleic acid fluorescent dye working solution to stain in the dark; (5) Aspirate and discard the nucleic acid fluorescent dye working solution, wash the sample, and add mounting medium to obtain the sample for fluorescence microscopy imaging; (6) Imaging under a fluorescence microscope.
[0013] Furthermore, the reagent used for cleaning is PBS.
[0014] In one embodiment of the present invention, a method for imaging cytoplasmic DNA using proteinase K to reduce background interference includes: placing cells in a microplate, culturing with a coverslip, and maintaining the cell confluence at 50-80%; for example, L929 cells are placed in an 8-well chamber (eight-well microplate) with a density of 10,000 to 20,000 cells per well on a coverslip (the number of cells in each well depends on the cell size), and 200 μL of 4% paraformaldehyde fixative is added to each well to fix the cells at room temperature for 10 minutes; then the fixative is aspirated, the cells are washed twice with PBS, and 200 μL of 0.25% Triton X-100 permeabilization agent is added to each well for permeabilization for 10 minutes; next, the permeabilization agent is aspirated, the cells are washed twice with PBS, and then 100 μL of enzymatic solution is added to each well and incubated at room temperature for 10 minutes; finally, the enzymatic solution in the well is gently aspirated, the cells are washed twice with PBS, and a nucleic acid fluorescent dye working solution is added and incubated in the dark; after incubation, a mounting medium is added to the well for mounting, and imaging is performed under a fluorescence microscope.
[0015] In a second aspect, the present invention provides the use of proteinase K in cytoplasmic DNA imaging.
[0016] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: (1) Traditional nucleic acid dyes are susceptible to interference from the cytoplasmic matrix, leading to false-positive signals. These dyes not only bind to DNA in the cytoplasm but may also nonspecifically bind to other proteins or nucleic acid components within the cell, thereby increasing background fluorescence. The present invention uses proteinase K to degrade proteins, reducing the background interference fluorescence generated by nucleic acid fluorescent dyes, thereby improving the sensitivity and accuracy of DNA detection. This allows for precise staining of cytoplasmic DNA and more accurate cytoplasmic DNA imaging results.
[0017] (2) In traditional methods, the presence of background fluorescence reduces the signal-to-noise ratio, affecting the sensitivity and accuracy of detection. The present invention significantly reduces background fluorescence and improves the signal-to-noise ratio through treatment with proteinase K. This enables clear detection of cytoplasmic DNA signals even in the presence of low DNA concentrations, thereby achieving highly sensitive cytoplasmic DNA signal detection.
[0018] (3) Traditional methods often lack clarity in imaging due to background interference, making it difficult to accurately identify the distribution and content of cytoplasmic DNA. This invention utilizes proteinase K-assisted, highly sensitive nucleic acid dye imaging to dynamically regulate signal specificity and cell integrity, successfully removing background fluorescence and achieving clearer imaging. This enables more accurate identification and quantitative analysis of cytoplasmic DNA.
[0019] Traditional methods may not be effective for cytoplasmic DNA imaging in certain cell types or experimental conditions. The proteinase K-assisted, highly sensitive nucleic acid dye imaging method of the present invention has broad applicability and can be used in a variety of cell types and experimental conditions, providing greater flexibility and convenience for cytoplasmic DNA detection. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 Schematic diagram of the process of cytoplasmic DNA imaging using proteinase K to reduce background interference in the present invention.
[0021] Figure 2 The background interference removal effect after different permeabilization methods of the present invention is shown. The scale bar is 10 μm.
[0022] Figure 3 These are images of cytoplasmic DNA imaging using different concentrations of proteinase K assisted by PicoGreen in a preferred embodiment of the present invention. The scale bar is 10 μm.
[0023] Figure 4 These are images of cytoplasmic DNA imaging using DAPI assisted by different concentrations of proteinase K in a preferred embodiment of the present invention. The scale bar is 10 μm.
[0024] Figure 5These are images of cytoplasmic DNA imaging of different cells using Proteinase K-assisted PicoGreen in an example of the present invention. The scale bar is 10 μm.
[0025] Figure 6 This is a confocal image of the detection of Cy5-dsDNA in cells using Proteinase K-assisted PicoGreen in an example of the present invention. The scale bar is 10 μm. DETAILED DESCRIPTION
[0026] The present invention aims to provide a cytoplasmic DNA imaging method that uses proteinase K to reduce background interference, thereby removing background interference and accurately identifying cytoplasmic DNA. The method includes the steps of fixation, washing, permeabilization, washing, enzymatic hydrolysis, washing, staining, washing, and sealing.
[0027] Specifically, the technical solution of the present invention comprises the following steps: (1) Prepare cell samples, as well as fixatives, permeabilization agents, cleaning solutions, enzymatic solutions, and nucleic acid fluorescent dyes; (2) Wash the sample and add a fixative to treat the sample; (3) Aspirate the fixative, wash the sample, and add a permeabilizing agent to treat the sample; (4) Aspirate the permeabilization agent, wash the sample, and add the enzymatic solution for incubation; (5) Aspirate and discard the enzymatic solution, wash the sample, and add nucleic acid fluorescent dye working solution to stain in the dark; (6) Aspirate and discard the nucleic acid dye working solution, wash the sample, and add mounting medium to obtain the sample for fluorescence microscopy imaging.
[0028] Wherein, the enzymatic hydrolysis solution in step (4) contains proteinase K.
[0029] Figure 1 Schematic diagram of the process of cytoplasmic DNA imaging using proteinase K to reduce background interference in the present invention. Figure 2 This is the effect of removing background interference after using different transparency methods in the present invention.
[0030] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
[0031] The cell samples used in the following examples were obtained from the Shanghai Cell Bank of the Chinese Academy of Sciences.
[0032] The mounting medium was 50% glycerol or commercial anti-fluorescence fading mounting medium.
[0033] Fluorescent nucleic acid dyes were DAPI or PicoGreen. DAPI was purchased from Shanghai Beyotime Biotechnology Co., Ltd., and PicoGreen was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.
[0034] Example 1: Cytoplasmic DNA imaging of cells using different concentrations of proteinase K assisted by nucleic acid fluorescent dyes L929 cells were plated at a density of 10,000 cells / well in 8-well chambered coverslips. First, 200 μL of 4% paraformaldehyde was added to each well for fixation at room temperature for 10 minutes. The fixative was then aspirated, the cells were washed twice with PBS, and 200 μL of 0.25% Triton X-100 was added to each well for permeabilization for 10 minutes. Next, the 0.25% Triton X-100 solution was aspirated, the cells were washed twice with PBS, and 100 μL of proteinase K working solution (1, 4, and 20 μg / mL in PBS) was added to each well and incubated at room temperature for 10 minutes. Finally, the proteinase K working solution was gently aspirated, the cells were washed twice with PBS, and a fluorescent nucleic acid dye was added to the wells for incubation in the dark. After incubation, the wells were mounted with mounting medium and images were captured using a fluorescence microscope.
[0035] Figure 3 These are images of cytoplasmic DNA imaging using different concentrations of proteinase K to assist PicoGreen in Example 1. The scale bar is 10 μm. Figure 4 The images of Example 1 using different concentrations of proteinase K to assist DAPI in cytoplasmic DNA imaging are shown in the figure. The scale bar is 10 μm. Figure 3 and Figure 4 As shown in the results, proteinase K treatment can significantly enhance the fluorescence intensity of the cell nucleus and eliminate the background fluorescence, and this effect is concentration-dependent.
[0036] In summary, the present invention uses proteinase K enzymatically assisted nucleic acid dyes for cytoplasmic DNA imaging, achieving dynamic regulation of signal specificity and cell integrity, successfully removing background fluorescence, and achieving excellent imaging results. This invention is applicable to a variety of nucleic acid dyes and provides a new strategy for achieving precise cytoplasmic DNA imaging.
[0037] Example 2 Using Proteinase K to Assist PicoGreen for Cytoplasmic DNA Imaging in Different Cells Different cells were cultured in 8-well chamber coverslips. Different cell sizes were different, and the cell confluence was maintained at 50-80%. First, 200 μL of 4% paraformaldehyde was added to each well to fix the cells at room temperature for 10 minutes. Then, the fixative was aspirated, the cells were washed twice with PBS, and 200 μL of 0.25% Triton X-100 was added to each well for permeabilization for 10 minutes. Next, 0.25% Triton X-100 was aspirated, the cells were washed twice with PBS, and then 100 μL of proteinase K working solution (4 μg / mL, prepared in PBS) was added to each well and incubated at room temperature for 10 minutes. Finally, the proteinase K working solution in the well was gently aspirated, the cells were washed twice with PBS, and PicoGreen was added and incubated in the dark. After incubation, mounting medium was added to the slides and images were captured using a fluorescence microscope.
[0038] Figure 5 The images of cytoplasmic DNA imaging of different cells using proteinase K assisted PicoGreen in the embodiment of the present invention are shown in the figure. The scale is 10 μm. Figure 5 As shown in the figure, there is background interference when nucleic acid dyes are used in 293T, A549 and B16-OVA cells. The use of proteinase K can effectively eliminate the background interference, thereby achieving accurate positioning and analysis of cytoplasmic DNA.
[0039] Example 3: Detection of Cy5-dsDNA in cells using proteinase K-assisted PicoGreen L929 cells were plated at a density of 10,000 per well in 8-well chambered coverslips and transfected with Cy5-dsDNA (generated by annealing two single-stranded DNAs: Cy5_5'-TTATCGTGTAAGTAACCCGCCTACTGGATATTGTCCCCAGCATTTAAAACCTCTGCCGTAAGCGATGTCCTGGCCCCTCCTCAGCACCTTATCCTTTCCGAACCGAATTTACGCATATAT-3' and 5'-ATATATGCGTAAATTCGGTTCGGAAAGGATAAGGTGCTGAGGAGGGGCCAGGACATCGCTTACGGCAGAGGTTTTAAATGCTGGGGACAATATCCAGTAGGCGGGTTACTTACACGATAA-3', SEQ ID NOs: 1 and 2) for 12 hours using a commercial reagent. Cells were first fixed with 200 μL of 4% paraformaldehyde per well for 10 minutes at room temperature. The fixative was then aspirated, the sections were washed twice with PBS, and 200 μL of 0.25% Triton X-100 was added to each well for permeabilization for 10 minutes. Next, the 0.25% Triton X-100 solution was aspirated, the sections were washed twice with PBS, and 100 μL of proteinase K working solution (4 μg / mL in PBS) was added to each well and incubated at room temperature for 10 minutes. Finally, the proteinase K working solution was gently aspirated, the sections were washed twice with PBS, and a fluorescent nucleic acid dye was added to incubate in the dark. After incubation, mounting medium was added and dual-channel images were captured using a fluorescence microscope.
[0040] Figure 6 This is a confocal image of the detection of Cy5-dsDNA in cells using Proteinase K-assisted PicoGreen in the embodiment of the present invention. The scale is 10 μm. Figure 6 As shown in the figure, when proteinase K is not used, the dsDNA signal is easily interfered by the background signal, and the identification and analysis of cytoplasmic DNA cannot be achieved. After proteinase K treatment, the background interference is significantly eliminated, and the co-localization effect of Cy5 and PicoGreen fluorescence spots is obvious, indicating that proteinase K can well assist PicoGreen or other nucleic acid dyes in cytoplasmic DNA imaging.
[0041] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
Claims
1. A method for imaging cytoplasmic DNA using proteinase K to reduce background interference, characterized in that: Prepare cell samples, sequentially treat with fixative, permeabilization agent, enzymatic solution, and nucleic acid fluorescent dye working solution, and finally seal with mounting medium and image under a fluorescence microscope; Wherein, the enzymatic hydrolysis solution contains proteinase K.
2. The method according to claim 1, characterized in that The enzymatic hydrolysis solution is prepared with PBS, wherein the concentration of proteinase K is 1-20 μg / mL, preferably 1, 4 and 20 μg / mL.
3. The method according to claim 1, characterized in that The fixative was 4% paraformaldehyde.
4. The method according to claim 1, wherein The permeabilization agent is 0.25% Triton X-100 or 1% NP40.
5. The method according to claim 1, wherein The nucleic acid fluorescent dye working solution is PicoGreen or DAPI.
6. The method according to claim 1, characterized in that The mounting medium is 50% glycerol or commercial anti-fluorescence quenching mounting medium.
7. The method according to any one of claims 1 to 6, characterized in that The cells are derived from animals.
8. The method according to claim 7, characterized in that The following steps are involved: (1) Prepare cell samples, wash the samples, and add fixative to treat the samples; (2) Aspirate the fixative, wash the sample, and add a permeabilizing agent to treat the sample; (3) Aspirate the permeabilization agent, wash the sample, and add the enzymatic solution for incubation; (4) Aspirate and discard the enzymatic solution, wash the sample, and add nucleic acid fluorescent dye working solution to stain in the dark; (5) Aspirate and discard the nucleic acid fluorescent dye working solution, wash the sample, and add mounting medium to obtain the sample for fluorescence microscopy imaging; (6) Imaging under a fluorescence microscope.
9. The method according to claim 8, characterized in that The reagent used for washing is PBS or TBS.
10. The method according to claim 9, characterized in that The cells were placed in a microwell plate and cultured with a coverslip, and the cell confluence was maintained at 50-80%; 200 μL of 4% paraformaldehyde fixative was added to each well and fixed at room temperature for 10 minutes; then the fixative was aspirated, the cells were washed twice with PBS, and 200 μL of 0.25% Triton X-100 permeabilization agent was added to each well for permeabilization for 10 minutes; next, the permeabilization agent was aspirated, the cells were washed twice with PBS, and then 100 μL of enzyme solution was added to each well and incubated at room temperature for 10 minutes; finally, the enzyme solution in the well was aspirated, the cells were washed twice with PBS, and the nucleic acid fluorescent dye working solution was added and incubated in the dark; after incubation, mounting medium was added for sealing and imaging was performed under a fluorescence microscope.