Compounds and methods for modulating SMN2

By using oligomeric compounds to regulate splicing of SMN2 RNA and increase the expression of full-length SMN2 protein, the problem of SMN2 RNA splicing is solved, the muscle and nerve function of SMA patients is improved, and the quality of life and survival rate is improved.

CN120464622APending Publication Date: 2025-08-12IONIS PHARMACEUTICALS INC
View PDF 93 Cites 0 Cited by

Patent Information

Application Number
CN202510501861.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2020-02-28
Filing Date
2021-02-26
Publication Date
2025-08-12

AI Technical Summary

Technical Problem

Existing treatments are difficult to effectively regulate the splicing of SMN2 RNA, resulting in symptoms such as decreased muscle strength, reduced neuromuscular activity, and decreased respiratory function in patients with spinal muscular atrophy, which seriously affects the patient's quality of life and survival rate.

Method used

Oligomeric compounds, especially modified oligonucleotides, are provided for regulating splicing of SMN2 RNA, increasing the expression of full-length SMN2 protein, thereby improving SMA symptoms.

Benefits of technology

By regulating the splicing of SMN2 RNA, increasing the expression of full-length SMN2 protein is improved, muscle strength, neuromuscular activity and respiratory function of SMA patients, and improving the quality of life and survival rate of patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005368673680000191
    Figure BDA0005368673680000191
  • Figure BDA0005368673680000201
    Figure BDA0005368673680000201
  • Figure BDA0005368673680000211
    Figure BDA0005368673680000211
Patent Text Reader

Abstract

Compounds, methods, and pharmaceutical compositions for modulating SMN2RNA and / or protein in a cell or subject are provided. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom of a neurodegenerative disorder. Such symptoms include: reduced muscle strength; a person cannot sit straight, stand and / or walk, or the ability thereof is reduced; neuromuscular activity is reduced; the electrical activity of one or more muscles is reduced; the respiratory action is reduced; without help, no eating, drinking and / or breathing or its ability is reduced; weight loss or weight gain reduction; and / or the survival rate is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of Chinese invention patent application number 202180017318.9, filed on February 26, 2021, and entitled “Compounds and Methods for Modulating SMN2.” The original application is a national phase application with international application number PCT / US2021 / 019934. This application claims the benefit of U.S. Provisional Patent Application Serial No. US62 / 983545, filed on February 28, 2020, which is incorporated herein by reference in its entirety.

[0002] Sequence Listing

[0003] This application is submitted with an electronic sequence listing. The sequence listing is provided as a 44KB file titled BIOL0367WOSEQ_ST25.txt, created on February 26, 2021. The information in the electronic sequence listing is incorporated herein by reference in its entirety. Technical Field

[0004] Compounds, methods, and pharmaceutical compositions for modulating SMN2 RNA in cells or subjects are provided. Such compounds, methods, and pharmaceutical compositions can be used to ameliorate at least one symptom of a neurodegenerative disorder. Such symptoms include: decreased muscle strength; inability or reduced ability to sit upright, stand, and / or walk; decreased neuromuscular activity; decreased electrical activity in one or more muscles; decreased respiration; inability or reduced ability to eat, drink, and / or breathe without assistance; weight loss or decreased weight gain; and / or decreased survival. Background Art

[0005] Proximal spinal muscular atrophy (SMA) is a hereditary neurodegenerative disorder characterized by loss of spinal motor neurons. SMA is an early-onset autosomal recessive disease and is the leading genetic cause of infant mortality. The severity of SMA varies from patient to patient and is therefore divided into four types. Type I SMA is the most severe form, with onset at birth or within 6 months, and usually leads to death within 2 years. Type I SMA children cannot sit or walk. Type II SMA is an intermediate form, and patients can sit, but cannot stand or walk. Type III SMA (a chronic form of the disease) patients usually develop SMA after 18 months of age (Lefebvre et al., Hum. Mol. Genet., 1998, 7, 1531-1536). Type IV SMA is a milder form and typically develops after age 18, sometimes after age 10; patients with Type IV SMA experience limited, mild motor impairments, are able to walk in adulthood, and typically have no respiratory or nutritional problems (Farrar et al., Ann. Neurol., 2017, 81, 355-368; D'Amico et al., Orphanet J. of Rare Diseases, 2011, 6:71).

[0006] The molecular basis of SMA is the loss of both copies of the survival motor neuron gene 1 (SMN1), which may also be referred to as the SMN telomere and encodes a protein that is part of a multiprotein complex thought to be involved in snRNP biogenesis and recycling. A nearly identical gene, SMN2 (also known as the SMN centromere), is present in a duplicated region on chromosome 5q13 and modulates disease severity. Although SMN1 and SMN2 have the potential to encode the same protein, expression of the normal SMN1 gene results only in the expression of the full-length survival motor neuron (SMN) protein, while expression of the SMN2 gene results in two distinct protein forms, the full-length SMN2 protein and a truncated SMN2 protein (SMNΔ7 protein). SMN2 contains a translationally silent mutation at position +6 of exon 7, which results in inefficient inclusion of exon 7 in the SMN2 transcript. Therefore, the predominant form of SMN2 is a truncated form lacking exon 7, which is unstable and inactive (Cartegni and Krainer, Nat. Genet., 2002, 30, 377-384). Expression of the SMN2 gene results in approximately 10-20% full-length SMN protein and 80-90% unstable / non-functional SMNΔ7 protein. SMN protein plays a well-established role in spliceosome assembly and also mediates mRNA trafficking in neuronal axons and nerve terminals.

[0007] It is an object herein to provide compounds, methods and pharmaceutical compositions for the treatment of SMA. Summary of the Invention

[0008] Provided herein are compounds, methods, and pharmaceutical compositions for modulating splicing of SMN2 RNA in a cell or subject. In certain embodiments, the compound useful for modulating splicing of SMN2 RNA is an oligomeric compound. In certain embodiments, the oligomeric compound increases the amount of SMN2 RNA including exon 7. In certain embodiments, the oligomeric compound increases expression of full-length SMN2 protein. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the subject suffers from a neurodegenerative disease. In certain embodiments, the subject suffers from spinal muscular atrophy (SMA).

[0009] Also provided are methods for ameliorating at least one symptom of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is SMA. In certain embodiments, symptoms include: decreased muscle strength; inability or reduced ability to sit upright, stand, and / or walk; decreased neuromuscular activity; decreased electrical activity in one or more muscles; decreased respiration; inability or reduced ability to eat, drink, and / or breathe without assistance; weight loss or decreased weight gain; and / or decreased survival. In certain embodiments, provided herein are modified oligonucleotides for use in treating SMA. DETAILED DESCRIPTION

[0010] It should be understood that the foregoing general description and the following detailed description are exemplary and illustrative only and are not restrictive. In this article, unless otherwise specifically stated, the use of the singular includes the plural. As used herein, unless otherwise specified, the use of "or" means "and / or". In addition, the use of the term "including" and other forms (such as "includes" and "included") is not restrictive. Similarly, unless otherwise specifically stated, terms such as "element" or "component" cover elements and components comprising one unit and elements and components comprising more than one subunit.

[0011] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including but not limited to patents, patent applications, articles, books and papers, and GenBank and NCBI reference sequence records, are hereby expressly incorporated by reference in their entirety and for the portions of the documents discussed herein.

[0012] definition

[0013] Unless specific definitions are provided, the nomenclature used in connection with the analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein, and the procedures and techniques thereof, are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications and other data cited throughout this disclosure are incorporated herein by reference in their entirety.

[0014] Unless otherwise indicated, the following terms have the following meanings:

[0015] As used herein, "2'-deoxyribonucleoside" means a nucleoside comprising a 2'-H (H) deoxyribosyl sugar moiety. In certain embodiments, the 2'-deoxyribonucleoside is a 2'-β-D-deoxyribonucleoside and comprises a 2'-β-D-deoxyribosyl sugar moiety having a β-D configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxyribonucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

[0016] As used herein, "2'-MOE" means a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. A "2'-MOE sugar moiety" is a sugar moiety in which a 2'-OCH2CH2OCH3 group replaces the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2'-MOE sugar moiety is in the β-D configuration. "MOE" means O-methoxyethyl.

[0017] As used herein, "2'-MOE nucleoside" means a nucleoside comprising a 2'-MOE sugar moiety.

[0018] As used herein, "2'-NMA" means a -O-CH2-C(=O)-NH-CH3 group in place of the 2'-OH group of a ribosyl sugar moiety. A "2'-NMA sugar moiety" is a sugar moiety in which the 2'-OH group of a ribosyl sugar moiety is replaced by a 2'-O-CH2-C(=O)-NH-CH3 group. Unless otherwise indicated, a 2'-NMA sugar moiety is in the β-D configuration. "NMA" means ON-methylacetamide.

[0019] As used herein, "2'-NMA nucleoside" means a nucleoside comprising a 2'-NMA sugar moiety.

[0020] As used herein, "2'-OMe" means a 2'-OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. A "2'-OMe sugar moiety" is a sugar moiety in which a 2'-OCH3 group replaces the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2'-OMe sugar moiety is in the β-D configuration. "OMe" means O-methyl.

[0021] As used herein, "2'-OMe nucleoside" means a nucleoside comprising a 2'-OMe sugar moiety. As used herein, "2'-substituted nucleoside" means a nucleoside comprising a 2'-substituted sugar moiety. As used herein, "2'-substituted" with respect to a sugar moiety means a sugar moiety comprising at least one 2'-substituent other than H or OH.

[0022] As used herein, "5-methylcytosine" means cytosine modified with a methyl group attached to position 5. 5-Methylcytosine is a modified nucleobase.

[0023] As used herein, "administering" means providing a pharmaceutical agent to a subject.

[0024] As used herein, "improvement" with respect to treatment means an improvement in at least one symptom relative to the same symptom in the absence of the treatment. In certain embodiments, the improvement is a decrease in the severity or frequency of the symptoms, or a delayed onset of the symptoms, or a slowing of the progression of severity or frequency. In certain embodiments, the symptoms are: decreased muscle strength; inability or decreased ability to sit upright, stand, and / or walk; decreased neuromuscular activity; decreased electrical activity in one or more muscles; decreased respiration; inability or decreased ability to eat, drink, and / or breathe without assistance; weight loss or decreased weight gain; and / or decreased survival.

[0025] As used herein, "antisense activity" means any detectable and / or measurable change attributable to hybridization of an antisense compound to its target nucleic acid.

[0026] As used herein, "antisense compound" means an oligomeric compound or oligomeric duplex capable of exerting at least one antisense activity.

[0027] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside comprising a bicyclic sugar moiety.

[0028] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl moiety is a ribosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

[0029] As used herein, "cerebrospinal fluid" or "CSF" means the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" means a fluid that is prepared or manufactured to have certain properties of cerebrospinal fluid.

[0030] As used herein, "cEt" means a 4' to 2' bridge in place of the 2' OH-group of a ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is in the S configuration. A "cEt sugar moiety" is a bicyclic sugar moiety in which a 4' to 2' bridge in place of the 2' OH-group of a ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is in the S configuration. "cEt" means constrained ethyl.

[0031] As used herein, "cEt nucleoside" means a nucleoside comprising a cEt sugar moiety.

[0032] As used herein, "chirally enriched population" means a plurality of molecules having the same molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules within the population that would be expected to contain the same particular stereochemical configuration at the same particular chiral center if the particular chiral center were stereorandom. A chirally enriched population of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

[0033] As used herein, " complementary " about oligonucleotide means when the oligonucleotide and the core base sequence of another nucleic acid are aligned in relative directions, at least 70% core bases of oligonucleotide or its one or more parts and the core bases of another nucleic acid or its one or more parts can hydrogen bond to each other.Complementary core bases means the core bases that can form hydrogen bonds with each other.Complementary core base pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G) and 5-methylcytosine (mC) and guanine (G).Complementary oligonucleotide and / or target nucleic acid need not all have core base complementarity at each nucleoside.On the contrary, some mispairings are allowed.As used herein, " fully complementary " or " 100% complementary " about oligonucleotide or its part means that each core base place of oligonucleotide or its part and another oligonucleotide or target nucleic acid in the shorter of two oligonucleotides is complementary, or if oligonucleotide is of the same length, then complementary at each nucleoside.

[0034] As used herein, "consecutive" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "consecutive nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.

[0035] As used herein, "hybridization" means the pairing or annealing of complementary oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding.

[0036] As used herein, "internucleoside linkage" means a covalent linkage between consecutive nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" means any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphorothioate internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside linkage is replaced by a sulfur atom.

[0037] As used herein, "mismatch" or "non-complementary" means that a nucleobase of the first oligonucleotide is not complementary to the corresponding nucleobase of the second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned.

[0038] As used herein, "motif" means the pattern of unmodified and / or modified sugar moieties, nucleobases and / or internucleoside linkages in an oligonucleotide.

[0039] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety comprising modifications (eg, substituents) that do not form a bridge between two atoms of the sugar to form a second ring.

[0040] As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is a group of atoms other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases. As used herein, a "nucleobase sequence" means the order of consecutive nucleobases in a target nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0041] As used herein, "nucleoside" means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. "Linked nucleosides" are nucleosides linked in a continuous sequence (i.e., no additional nucleosides are present between the linked nucleosides).

[0042] As used herein, "oligomeric compound" means an oligonucleotide and optionally one or more additional features, such as a conjugated group or a terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligoduplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligoduplex may be referred to as a "duplex oligomeric compound."

[0043] As used herein, "oligonucleotide" means a chain of linked nucleosides connected via internucleoside bonds, wherein each nucleoside and internucleoside bond may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8-50 linked nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide in which at least one nucleoside or internucleoside bond is modified. As used herein, "unmodified oligonucleotide" means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.

[0044] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.

[0045] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for administration to a subject. Certain such carriers enable pharmaceutical compositions to be formulated, for example, as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, a sterile buffered solution, or sterile artificial cerebral spinal fluid.

[0046] As used herein, "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of a compound. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesirable toxicological effects thereto.

[0047] Unless otherwise specified, as used herein, "RNA" means RNA transcripts and includes pre-mRNA and mature mRNA.

[0048] As used herein, "stereorandom chiral center" refers to a chiral center with random stereochemical configuration in the context of a population of molecules having the same molecular formula. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having a stereorandom chiral center with the (S) configuration may, but may not, be the same as the number of molecules having a stereorandom chiral center with the (R) configuration. The stereochemical configuration of a chiral center is considered random when the synthetic method is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0049] As used herein, "subject" means a human or non-human animal.

[0050] As used herein, "sugar moiety" means an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" means a 2'-OH(H)β-D ribosyl moiety as found in RNA ("unmodified RNA sugar moiety") or a 2'-H(H)β-D deoxyribosyl moiety as found in DNA ("unmodified DNA sugar moiety"). Unmodified sugar moieties have one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or sugar surrogate.

[0051] As used herein, "sugar surrogate" means a modified sugar moiety, other than a furanosyl moiety, that can link a nucleobase to another group in an oligonucleotide (e.g., an internucleoside linkage, a conjugate group, or a terminal group). Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to a complementary oligomeric compound or a target nucleic acid.

[0052] As used herein, "standard in vivo assay" means the assay described in Example 2 and reasonable variations thereof.

[0053] As used herein, "symptom" means any physical characteristic or test result that indicates the presence or extent of a disease or condition. In certain embodiments, the symptom is obvious to the subject or a medical professional examining or testing the subject.

[0054] As used herein, "target nucleic acid" means the nucleic acid that an antisense compound is designed to affect.

[0055] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0056] As used herein, "terminal group" means a chemical group or group of atoms covalently linked to the terminus of an oligonucleotide.

[0057] As used herein, a "therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves the symptoms of a disease.

[0058] Certain embodiments

[0059] The present disclosure provides the following non-limiting numbered embodiments:

[0060] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 16, 17, 18, 19 or 20 linked nucleosides and a nucleobase sequence comprising at least 15 or at least 16 consecutive nucleobases of any one of the nucleobase sequences SEQ ID NOs: 20-50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0061] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 17, 18, 19 or 20 linked nucleosides and a nucleobase sequence comprising at least 15, at least 16 or at least 17 consecutive nucleobases of any one of the nucleobase sequences SEQ ID NOs: 20-27, 29-30 or 32-50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0062] Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 18, 19 or 20 linked nucleosides and a nucleobase sequence comprising at least 15, at least 16, or at least 17 or at least 18 consecutive nucleobases of any one of the nucleobase sequences SEQ ID NOs: 20-27, 30 or 33-50, wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety and a modified internucleoside linkage.

[0063] Embodiment 4. An oligomeric compound comprising a modified oligonucleotide consisting of 19 or 20 linked nucleosides and a nucleobase sequence comprising at least 15, at least 16, or at least 17, at least 18, or at least 19 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 20, 22, 24-27, 30, 33-50, wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety and a modified internucleoside linkage.

[0064] Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and a nucleobase sequence comprising at least 15, at least 16, or at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NO: 20, 22, 25, 27, 35, 39-46, or 49, wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar moiety and a modified internucleoside linkage.

[0065] Embodiment 6. The oligomeric compound of any one of embodiments 1-5, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, 85%, 87.5%, 88.2%, 89%, 89.4%, 90%, 93.7%, 94%, 94.7%, 95% or 100% complementary to the nucleobase sequence of SEQ ID NO: 1 when measured over the entire nucleobase sequence of the modified oligonucleotide.

[0066] Embodiment 7. An oligomeric compound according to any one of Embodiments 1-6, wherein the modified oligonucleotide has a internucleoside linkage motif (5' to 3') selected from: sosososssssssssssss, ssosssssssssssoss, ssosssssosssssoss, ssosssosssosssoss, soossssssssssooss, sooossssssssssooss, sooosssssssssoooss, ssssssssooosssssss, ssossssssssssssss, sssssossssssssssss, sssssssossssssssss, sssssssssossssssss, sssssssssssossssss, sssssssssssssossss, sssssssssssssssoss, sossssssssssssoss, sosssssssssosssss, sosssssssosssssss, sosssssosssssssss, sosssosssssssssss, sssssosssssssssoss, sssssssosssssssoss, sssssssssosssssoss, sssssssssssosssoss, sssssssssssssososs, soossssssssssssss, sssoossssssssssss, ssssssoossssssssss, ssssssssoossssssss, ssssssssssoossssss, ssssssssssssoossss, ssssssssssssssooss, ssssssssoooossssss, ssoooosssssssssss, ssssoooosssssssss, sssssssssoooosssss, sssssssssssoooosss, ssssssssssssooooss, sssssssooooossssss, sssssssoooooosssss, sooossssssssoooss, ssssssooooooosssss, sssssssssssssssoss, sssssssssssssosss, ssssssssssssssooss, sssssssssssssososs, ssssssssssssosssss, ssssssssssssososss, sssssssssssossosss, ssssssssssosssssss, ssssssssssosssosss, sssssssssosssssoss,ssssssssosssssss、ssssssssssssss、ssssssssssssss、sssssssssssss、sssssssssssssss、sssssssssssssssssssss、ssssssssssssssssssssss、ssssssssssssssssssssss、sssssssssssssssssssssss、sssssssssssssssssssssss、ssssssssssssssssssssss、sssssssssssssssssssssss、ssssssssssssssssssssssss、soss ... ss、soossssssssssssss、ossssssssssssssssso、s ... sssssssssssss、sssssssssssssssss、sssssssssssssssss、sssssssssssssssssss、ssssssssssssssssssssssss、sosssssssssssssssssssssssssssss、sosssssssssssssssssssssssss、sossssssssssssssssssss、sossssssssssssssssssss、sosss sssssssssssss、soosssssssssssssss、s ... sssoss、sssssssssssssosss、ssssssssssssssssss、ssssssssssssssssssss、ssssssssssssssssssssss、ssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss、sos ... sosssssssssssssss、 ...s、ssssssssss ooooooosssss、ssssssssssss、ssosssssssssssss、ssossssssssssssss、ssosssssssssssssssss、ssossssssssssssssssssss、ssosssssssssssssssssss、ssossssssssssssssss、ssosssssssssssssss、ssosssssssssssssss、ssoooossssssssssssssss、soossssssssssssssssss、sooosssssssssssssssss、s ...ssssssoooosssss, ssssssooooosssss, sssssoooooosssss, ssssoooossssss, ssssooooooossss, sssosssosssosss, ssossssssssssoss, ssossossossoss, ssossossososs, ssososososososs, ssoooosssssssss, soosssssssssooss, soooossssssssoooss, and soooosssssssoooss; wherein 's' represents a phosphorothioate internucleoside linkage and 'o' represents a phosphodiester internucleoside linkage.

[0067] Embodiment 8. The oligomeric compound of any one of embodiments 1-6, wherein the modified oligonucleotide has an internucleoside linkage motif selected from the group consisting of: sssssssssssssssxs and ssssssssssssssssx; wherein 's' represents a phosphorothioate internucleoside linkage, 'o' represents a phosphodiester internucleoside linkage and "x" represents a methoxypropylphosphonate internucleoside linkage.

[0068] Embodiment 9. The oligomeric compound of any one of embodiments 1-6, wherein the modified oligonucleotide has an internucleoside linkage motif selected from the group consisting of: zzzzzzzzzzzzzzzzz, ssssssssssszzzzzz, ssssszzzzzzsssssss, zzooooooooooooozz, zzzzooooooooooozz, zzzzzzooooooooozz, zzzzzzzzooooooozz, and ssoooooooooooooss; wherein 's' represents a phosphorothioate internucleoside linkage, 'o' represents a phosphodiester internucleoside linkage, and "z" represents a methylsulfonyl phosphoramidate internucleoside linkage.

[0069] Embodiment 10. The oligomeric compound according to any one of Embodiments 1-9, wherein the modified oligonucleotide has a glycosyl motif (5' to 3') selected from the following: eeeeeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeee, nnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnnnnn, nennnnneneennnnnnn, nnnnnnnnnnnenneen, nennnnneneenenneen, nnnnnnnnnnnnnnnnnnne, nnnnnnnnnnnnnnnnnnnd, nnnnnnnnnnnnnnnnnnny, nnnnnnnnnnnnnnnnnnndd, nnnnnnnnnnnnnnnnnnned, nnnnnnnnnnnnnnnnnnnde, nnnnnnnnnnnnnnnnnnnee, eeeeeeeeeeeeeeeeeeedd, eeeeeeeeeeeeeeeeeeeed, eeeeeeeeeeeeeeeeeeede, nnnnnnnnnnnnnnnnnnnd, nnnnnnnnnnnnnnnnnnne, eeeeeeeeeeeeeeeeeeed, keekeekeekeekeeeek, keeekeeekeeekeeeek, keeeeekeeeeekeeeek, keeeeeeekeeeeeeeek, keeeeeeeeeeeeeeeek, eeekeekeekeekeekek, eeekeekeekeekeekee, eeeeeeekeekeekeekee, eeeeeeekeekeekeeeee, eeeeeeekeeeeekeeeee, keekeekeekeeeeeeee, eeeeeeeeekeekeekeek, keekeekeeeeeeeeeee, eeeeeeeeeeeekeekeek, keekeeeeeeeeeeeeee, eeeeeeeeeeeeeeekeek, keekeekeekeekeeek, keeeekeeekeeekeeek, keeeekeeeeekeeeek, keeeeeeekeeeeeeek, keeeeeeeeeeeeeeek, eekeekeekeekeekek,eekeekeekeekeekee, eeeeekeekeekeekee, eeeeekeekeekeeeee, eeeeekeeeeeekeeeee, keekeekeekeeeeeee, eeeeeeekeekeekeek, keekeekeeeeeeeeee, eeeeeeeeekeekeek, keekeeee eeeeeeee, eeeeeeeeeeeeekeek, keekeekeekeekeek, keeekeekeekeekeek, keeeekeeeekeeeek, keeeeeeekeeeeeek, keeeeeeeeeeeeek, kekeekeekeekeeke, eekeekeekeekeeke, eeeeekee keekeeke, eeeeekeekeekeeee, eeeeekeeeeekeeee, keekeekeekeeeeee, eeeeeekeekee, keekeeeeeeeeeeee, eeeeeeeeeeeekeek, keekeeeeeeeeeeee, eeeeeeeeeeeeeeed, eeeeeeeeeeeeeeeeeey, ennnnnnnnnnnnnnnnnn, and ennnnnnnnnnnnnnnnnnnne; wherein 'e' represents a 2'-MOE sugar moiety, 'n' represents a 2'-NMA sugar moiety, 'k' represents a cEt sugar moiety, 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, and 'y' represents a 2'-OMe sugar moiety.

[0070] Embodiment 11. The oligomeric compound of any one of embodiments 1-9, wherein the modified oligonucleotide has a sugar motif (5' to 3') selected from the group consisting of: nnnnnnnnnnnnnnnenn and nnnnnnnnnnnnnnnnenen, wherein 'e' represents a 2'-MOE sugar moiety and 'n' represents a 2'-NMA sugar moiety.

[0071] Embodiment 12. An oligomeric compound as described in any one of embodiments 1-9, wherein the modified oligonucleotide has a sugar motif (5' to 3')qqnqqqqqnqnnqnqqnn, wherein each 'n' represents a 2'-NMA sugar moiety and each 'q' is independently selected from a 2'-O-(N,N-dimethyl)acetamide sugar moiety, a 2'-O-(N-ethyl)acetamide sugar moiety, a 2'-O-(N-propyl)acetamide sugar moiety, a 2'-O-(N-cyclopropyl)acetamide sugar moiety and a 2'-O-(N-cyclopropylmethyl)acetamide sugar moiety.

[0072] Embodiment 13. The oligomeric compound of any one of embodiments 1-9, wherein the modified oligonucleotide comprises at least one modified sugar moiety.

[0073] Embodiment 14. The oligomeric compound of embodiment 13, wherein the modified oligonucleotide comprises at least one bicyclic sugar moiety.

[0074] Embodiment 15. The oligomeric compound of embodiment 14, wherein the bicyclic sugar moiety has a 4'-2' bridge, wherein the 4'-2' bridge is selected from -CH2-O- and -CH(CH3)-O.

[0075] Embodiment 16. The oligomeric compound of embodiment 13, wherein the modified oligonucleotide comprises at least one non-bicyclic modified sugar moiety.

[0076] Embodiment 17. The oligomeric compound of embodiment 16, wherein the non-bicyclic modified sugar moiety is any one of a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety.

[0077] Embodiment 18. The oligomeric compound of embodiment 13, wherein the modified oligonucleotide comprises at least one sugar surrogate.

[0078] Embodiment 19. The oligomeric compound of embodiment 18, wherein the sugar surrogate is any one of morpholino, modified morpholino, PNA, THP, and F-HNA.

[0079] Embodiment 20. The oligomeric compound of any one of embodiments 1-6 and 10-19, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0080] Embodiment 21. The oligomeric compound of embodiment 20, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

[0081] Embodiment 22. The oligomeric compound of embodiment 20 or embodiment 21, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0082] Embodiment 23. The oligomeric compound of any one of embodiments 1-20 or 22, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0083] Embodiment 24. The oligomeric compound of embodiment 20, 22 or 23, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0084] Embodiment 25. An oligomeric compound as described in any one of embodiments 13-19, wherein the modified oligonucleotide has an internucleoside linkage motif (5' to 3') selected from the following: sosossssssssssssss, soosssssssssssssss, sosssossssssssssss, sosssssossssssssss, sossssssosssssssss, sssoossssssssss, ssssssssssoosssssss and ssssssssssssoossssss; wherein 's' represents phosphorothioate internucleoside linkages and 'o' represents phosphodiester internucleoside linkages.

[0085] Embodiment 26. The oligomeric compound of any one of embodiments 1-25, wherein the modified oligonucleotide comprises a modified nucleobase.

[0086] Embodiment 27. The oligomeric compound of embodiment 26, wherein the modified nucleobase is 5-methylcytosine.

[0087] Embodiment 28. The oligomeric compound of any one of embodiments 1-27, wherein the modified oligonucleotide consists of 16, 17, 18, 19 or 20 linked nucleosides.

[0088] Embodiment 29. The oligomeric compound of any one of embodiments 1-28, wherein the modified oligonucleotide comprises 1 or 2 non-complementary nucleobases.

[0089] Embodiment 30. The oligomeric compound of any one of embodiments 1-29, wherein the modified oligonucleotide comprises 1 or 2 cleavable moieties.

[0090] Embodiment 31. The oligomeric compound of embodiment 30, wherein the cleavable moiety is a phosphodiester internucleoside linkage.

[0091] Embodiment 32. The oligomeric compound of any one of embodiments 1-31, consisting of the modified oligonucleotide.

[0092] Embodiment 33. The oligomeric compound of any one of embodiments 1-32, wherein the oligomeric compound is a single-chain oligomeric compound.

[0093] Embodiment 34. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es A eo m C es T eo T es T es m C es A es T es A es A es T es G es m C es T es G es G es m C e (SEQ ID NO: 21), wherein:

[0094] A = adenine nucleobase,

[0095] m C=5-methylcytosine nucleobase,

[0096] G = guanine nucleobase,

[0097] T = thymine nucleobase,

[0098] e=2'-MOE sugar moiety,

[0099] s = phosphorothioate internucleoside linkage, and

[0100] o = phosphodiester internucleoside linkage.

[0101] Embodiment 35. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: eo T es m C es A es m C es T es T es T es m C es A es T es A es A es T es G esm C es T es G es G eo m C e (SEQ ID NO: 22), wherein:

[0102] A = adenine nucleobase,

[0103] m C=5-methylcytosine nucleobase,

[0104] G = guanine nucleobase,

[0105] T = thymine nucleobase,

[0106] e=2'-MOE sugar moiety,

[0107] s = phosphorothioate internucleoside linkage, and

[0108] o = phosphodiester internucleoside linkage.

[0109] Embodiment 36. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: eo T ns m C ns A ns m C ns T ns T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G no m C e (SEQ ID NO: 22), wherein:

[0110] A = adenine nucleobase,

[0111] m C=5-methylcytosine nucleobase,

[0112] G = guanine nucleobase,

[0113] T = thymine nucleobase,

[0114] e=2'-MOE sugar moiety,

[0115] n=2'-NMA sugar moiety,

[0116] s = phosphorothioate internucleoside linkage, and

[0117] o = phosphodiester internucleoside linkage.

[0118] Embodiment 37. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C ns A no m C ns T no T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G ns m C n (SEQ ID NO: 21), wherein:

[0119] A = adenine nucleobase,

[0120] m C=5-methylcytosine nucleobase,

[0121] G = guanine nucleobase,

[0122] T = thymine nucleobase,

[0123] n=2'-NMA sugar moiety,

[0124] s = phosphorothioate internucleoside linkage, and

[0125] o = phosphodiester internucleoside linkage.

[0126] Embodiment 38. A modified oligonucleotide according to the following chemical structure:

[0127]

[0128] (SEQ ID NO: 21), or a salt thereof.

[0129] Embodiment 39. The modified oligonucleotide of embodiment 38, which is a sodium salt or a potassium salt.

[0130] Embodiment 40. A modified oligonucleotide according to the following chemical structure:

[0131] (SEQ ID NO: 21).

[0132] Embodiment 41. A modified oligonucleotide according to the following chemical structure:

[0133]

[0134] (SEQ ID NO: 22), or a salt thereof.

[0135] Embodiment 42. The modified oligonucleotide of embodiment 41, which is a sodium salt or a potassium salt.

[0136] Embodiment 43. A modified oligonucleotide according to the following chemical structure:

[0137] (SEQ ID NO: 22).

[0138] Embodiment 44. A modified oligonucleotide according to the following chemical structure:

[0139]

[0140] (SEQ ID NO: 22), or a salt thereof.

[0141] Embodiment 45. The modified oligonucleotide of embodiment 44, which is a sodium salt or a potassium salt.

[0142] Embodiment 46. A modified oligonucleotide corresponding to the following chemical structure:

[0143] (SEQ ID NO: 22).

[0144] Embodiment 47. A modified oligonucleotide according to the following chemical structure:

[0145]

[0146] (SEQ ID NO: 21), or a salt thereof.

[0147] Embodiment 48. The modified oligonucleotide of embodiment 47, which is a sodium salt or a potassium salt.

[0148] Embodiment 49. A modified oligonucleotide according to the following chemical structure:

[0149]

[0150] (SEQ ID NO: 21).

[0151] Embodiment 50. A pharmaceutical composition comprising the oligomeric compound of any one of embodiments 1-36 or the modified oligonucleotide of any one of embodiments 38-49 and a pharmaceutically acceptable diluent or carrier.

[0152] Embodiment 51. The pharmaceutical composition of embodiment 50, comprising a pharmaceutically acceptable diluent, and wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or PBS.

[0153] Embodiment 52. The pharmaceutical composition of embodiment 51, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial CSF (aCSF).

[0154] Embodiment 53. The pharmaceutical composition of embodiment 51, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS.

[0155] Embodiment 54. A chirally enriched population of modified oligonucleotides as described in any one of embodiments 38-49, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration.

[0156] Embodiment 55. The chirally enriched population of embodiment 54, wherein the population is enriched for at least one modified oligonucleotide having a specific phosphorothioate internucleoside linkage of the (Sp) configuration.

[0157] Embodiment 56. The chirally enriched population of embodiment 54, wherein the population is enriched for at least one modified oligonucleotide having a specific phosphorothioate internucleoside linkage of the (Rp) configuration.

[0158] Embodiment 57. The chirally enriched population of embodiment 54, wherein the population is enriched for modified oligonucleotides having a specific independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0159] Embodiment 58. A chirally enriched population as described in embodiment 57, wherein the population is enriched for modified oligonucleotides having a (Sp) configuration at each phosphorothioate internucleoside linkage or modified oligonucleotides having a (Rp) configuration at each phosphorothioate internucleoside linkage.

[0160] Embodiment 59. The chirally enriched population of embodiment 57, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0161] Embodiment 60. The chirally enriched population of Embodiment 57, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the 5' to 3' direction in the configurations of Sp, Sp, and Rp.

[0162] Embodiment 61. A population of modified oligonucleotides according to any one of embodiments 38-49, wherein all phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0163] Embodiment 62. A method of treating a disease associated with SMN1 or SMN2, the method comprising administering to a subject having or at risk of developing a disease associated with SMN1 or SMN2 a therapeutically effective amount of the pharmaceutical composition of any one of embodiments 50-53; and thereby treating the disease associated with SMN1 or SMN2.

[0164] Embodiment 63. The method of embodiment 62, wherein the disease associated with SMN1 or SMN2 is a neurodegenerative disease.

[0165] Embodiment 64. The method of embodiment 63, wherein the neurodegenerative disease is spinal muscular atrophy (SMA).

[0166] Embodiment 65. The method of embodiment 64, wherein the SMA is any one of type I SMA, type II SMA, type III SMA, or type IV SMA.

[0167] Embodiment 66. The method of embodiment 64 or embodiment 65, wherein at least one symptom of SMA is improved.

[0168] Embodiment 67. The method of embodiment 66, wherein the symptom is any of the following: decreased muscle strength; inability or decreased ability to sit upright, stand and / or walk; decreased neuromuscular activity; decreased electrical activity in one or more muscles; decreased respiration; inability or decreased ability to eat, drink and / or breathe without assistance; weight loss or decreased weight gain; and / or decreased survival rate.

[0169] Embodiment 68. The method of any one of embodiments 62-67, wherein the pharmaceutical composition is administered to the central nervous system or systemically.

[0170] Embodiment 69. The method of embodiment 68, wherein the pharmaceutical composition is administered to the central nervous system and systemically.

[0171] Embodiment 70. The method of any one of embodiments 62-67, wherein the pharmaceutical composition is administered any one of intrathecally, systemically, subcutaneously, or intramuscularly.

[0172] Embodiment 71. A method of increasing SMN2 RNA including exon 7, the method comprising contacting a cell, tissue, or organ with the oligomeric compound of any one of embodiments 1-37, the modified oligonucleotide of any one of embodiments 38-49, or the pharmaceutical composition of any one of embodiments 50-53.

[0173] Certain oligonucleotides

[0174] In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide consisting of connected nucleosides. The oligonucleotide may be an unmodified oligonucleotide (RNA or DNA) or a modified oligonucleotide. Relative to unmodified RNA or DNA, the modified oligonucleotide comprises at least one modification. That is, the modified oligonucleotide comprises at least one modified nucleoside (comprising a modified sugar moiety and / or a modified core base) and / or at least one modified internucleoside linkage.

[0175] Certain modified nucleosides

[0176] Modified nucleosides comprise a modified sugar moiety, or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0177] Certain sugar moieties

[0178] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogate may contain one or more substitutions corresponding to other types of modified sugar moieties.

[0179] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring having one or more substituents, none of which bridge the two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be located at any position of the furanosyl group, including but not limited to substituents at the 2', 4' and / or 5' positions. In certain embodiments, one or more non-bridging substituents of the non-bicyclic modified sugar moiety are branched. Examples of 2'-substituents suitable for non-bicyclic modified sugar moieties include but are not limited to: 2'-F, 2'-OCH3 ("OMe" or "O-methyl") and 2'-O(CH2)2OCH3 ("MOE" or "O-methoxyethyl") and 2'-ON-alkylacetamides, for example, 2'-ON-methylacetamide ("NMA"), 2'-ON-dimethylacetamide, 2'-ON-ethylacetamide, or 2'-ON-propylacetamide. For example, see US 6,147,200, Prakash et al., 2003, Org. Lett., 5, 403-6. "2'-ON-methylacetamide nucleoside" or "2'-NMA nucleoside" is shown below:

[0180]

[0181] In certain embodiments, the 2'-substituent is selected from the group consisting of: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ) or OCH2C(=O)-N(R m )(R n ), where each R m and Rn are independently H, an amino protecting group or a substituted or unsubstituted C1-C 10 alkyl, and 2'-substituents described in Cook et al., US6,531,584; Cook et al., US5,859,221; and Cook et al., US6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from the group consisting of hydroxy, amino, alkoxy, carboxyl, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, the non-bicyclic modified sugar moiety comprises more than one non-bridging sugar substituent, such as 2'-F-5'-methyl sugar moiety and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US 2013 / 0203836.

[0182] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2'-substituent selected from the group consisting of F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2), ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )), where each R m and R n are independently H, an amino protecting group or a substituted or unsubstituted C1-C 10 Alkyl, for example, OCH2C(=O)-N(H)CH3 ("NMA").

[0183] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2'-substituent selected from the group consisting of F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0184] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2'-substituent selected from the group consisting of: F, OCH3, OCH2CH2OCH3, and OCH2C(=O)-N(H)CH3.

[0185] Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, thereby generating a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and 2' furanose ring atoms. Examples of such 4' to 2' bridged sugar substituents include, but are not limited to, 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("constrained MOE" or "cMOE"), and the like (see, e.g., Seth et al., US Pat. No. 7,399,845; Bhat et al., US Pat. No. 7,569,686; Swayze et al., US Pat. No. 7,741,457; and Swayze et al., US Pat. No. 7,741,457. 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,426), 4'-C(R a R b)-N(R)-O-2'、4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2', wherein each R, R a and R b are independently H, a protecting group or a C1-C 12 Alkyl (see, eg, Imanishi et al., US 7,427,672).

[0186] In certain embodiments, such 4' to 2' bridges independently comprise 1 to 4 linked groups independently selected from: -[C(R a )(R b )] n -、-[C(R a )(R b )] n -O-、-C(R a )=C(R b )-、-C(R a )=N-、-C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-、-S(=O) x -and-N(R a )-;

[0187] in:

[0188] x is 0, 1, or 2;

[0189] n is 1, 2, 3, or 4;

[0190] Each R a and R b are independently H, a protecting group, a hydroxyl group, a C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-C7 alicyclic group, substituted C5-C7 alicyclic group, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl group (C(═O)-H), substituted acyl group, CN, sulfonyl group (S(═O)2-J1), or sulfoxyl group (S(═O)-J1); and

[0191] Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C (= O) -H), substituted acyl, heterocyclic group, substituted heterocyclic group, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl or a protecting group.

[0192] Other bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 836. 2-8379; Wengel et al., US7,053,207; Imanishi et al., US6,268,490; Imanishi et al., US6,770,748; Imanishi et al., USRE44,779; Wengel et al., US6,794,499; Wengel et al., US6,670,461; Wengel et al., US7,034,133; Wengel et al., US8,080,644; Wengel et al., US8,034,909; Wengel et al., US8,153,365; Wengel et al., US7,572,582; and Ramasamy et al., US6,525,191; Torsten et al., WO 2004 / 106356; Wengel et al., WO 1999 / 014226; Seth et al., WO 2007 / 134181; Seth et al., US7,547,684; Seth et al., US7,666,854; Seth et al., US8,088,746; Seth et al., US7,750,131; Seth et al., US8,030,467; Seth et al., US8,268,980; Seth et al., US8,546,556; Seth et al., US8,530,640; Migawa et al., US9,012,421; Seth et al., US8,501,805; and Allerson et al., U.S. Patent Publication No. US2008 / 0039618 and Migawa et al., U.S. Patent Publication No. US2015 / 0191727.

[0193] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L configuration or the β-D configuration.

[0194]

[0195] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides and have demonstrated antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this article, the general description of bicyclic nucleosides includes two isomeric configurations. Unless otherwise indicated, when the position of a specific bicyclic nucleoside (e.g., LNA or cEt) is identified in the embodiments exemplified herein, it is in the β-D configuration.

[0196] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridged sugars).

[0197] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced by, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, some sugar surrogate includes a 4'-sulfur atom and a substitution at the 2' position (see, for example, Bhat et al., US7,875,733 and Bhat et al., US7,939,677) and / or the 5' position.

[0198] In certain embodiments, the sugar surrogate comprises a ring having other than 5 atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acids ("HNA"), anitol nucleic acids ("ANA"), mannitol nucleic acids ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

[0199]

[0200] (“F-HNA,” see, e.g., Swayze et al., US Pat. No. 8,088,904; Swayze et al., US Pat. No. 8,440,803; Swayze et al., US Pat. No. 8,796,437; and Swayze et al., US Pat. No. 9,005,906; F-HNA may also be referred to as F-THP or 3′-fluorotetrahydropyran) and nucleosides comprising other modified THP compounds having the formula:

[0201]

[0202] wherein, independently, for each of said modified THP nucleosides:

[0203] Bx is the nucleobase moiety;

[0204] T3 and T4 are each independently an internucleoside linking group that connects the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that connects the modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugating group, or a 5' or 3'-terminal group;

[0205] q1, q2, q3, q4, q5, q6 and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl; and

[0206] R1 and R2 are each independently selected from: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 and CN, wherein X is O, S or NJ1, and J1, J2 and J3 are each independently H or C1-C6 alkyl.

[0207] In certain embodiments, modified THP nucleosides are provided wherein each of q1, q2, q3, q4, q5, q6, and q7 is H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is not H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0208] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholinyl sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US5,698,685; Summerton et al., US5,166,315; Summerton et al., US5,185,444; and Summerton et al., US5,034,506). As used herein, the term "morpholinyl" means a sugar surrogate having the following structure:

[0209]

[0210] In certain embodiments, the morpholino group can be modified, for example, by adding or changing various substituents compared to the morpholino structure described above. Such sugar surrogates are referred to herein as "modified morpholino groups."

[0211] In certain embodiments, the sugar surrogate comprises a non-cyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogate include, but are not limited to, peptide nucleic acids ("PNAs"), non-cyclic butyl nucleic acids (see, for example, Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865) and Manoharan et al., nucleosides and oligonucleotides described in WO 2011 / 133876.

[0212] Numerous other bicyclic and tricyclic sugars and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

[0213] Certain modified nucleobases

[0214] In certain embodiments, the modified oligonucleotide comprises one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides comprising a modified nucleobase. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides that do not comprise a nucleobase, referred to as abasic nucleosides.

[0215] In certain embodiments, the modified nucleobase is selected from the group consisting of a 5-substituted pyrimidine, a 6-azapyrimidine, an alkyl or alkynyl substituted pyrimidine, an alkyl substituted purine, and N-2, N-6, and O-6 substituted purines. In certain embodiments, the modified nucleobase is selected from the group consisting of: 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-sulfanyl, 8-hydroxy, 8-aza and Other 8-substituted purines; 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil and 5-halocytosine; 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, mixed bases, size-expanded bases and fluorinated bases. Other modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenthiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases may also include nucleobases in which the purine or pyrimidine base is replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanine, 2-aminopyridine, and 2-pyridone.Other nucleobases include those disclosed by Merigan et al., US Pat. No. 3,687,808; The Concise Encyclopedia Of Polymer Science And Engineering, edited by Kroschwitz, JI, John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, edited by Crooke, ST and Lebleu, B., CRC Press, 1993, 273-288; and Chapters 6 and 15, Antisense Drug Technology, edited by Crooke ST, CRC Press, 2008, 163-166 and 442-443.

[0216] Disclosures teaching the preparation of some of the modified nucleobases described above, as well as other modified nucleobases, include, but are not limited to: Manoharan et al., US 2003 / 0158403; Manoharan et al., US 2003 / 0175906; Dinh et al., US 4,845,205; Spielvogel et al., US 5,130,302; Rogers et al., US 5,134,066; Bischofberger et al., US 5 ,175,273; Urdea et al., US5,367,066; Benner et al., US5,432,272; Matteucci et al., US5,434,257; Gmeiner et al., US5,457,187; Cook et al., US5,459,255; Froehler et al., US5,484,908; Matteucci et al., US5,502,177; Hawkins et al., US5,525, 711; Haralambidis et al., US5,552,540; Cook et al., US5,587,469; Froehler et al., US5,594,121; Switzer et al., US5,596,091; Cook et al., US5,614,617; Froehler et al., US5,645,985; Cook et al., US5,681,941; Cook et al., US5,811,534; Cook et al. Cook et al., US5,750,692; Cook et al., US5,948,903; Cook et al., US5,587,470; Cook et al., US5,457,191; Matteucci et al., US5,763,588; Froehler et al., US5,830,653; Cook et al., US5,808,027; Cook et al., US6,166,199; and Matteucci et al., US6,005,096.

[0217] Certain modified internucleoside linkages

[0218] In certain embodiments, the nucleosides of the modified oligonucleotide can be linked together using any internucleoside linkage. The two main categories of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester, which contains a phosphodiester bond (P(O2)=O) (also referred to as unmodified or naturally occurring linkages); phosphotriester; methylphosphonate; methoxypropylphosphonate ("MOP"); phosphoramidate; methylsulfonylphosphoramidate; phosphorothioate (P(O2)=S) and phosphorodithioate (HS-P=S). Representative non-phosphorus-containing internucleoside linking groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-); thiodiester; thiocarbonylcarbamate (-OC(=O)(NH)-S-); siloxane (-O-SiH2-O-); and N, N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Compared to naturally occurring phosphate linkages, modified internucleoside linkages can be used to alter (usually increase) the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages with chiral atoms can be prepared as racemic mixtures or separated enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0219] Representative internucleoside linkages with chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. The modified oligonucleotide comprising the internucleoside linkage with a chiral center can be prepared into a population of modified oligonucleotides comprising stereo-random internucleoside linkages, or a population of modified oligonucleotides comprising phosphorothioate internucleoside linkages in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides comprises wherein all phosphorothioate internucleoside linkages are stereo-random phosphorothioate internucleoside linkages. Such modified oligonucleotides can be generated using a synthetic method that randomly selects the stereochemical configuration of each phosphorothioate internucleoside linkage. Nevertheless, as those skilled in the art fully appreciate, each individual phosphorothioate of each individual oligonucleotide molecule has a definite stereoconfiguration. In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides comprising one or more specific phosphorothioate internucleoside linkages in a specific independently selected stereochemical configuration. In certain embodiments, a specific phosphorothioate internucleoside linkage of a specific configuration is present in at least 65% of the molecules in the population. In certain embodiments, a specific phosphorothioate internucleoside linkage of a specific configuration is present in at least 70% of the molecules in the population. In certain embodiments, a specific phosphorothioate internucleoside linkage of a specific configuration is present in at least 80% of the molecules in the population. In certain embodiments, a specific phosphorothioate internucleoside linkage of a specific configuration is present in at least 90% of the molecules in the population. In certain embodiments, a specific phosphorothioate internucleoside linkage of a specific configuration is present in at least 99% of the molecules in the population. Such chiral enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, such as those described in Oka et al., JACS, 2003, 125, 8307; Wan et al., Nuc. Acid. Res., 2014, 42, 13456 and WO 2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioate comprise one or more of the following formulae, respectively, wherein "B" indicates a nucleobase:

[0220]

[0221] Unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or in a specific stereochemical configuration.

[0222] In certain embodiments, the modified oligonucleotide comprises the internucleoside motif (5' to 3')sooossssssssssssss. In certain embodiments, the specific stereochemistry of the modified oligonucleotide is (5' to 3')Sp-ooo-Sp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp or Sp-ooo-Sp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp; wherein each 'Sp' represents a phosphorothioate internucleoside linkage in the S configuration; Rp represents a phosphorothioate internucleoside linkage in the R configuration; and 'o' represents a phosphodiester internucleoside linkage.

[0223] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), methylal (3'-O-CH2-O-5'), methoxypropyl, and thiomethylal (3'-S-CH2-O-5'). Other neutral internucleoside linkages include nonionic linkages comprising siloxanes (dialkylsiloxanes), carboxylates, carboxamides, sulfides, sulfonates, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and P.D. Cook, eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Other neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S, and CH2 components.

[0224] In certain embodiments, the modified internucleoside linkage is any of those described in WO 2021 / 030778, which is incorporated herein by reference.

[0225] Certain motifs

[0226] In certain embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified core base. In certain embodiments, the modified oligonucleotide comprises one or more modified internucleoside linkages. In such embodiments, the modified, unmodified and differently modified sugar moieties, core bases and / or internucleoside linkages of the modified oligonucleotide define patterns or motifs. In certain embodiments, the patterns of sugar moieties, core bases and internucleoside linkages are each independent of one another. Therefore, modified oligonucleotides and are described by their sugar motifs, core base motifs and / or internucleoside linkage motifs (as used herein, core base motifs describe modifications to core bases that are unrelated to the sequence of the core base).

[0227] Certain sugar motifs

[0228] In certain embodiments, the oligonucleotide comprises one or more types of modified sugars and / or unmodified sugar moieties arranged in a defined pattern or sugar motif along the oligonucleotide or portion thereof. In some cases, such sugar motifs include, but are not limited to, any sugar modifications discussed herein.

[0229] In certain embodiments, modified oligonucleotide has a gapmer motif, which is limited by two external regions or " flanks " and a central or internal region or " gap ". The three districts (5 '-flanks, gaps and 3 '-flanks) of the gapmer motif form a continuous sequence of nucleosides, wherein at least some sugar moieties of the nucleosides of each flank are different from at least some sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moiety of the nucleosides closest to the gap in each flank (the most 3 ' end nucleosides of the 5 '-flanks and the most 5 ' end nucleosides of the 3 '-flanks) is different from the sugar moiety of the adjacent gap nucleosides, therefore limiting the boundary between the flank and the gap (that is, the flank / gap junction). In certain embodiments, the sugar moieties in the gap are identical to each other. In certain embodiments, the gap includes one or more nucleosides, and its sugar moiety is different from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two flanks are identical to each other (symmetrical gapmers). In certain embodiments, the 5'-flanking sugar motif is different from the 3'-flanking sugar motif (asymmetric spacer).

[0230] In certain embodiments, the flanks of a spacer comprise 1-6 nucleosides. In certain embodiments, each nucleoside of each flank of a spacer comprises a modified sugar moiety. In certain embodiments, at least one, at least two, at least three, at least four, at least five, or at least six nucleosides of each flank of a spacer comprise a modified sugar moiety.

[0231] In certain embodiments, the gap of a spacer comprises 7-12 nucleosides. In certain embodiments, each nucleoside in the gap of a spacer comprises a 2-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside in the gap of a spacer comprises a modified sugar moiety and each of the remaining nucleosides comprises a 2'-deoxyribosyl sugar moiety.

[0232] In this article, the length (number of nucleosides) of the three regions of the spacer can be provided using the notation [number of nucleosides in the 5'-flank]-[number of nucleosides in the gap]-[number of nucleosides in the 3'-flank]. Therefore, the 5-10-5 spacer is composed of the nucleosides of 5 connections in each flank and the nucleosides of 10 connections in the gap. In the case where this type of nomenclature is subsequently specifically modified, the modification is the modification in each sugar moiety of each flank and the gap nucleosides include 2'-deoxyribosyl sugar moieties. Therefore, the 5-10-5 MOE spacer is composed of the 2'-MOE nucleosides of 5 connections in the 5'-flank, the 2'-deoxyribonucleosides of 10 connections in the gap and the 2'-MOE nucleosides of 5 connections in the 3'-flank.

[0233] In certain embodiments, each nucleoside of the modified oligonucleotide or a portion thereof comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, a sugar surrogate or a 2'-deoxyribosyl sugar moiety. In certain embodiments, the 2'-substituted sugar moiety is selected from 2'-MOE sugar moiety, 2'-NMA sugar moiety, 2'-OMe sugar moiety and 2'-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from cEt sugar moiety and LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from morpholinyl, modified morpholinyl, PNA, THP and F-HNA.

[0234] In certain embodiments, the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 nucleosides comprising modified sugar moieties. In certain embodiments, the modified sugar moieties are independently selected from 2'-substituted sugar moieties, bicyclic sugar moieties or sugar surrogates. In certain embodiments, the 2'-substituted sugar moieties are selected from 2'-MOE sugar moieties, 2'-NMA sugar moieties, 2'-OMe sugar moieties and 2'-F sugar moieties. In certain embodiments, the bicyclic sugar moieties are selected from cEt sugar moieties and LNA sugar moieties. In certain embodiments, sugar surrogates are selected from morpholinyl, modified morpholinyl, THP and F-HNA.

[0235] In certain embodiments, each nucleoside of a modified oligonucleotide comprises a modified sugar moiety ("completely modified oligonucleotide"). In certain embodiments, each nucleoside of a completely modified oligonucleotide comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, and a 2'-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and a LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from a morpholino group, a modified morpholino group, THP, and F-HNA. In certain embodiments, each nucleoside of a completely modified oligonucleotide comprises an identical modified sugar moiety ("uniformly modified sugar motif"). In certain embodiments, the length of the uniformly modified sugar motif is 7 to 20 nucleosides. In certain embodiments, each nucleoside of a uniformly modified sugar motif comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2'-substituted sugar moiety is selected from the group consisting of 2'-MOE sugar moieties, 2'-NMA sugar moieties, 2'-OMe sugar moieties, and 2'-F sugar moieties. In certain embodiments, the bicyclic sugar moiety is selected from the group consisting of cEt sugar moieties and LNA sugar moieties. In certain embodiments, the sugar surrogate is selected from the group consisting of morpholinyl, modified morpholinyl, THP, and F-HNA. In certain embodiments, the modified oligonucleotide having at least one fully modified sugar motif may also comprise at least 1, at least 2, at least 3, or at least 4 2'-deoxyribonucleosides.

[0236] Certain nucleobase motifs

[0237] In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or portion thereof. In certain embodiments, each nucleobase is modified. In certain embodiments, no nucleobase is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all pyrimidine nucleobases in a modified oligonucleotide are 5-methylcytosine. In certain embodiments, all cytosine nucleobases are 5-methylcytosine, and all other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0238] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5' end of the oligonucleotide.

[0239] In certain embodiments, the oligonucleotide having a spacer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, a nucleoside comprising a modified nucleobase is in the central gap of the oligonucleotide having a spacer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from: 2-thiopyrimidine and 5-propyne pyrimidine.

[0240] Certain internucleoside linkage motifs

[0241] In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or portion thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each thiophosphate internucleoside linkage is independently selected from a stereo-random phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, the sugar motif of the modified oligonucleotide is a spacer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all internucleoside linkages in the flanks are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a spacer, and the internucleoside linkage motif includes at least one phosphodiester internucleoside linkage in at least one flank, wherein the at least one phosphodiester internucleoside linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are thiophosphate internucleoside linkages. In certain such embodiments, all thiophosphate internucleoside linkages are stereo-irregular. In certain embodiments, all thiophosphate internucleoside linkages in the flank are (Sp) thiophosphate, and the gap includes at least one Sp, Sp, Rp motif. In certain embodiments, the colony of the modified oligonucleotide is enriched with modified oligonucleotides comprising such internucleoside linkage motifs. In certain embodiments, one or more internucleoside linkages are methylsulfonylphosphoramidate internucleoside linkages. In certain embodiments, each internucleoside linkage is independently selected from phosphodiester internucleoside linkages, thiophosphate internucleoside linkages, and methylsulfonylphosphoramidate internucleoside linkages. In certain embodiments, each internucleoside linkage is independently selected from thiophosphate internucleoside linkage and methylsulfonylphosphoramidate internucleoside linkage.In certain embodiments, one or more internucleoside linkages are methoxypropylphosphonate internucleoside linkages.In certain embodiments, each internucleoside linkage is independently selected from phosphodiester internucleoside linkage, thiophosphate internucleoside linkage and methoxypropylphosphonate internucleoside linkage.In certain embodiments, each internucleoside linkage is independently selected from thiophosphate internucleoside linkage and methoxypropylphosphonate internucleoside linkage.

[0242] In certain embodiments, the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 phosphodiester internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, or at least 5 phosphodiester internucleoside linkages and the remaining internucleoside linkages are phosphorothioate internucleoside linkages.

[0243] Certain lengths

[0244] It is possible to increase or decrease the length of the oligonucleotide without eliminating activity. For example, at Woolf et al., Proc.Natl.Acad.Sci.USA, 1992, 89, 7305-7309, 1992), a series of oligonucleotides with a length of 13-25 core bases were tested for the ability of the target nucleic acid to be induced in the oocyte injection model. The oligonucleotides with a length of 25 core bases and 8 or 11 mismatched bases near the end of the oligonucleotide can guide the specific cutting of the target nucleic acid, but the degree is lower than the oligonucleotides without mismatching. Similarly, using oligonucleotides of 13 core bases, target-specific cutting is achieved including those oligonucleotides with 1 or 3 mismatches.

[0245] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any one of a variety of length ranges. In certain embodiments, oligonucleotides are composed of X to Y connected nucleosides, wherein X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 and 50; Condition is X≤Y. For example, in certain embodiments, the oligonucleotides range from 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27 8, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26,20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 2 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0246] In certain embodiments, the oligonucleotide consists of 16 nucleosides connected. In certain embodiments, the oligonucleotide consists of 17 nucleosides connected. In certain embodiments, the oligonucleotide consists of 18 nucleosides connected. In certain embodiments, the oligonucleotide consists of 19 nucleosides connected. In certain embodiments, the oligonucleotide consists of 20 nucleosides connected.

[0247] Certain modified oligonucleotides

[0248] In certain embodiments, the above-mentioned modifications (sugar, core base, internucleoside linkage) are incorporated into modified oligonucleotide.In certain embodiments, the characterised in that modified oligonucleotide is its modified motif and overall length.In certain embodiments, such parameters are independent of one another.Therefore, unless otherwise indicated, otherwise each internucleoside linkage of the oligonucleotide with spacer sugar motif can be modified or unmodified and can follow or may not follow the sugar-modified spacer modification pattern.For example, the internucleoside linkage in the flanking region of the sugar spacer can be identical or different from each other, and can be identical or different with the internucleoside linkage in the gap region of the sugar motif.Equally, such sugar spacer oligonucleotide can include one or more modified core bases unrelated to the sugar-modified spacer pattern.Unless otherwise indicated, all modifications are unrelated to the core base sequence.

[0249] Populations of certain modified oligonucleotides

[0250] The population of modified oligonucleotides (wherein all modified oligonucleotides of the population have the same molecular formula) can be a stereo-random population or a chiral-enriched population. All chiral centers of all modified oligonucleotides in the stereo-random population are stereo-random. In a chiral-enriched population, at least one specific chiral center in the modified oligonucleotides of the population is not stereo-random. In certain embodiments, the modified oligonucleotides of the chiral-enriched population are enriched in β-D ribosyl sugar moieties, and all thiophosphate internucleoside linkages are stereo-random. In certain embodiments, the modified oligonucleotides of the chiral-enriched population are enriched in β-D ribosyl sugar moieties and at least one specific thiophosphate internucleoside linkage in a specific stereochemical configuration.

[0251] Nucleobase sequence

[0252] In certain embodiments, oligonucleotides (unmodified or modified) are further described by a nucleobase sequence. In certain embodiments, the nucleobase sequence of an oligonucleotide is complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In certain such embodiments, the nucleobase sequence of a portion of an oligonucleotide is complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In certain embodiments, the nucleobase sequence of a portion or the entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a second oligonucleotide or nucleic acid (e.g., a target nucleic acid).

[0253] Certain oligomeric compounds

[0254] In certain embodiments, provided herein is an oligomeric compound, which is composed of an oligonucleotide (modified or unmodified) and optionally one or more conjugated groups and / or terminal groups. The conjugated group is composed of one or more conjugated moieties and a conjugated joint for connecting the conjugated moiety to the oligonucleotide. The conjugated group can be connected to either end or both ends and / or any internal position of the oligonucleotide. In certain embodiments, the conjugated group is connected to the 2' position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugated group connected to either end or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugated group or terminal group is connected to the 3' end and / or 5' end of the oligonucleotide. In certain such embodiments, the conjugated group (or terminal group) is connected to the 3' end of the oligonucleotide. In certain embodiments, the conjugated group is connected near the 3' end of the oligonucleotide. In certain embodiments, the conjugated group (or terminal group) is connected to the 5' end of the oligonucleotide. In certain embodiments, the conjugated group is connected near the 5' end of the oligonucleotide.

[0255] Examples of terminal groups include, but are not limited to, a conjugating group, a capping group, a phosphate moiety, a protecting group, an abasic nucleoside, a modified or unmodified nucleoside, and two or more independently modified or unmodified nucleosides.

[0256] Certain conjugated groups

[0257] In certain embodiments, the oligonucleotide is covalently linked to one or more conjugated groups. In certain embodiments, the conjugated group modifies one or more properties of the oligonucleotide to be connected, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, the conjugated group imparts new properties to the oligonucleotide to be connected, for example, a fluorophore or reporter group capable of detecting the oligonucleotide.Certain conjugated groups and conjugated moieties have been previously described, for example: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556); cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060); thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NYA cad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770); thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538); aliphatic chains, such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54); phospholipids, such as di-hexadecyl-rac-glycerol or 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonic acid triethyl-ammonium (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783); a polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973) or an adamantaneacetic acid palmitoyl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237); an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937); a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740) or a GalNAc cluster (e.g., WO 2014 / 179620).

[0258] Conjugated moiety

[0259] Conjugate moieties include, but are not limited to, intercalators, reporters, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, bile acid moieties, folate, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0260] In certain embodiments, the conjugate moiety comprises an active drug substance, e.g., aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepam, indomethicin, a barbiturate, cephalosporin, sulfonamide, antidiabetic, antibacterial, or antibiotic.

[0261] Conjugation linker

[0262] The conjugated moiety is connected to the oligonucleotide via a conjugated joint. In some oligomeric compounds, the conjugated joint is a single chemical bond (i.e., the conjugated moiety is directly connected to the oligonucleotide via a single bond). In some oligomeric compounds, the conjugated moiety is connected to the oligonucleotide via a more complex conjugated joint comprising one or more conjugated joint moieties, and the one or more conjugated joint moieties are the subunits constituting the conjugated joint. In certain embodiments, the conjugated joint comprises an oligomer of a chain structure (e.g., a hydrocarbon chain) or a repeating unit (e.g., ethylene glycol, nucleosides, or amino acid units).

[0263] In certain embodiments, the conjugate linker comprises one or more groups selected from the group consisting of alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In certain such embodiments, the conjugate linker comprises a group selected from the group consisting of alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from the group consisting of alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from the group consisting of alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate moiety. In certain embodiments, the conjugate linker includes at least one neutral linking group.

[0264] In certain embodiments, conjugated linkers, including conjugated linkers described above, are bifunctional linking moieties, such as those known in the art that can be used to connect conjugated groups to parent compounds, such as oligonucleotides provided herein. In general, bifunctional linking moieties comprise at least two functional groups. A functional group is selected to bind to a specific site on the parent compound, and another functional group is selected to bind to the conjugated group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophilic agents for reacting with nucleophilic groups and nucleophilic agents for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from: amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0265] Examples of conjugated linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxooctanoic acid (ADO), 4-(N-maleimidomethyl)cyclohexane-1-carboxylic acid succinimidyl ester (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugated linkers include, but are not limited to, substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl or substituted or unsubstituted C2-C 10 Alkynyl, where a non-limiting list of preferred substituents includes hydroxy, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halo, alkyl, aryl, alkenyl, and alkynyl.

[0266] In certain embodiments, the conjugate linker comprises 1-10 linker-nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker-nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker-nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, the linker-nucleoside is unmodified. In certain embodiments, the linker-nucleoside comprises an optionally protected heterocyclic base selected from the group consisting of a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from the group consisting of uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is usually desirable to make it cut from the oligomeric compound after the oligomeric compound arrives at the target tissue.Therefore, the linker-nucleoside is usually connected to each other and to the remainder of the oligomeric compound by a cleavable bond.In certain embodiments, this type of cleavable bond is a phosphodiester bond.

[0267] In this article, joint-nucleoside is not considered as a part of oligonucleotide. Therefore, in the embodiment that oligomeric compound comprises the nucleoside composition of the connection of specified number or scope and / or has the oligonucleotide of specified complementarity percentage with reference nucleic acid and / or oligomeric compound also comprises the conjugated group of the conjugated joint including the conjugated joint with joint-nucleoside, those joint-nucleoside are not counted in the length of oligonucleotide and are not used to determine the complementarity percentage of oligonucleotide for reference nucleic acid. For example, oligomeric compound can comprise (1) the modified oligonucleotide consisting of 8-30 nucleosides and (2) the conjugated group of joint-nucleoside comprising 1-10 continuous nucleosides with the nucleosides of modified oligonucleotide. The total number of continuous connection nucleosides in such oligomeric compound is more than 30. Alternatively, oligomeric compound can comprise the modified oligonucleotide consisting of 8-30 nucleosides and without conjugated group. The total number of continuous connection nucleosides in such oligomeric compound is no more than 30. Unless otherwise indicated, conjugated joint comprises no more than 10 joint-nucleosides. In certain embodiments, the conjugated linker comprises no more than 5 linkers-nucleosides. In certain embodiments, the conjugated linker comprises no more than 3 linkers-nucleosides. In certain embodiments, the conjugated linker comprises no more than 2 linkers-nucleosides. In certain embodiments, the conjugated linker comprises no more than 1 linker-nucleoside.

[0268] In certain embodiments, it is desirable to cut the conjugated group from the oligonucleotide. For example, in some cases, an oligomeric compound comprising a specific conjugated portion may be better taken up by a specific cell type, but once the oligomeric compound is taken up, it is desirable to cut the conjugated group to release the unconjugated or parent oligonucleotide. Therefore, some conjugated linkers may comprise one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, the cleavable moiety comprises a group of atoms having one, two, three, four or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved in a cell or subcellular compartment such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.

[0269] In certain embodiments, the cleavable bond is selected from the group consisting of: an amide, an ester, an ether, one or two esters of a phosphodiester, a phosphate, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or two esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugated moiety or conjugated group.

[0270] In certain embodiments, the cleavable portion comprises or consists of one or more joints-nucleosides. In certain such embodiments, the one or more joints-nucleosides are connected to each other and / or to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable portion is a 2'-deoxyribonucleoside, which is linked to the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate internucleoside linkage and is covalently linked to the remainder of the conjugated joint or conjugated portion by a phosphate or thiophosphate internucleoside linkage. In certain such embodiments, the cleavable portion is a 2'-deoxyadenosine.

[0271] Certain terminal groups

[0272] In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include but are not limited to 5'-phosphonates, including but not limited to 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or reverse nucleosides. In certain embodiments, the terminal group comprises one or more 2'-connected nucleosides. In certain such embodiments, the 2'-connected nucleosides are abasic nucleosides.

[0273] Oligoduplex

[0274] In certain embodiments, the oligomeric compound described herein comprises an oligonucleotide whose core base sequence is complementary to the sequence of the target nucleic acid. In certain embodiments, the oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes include a first oligomeric compound that is complementary to the target nucleic acid and a second oligomeric compound that is complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises the following or consists of the following: (1) a modified or unmodified oligonucleotide and optionally a conjugated group and (2) a second modified or unmodified oligonucleotide and optionally a conjugated group. Any one or two oligomeric compounds of the oligomeric duplex may include a conjugated group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may include non-complementary overhanging nucleosides.

[0275] Antisense activity

[0276] In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing with target nucleic acids to produce at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, an antisense compound has antisense activity when it reduces, regulates, or increases the amount or activity of a target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, an antisense compound selectively affects one or more target nucleic acids. Such antisense compounds comprise the following nucleobase sequence, which hybridizes with one or more target nucleic acids, produces one or more desired antisense activities, and does not hybridize with one or more non-target nucleic acids, or does not hybridize with one or more non-target nucleic acids in a manner that produces significant non-desired antisense activity.

[0277] In certain antisense activities, hybridization of the antisense compound to the target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, provided herein are antisense compounds that are sufficiently "DNA-like" to trigger RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap between the spacers are tolerated.

[0278] In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately leading to target nucleic acid cleavage. For example, certain antisense compounds cause target nucleic acid cleavage via Argonaute. The antisense compound loaded into RISC is an RNAi compound. The RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).

[0279] In certain embodiments, the hybridization of antisense compounds and target nucleic acids does not result in the recruitment of proteins that cut the target nucleic acid. In certain embodiments, the hybridization of antisense compounds and target nucleic acids results in a change in the splicing of the target nucleic acid. In certain embodiments, the hybridization of antisense compounds and target nucleic acids results in the inhibition of the binding interactions between the target nucleic acid and a protein or other nucleic acids. In certain embodiments, the hybridization of antisense compounds and target nucleic acids results in a change in the translation of the target nucleic acid. In certain embodiments, the hybridization of antisense compounds and target nucleic acids results in exon inclusion. In certain embodiments, the hybridization of antisense compounds and target nucleic acids results in an increase in the amount or activity of the target nucleic acid. In certain embodiments, the hybridization of antisense compounds complementary to the target nucleic acid results in a change in splicing, thereby resulting in the inclusion of exons in mRNA.

[0280] Antisense activity can be observed directly or indirectly. In certain embodiments, observing or detecting antisense activity involves observing or detecting a change in the amount of a target nucleic acid or a protein encoded by the target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a phenotypic change in a cell or subject.

[0281] Certain target nucleic acids

[0282] In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from the group consisting of mature mRNA and pre-mRNA, including introns, exons, and untranslated regions. In certain embodiments, the target nucleic acid is mature mRNA. In certain embodiments, the target nucleic acid is pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, at least 50% of the target region is within an intron.

[0283] Complementary / mismatched with target nucleic acid

[0284] It is possible to introduce mismatches without eliminating activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93: 463-471, March 2001) demonstrated the ability of an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA to reduce the expression of bcl-2 and bcl-xL in vivo and in vitro. In addition, this oligonucleotide showed effective anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16: 3341-3358, 1988) tested a series of 14-nucleobase oligonucleotides in series and 28- and 42-nucleobase oligonucleotides containing sequences of two or three tandem oligonucleotides for their ability to inhibit translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14-nucleobase oligonucleotides was individually able to inhibit translation, but at a more modest level compared to the 28- or 42-nucleobase oligonucleotides.

[0285] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85% or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and a portion is 100% or fully complementary to the target nucleic acid. In certain embodiments, the length of the fully complementary portion is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 core bases.

[0286] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases relative to the target nucleic acid.In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 from the 5' end of the oligonucleotide.

[0287] SMN2

[0288] In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide that is complementary to a target nucleic acid encoding SMN2 or a portion thereof. In certain embodiments, SMN2 has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated from nucleotides 19939708 to 19967777).

[0289] In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 modulates splicing of SMN2 RNA in the cell. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 increases the amount of SMN2 RNA comprising exon 7. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 increases expression of full-length SMN2 protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide.

[0290] In certain embodiments, contacting a cell of a subject with an oligomeric compound complementary to SEQ ID NO: 1 ameliorates one or more symptoms of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is SMA, including type I SMA, type II SMA, type III SMA, and type IV SMA. In certain embodiments, the symptom is any one of: decreased muscle strength; inability or decreased ability to sit upright, stand, and / or walk; decreased neuromuscular activity; decreased electrical activity in one or more muscles; decreased respiration; inability or decreased ability to eat, drink, and / or breathe without assistance; weight loss or decreased weight gain; and / or decreased survival.

[0291] In certain embodiments, oligomeric compounds complementary to SEQ ID NO: 1 are capable of increasing SMN2 RNA, including exon 7, by at least 1-fold, 2-fold, or 3-fold in vivo when administered according to a standard in vivo assay. In certain embodiments, oligomeric compounds complementary to SEQ ID NO: 1 are capable of increasing full-length SMN2 protein by at least 1-fold, 2-fold, or 3-fold in vivo when administered according to a standard in vivo assay.

[0292] Certain target nucleic acids in certain tissues

[0293] In certain embodiments, the oligomeric compound comprises or consists of a portion of oligonucleotides complementary to the target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is the cell and tissue constituting the central nervous system (CNS). Such tissues include brain tissue, such as spinal cord, cortex, and coronary brain tissue.

[0294] Certain pharmaceutical compositions

[0295] In certain embodiments, pharmaceutical compositions comprising one or more oligomeric compounds are described herein. In certain embodiments, each of the one or more oligomeric compounds is composed of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more oligomeric compounds or consists of it. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and sterile water or consists of it. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and phosphate buffered saline (PBS) or consists of it. In certain embodiments, sterile PBS is pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and artificial cerebral spinal fluid ("artificial CSF" or "aCSF") or consists of it. In certain embodiments, artificial cerebral spinal fluid is pharmaceutical grade.

[0296] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebral spinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and artificial cerebral spinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebral spinal fluid. In certain embodiments, the artificial cerebral spinal fluid is pharmaceutical grade.

[0297] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In certain embodiments, the excipient is selected from water, saline solution, ethanol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose and polyvinyl pyrrolidone.

[0298] In certain embodiments, the oligomeric compound can be mixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. The composition and method of formulation of the pharmaceutical composition depends on many criteria, including but not limited to the route of administration, the extent of the disease or the dose to be administered.

[0299] In certain embodiments, the pharmaceutical composition comprising an oligomeric compound encompasses any pharmaceutically acceptable salt of an oligomeric compound, an ester of an oligomeric compound, or a salt of such an ester. In certain embodiments, the pharmaceutical composition comprising an oligomeric compound comprising one or more oligonucleotides, when administered to a subject (including the human race), can provide (directly or indirectly) a bioactive metabolite or its residue. Therefore, for example, the disclosure also relates to pharmaceutically acceptable salts, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents of oligomeric compounds. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium salts and potassium salts. In certain embodiments, a prodrug comprises one or more conjugated groups connected to an oligonucleotide, wherein the conjugated groups are cut in vivo by endogenous nucleases. In certain embodiments, a prodrug comprises one or more conjugated groups connected to an oligonucleotide, wherein the conjugated groups are cut in vivo by endogenous nucleases.

[0300] In a variety of methods, lipid moieties have been used in nucleic acid therapy. In some such methods, nucleic acids (e.g., oligomeric compounds) are introduced into preformed liposomes or lipid complexes (lipoplexes) made from a mixture of cationic lipids and neutral lipids. In some methods, a DNA complex with a single cationic lipid or a polycationic lipid is formed in the absence of a neutral lipid. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to muscle tissue.

[0301] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems can be used to prepare certain pharmaceutical compositions, including pharmaceutical compositions comprising hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0302] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents comprising the oligomeric compounds provided herein to specific tissues or cell types. For example, in certain embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0303] In certain embodiments, the pharmaceutical composition comprises a co-solvent system. Some of such co-solvent systems comprise, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which comprises 3% w / v benzyl alcohol, 8% w / v of the non-polar surfactant polysorbate 80, and 1% w / v of the non-polar surfactant polysorbate 80. TM and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such cosolvent systems can be varied significantly without significantly changing their solubility and toxicity characteristics. In addition, the identity of the cosolvent components can be varied: for example, other surfactants can be used instead of polysorbate 80. TM The fraction size of polyethylene glycol can be varied; other biocompatible polymers can be substituted for polyethylene glycol, for example, polyvinyl pyrrolidone; and other sugars or polysaccharides can be substituted for dextrose.

[0304] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, and the aqueous solution is, for example, water or a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or a physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that help dissolve or act as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Some pharmaceutical compositions for injection are present in, for example, ampoules or multidose containers in unit dosage form. Some pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain preparatons, such as suspending agents, stabilizers, and / or dispersants. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil; synthetic fatty acid esters, such as ethyl oleate or triglycerides; and liposomes.

[0305] Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds can be drawn or described in a protonated (free acid) form or in an ionized and cation-associated (salt) form, aqueous solutions of such compounds exist in equilibrium in such forms. For example, the phosphate linkages of oligonucleotides in aqueous solution exist in equilibrium in the form of free acid, anion, and salt. Unless otherwise noted, the compounds described herein are intended to include all such forms. In addition, some oligonucleotides have several such linkages, each of which is balanced. Therefore, the oligonucleotides in solution exist in a series of forms at multiple locations, all in equilibrium. The term "oligonucleotide" is intended to include all such forms. The drawn structure must depict a single form. However, unless otherwise noted, such drawings are also intended to include corresponding forms. In this article, the structure depicting the free acid of a compound followed by the term "or its salt" explicitly includes all such forms that may be fully or partially protonated / deprotonated / associated with a cation. In some cases, one or more specific cations are identified.

[0306] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to reach the desired pH.

[0307] In this article, some specific doses are described. Dosage can be in dosage unit form. For the sake of clarity, the dosage (or dosage unit) (mg) of modified oligonucleotide or oligomeric compound indicates the mass of the modified oligonucleotide or oligomeric compound in free acid form. As described above, in aqueous solution, free acid is balanced with anion and salt form. However, for the purpose of calculating dosage, it is assumed that modified oligonucleotide or oligomeric compound exist in solvent-free, sodium acetate-free, anhydrous, free acid form. For example, in the case of modified oligonucleotide or oligomeric compound in a solution (such as saline) comprising sodium, modified oligonucleotide or oligomeric compound can be partially or completely deprotonated and associated with Na+ ions. However, the mass of protons is still included in the weight of dosage, and the mass of Na+ ions is not included in the weight of dosage. Thus, for example, a 10 mg dose or dosage unit of Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 is equivalent to the number of fully protonated molecules weighing 10 mg. This is equivalent to: 10.53 mg of solvent-free, sodium acetate-free, anhydrous sodium-ionized Compound No. 1263789; 10.53 mg of solvent-free, sodium acetate-free, anhydrous sodium-ionized Compound No. 1287717; 10.52 mg of solvent-free, sodium acetate-free, anhydrous sodium-ionized Compound No. 1287745; and 10.51 mg of solvent-free, sodium acetate-free, anhydrous sodium-ionized Compound No. 1358996. When an oligomeric compound contains a conjugated group, the mass of the conjugated group is included in calculating the dose of such oligomeric compound. If the conjugated group also has an acid, the conjugated group is also assumed to be fully protonated for the purposes of calculating the dose.

[0308] Certain compositions

[0309] Compound number: 1263789

[0310] In certain embodiments, compound No. 1263789 is characterized as a modified oligonucleotide having the sequence (5' to 3')CACTTTCATAATGCTGGC (SEQ ID NO: 21), wherein each nucleoside comprises a 2'-MOE sugar moiety, wherein the internucleoside linkages between nucleosides 2 to 3 and 4 to 5 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, and 17 to 18 are phosphorothioate internucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0311] In certain embodiments, Compound No. 1263789 is represented by the following chemical notation (5' to 3'): m C es A eo m C es T eo T es T es m C es A es T es A es A es T es G es m C es T es G es G es m C e (SEQ ID NO: 21),

[0312] in,

[0313] A = adenine nucleobase,

[0314] m C=5-methylcytosine nucleobase,

[0315] G = guanine nucleobase,

[0316] T = thymine nucleobase,

[0317] e=2'-MOE sugar moiety,

[0318] s = phosphorothioate internucleoside linkage, and

[0319] o = phosphodiester internucleoside linkage.

[0320] In certain embodiments, Compound No. 1263789 is represented by the following chemical structure:

[0321]

[0322] (SEQ ID NO: 21).

[0323] Structure 1. Compound No. 1263789

[0324] In certain embodiments, the sodium salt of Compound No. 1263789 is represented by the following chemical structure:

[0325]

[0326] (SEQ ID NO: 21).

[0327] Structure 2. Sodium salt of compound number 1263789

[0328] Compound number: 1287717

[0329] In certain embodiments, compound No. 1287717 is characterized as a modified oligonucleotide having the sequence (5' to 3')TTCACTTTCATAATGCTGGC (SEQ ID NO: 22), wherein each nucleoside comprises a 2'-MOE sugar moiety, wherein the internucleoside linkages between nucleosides 1 to 2 and 19 to 20 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, and 18 to 19 are phosphorothioate internucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0330] In certain embodiments, Compound No. 1287717 is represented by the following chemical notation (5' to 3'):

[0331] T eo T es m C es A es m C es T es T es T es m C es A es T es A es A es T es G es m C es T es G es G eo m C e (SEQ ID NO:22)

[0332] in,

[0333] A = adenine nucleobase,

[0334] m C=5-methylcytosine nucleobase,

[0335] G = guanine nucleobase,

[0336] T = thymine nucleobase,

[0337] e=2'-MOE sugar moiety,

[0338] s = phosphorothioate internucleoside linkage, and

[0339] o = phosphodiester internucleoside linkage.

[0340] In certain embodiments, Compound No. 1287717 is represented by the following chemical structure:

[0341]

[0342] (SEQ ID NO: 22).

[0343] Structure 3. Compound No. 1287717

[0344] In certain embodiments, the sodium salt of Compound No. 1287717 is represented by the following chemical structure:

[0345]

[0346] (SEQ ID NO: 22).

[0347] Structure 4. Sodium salt of compound number 1287717

[0348] Compound number: 1287745

[0349] In certain embodiments, compound No. 1287745 is characterized as a modified oligonucleotide having the sequence (5' to 3')TTCACTTTCATAATGCTGGC (SEQ ID NO: 22), wherein each of nucleosides 1 and 20 comprises a 2'-MOE sugar moiety, each of nucleosides 2-19 comprises a 2'-NMA sugar moiety, wherein the internucleoside linkages between nucleosides 1 to 2 and 19 to 20 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, and 18 to 19 are phosphorothioate internucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0350] In certain embodiments, Compound No. 1287745 is represented by the following chemical notation (5' to 3'):

[0351] T eo T ns m Cns A ns m C ns T ns T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G no m C e (SEQ ID NO:22)

[0352] in,

[0353] A = adenine nucleobase,

[0354] m C=5-methylcytosine nucleobase,

[0355] G = guanine nucleobase,

[0356] T = thymine nucleobase,

[0357] e=2'-MOE sugar moiety,

[0358] n=2'-NMA sugar moiety,

[0359] s = phosphorothioate internucleoside linkage, and

[0360] o = phosphodiester internucleoside linkage.

[0361] In certain embodiments, Compound No. 1287745 is represented by the following chemical structure:

[0362]

[0363] (SEQ ID NO: 22).

[0364] Structure 5. Compound No. 1287745

[0365] In certain embodiments, the sodium salt of Compound No. 1287745 is represented by the following chemical structure:

[0366]

[0367] (SEQ ID NO: 22).

[0368] Structure 6. Sodium salt of compound number 1287745

[0369] Compound number: 1358996

[0370] In certain embodiments, compound No. 1358996 is characterized as a modified oligonucleotide having the sequence (5' to 3')CACTTTCATAATGCTGGC (SEQ ID NO: 21), wherein each nucleoside comprises a 2'-NMA sugar moiety, wherein the internucleoside linkages between nucleosides 2 to 3 and 4 to 5 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, and 17 to 18 are phosphorothioate internucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0371] In certain embodiments, Compound No. 1358996 is represented by the following chemical notation (5' to 3'):

[0372] m C ns A no m C ns T no T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G ns m C n (SEQ ID NO: 21)

[0373] in,

[0374] A = adenine nucleobase,

[0375] m C=5-methylcytosine nucleobase,

[0376] G = guanine nucleobase,

[0377] T = thymine nucleobase,

[0378] n=2'-NMA sugar moiety,

[0379] s = phosphorothioate internucleoside linkage, and

[0380] o = phosphodiester internucleoside linkage.

[0381] In certain embodiments, Compound No. 1358996 is represented by the following chemical structure:

[0382]

[0383] (SEQ ID NO: 21).

[0384] Structure 7. Compound No. 1358996

[0385] In certain embodiments, the sodium salt of Compound No. 1358996 is represented by the following chemical structure:

[0386]

[0387] (SEQ ID NO: 21).

[0388] Structure 8. Sodium salt of compound number 1358996

[0389] Certain comparative compositions

[0390] In certain embodiments, an approved drug for the treatment of SMA (generic name nusinersen; compound number 396443) is a comparative compound (see, for example, Chiroboga et al., Neurology, 86(10):890-897, 2016; Finkel et al., Lancet, 338(10063):3017-3026, 2016; Finkel et al., N. Engl. J. Med., 377(18):1723-17322017; Mercuri et al., N. Engl. J. Med., 378(7):625-635, 2018; Montes et al., Muscle Nerve. 60(4):409-414, 2019; Darras et al., Neurology, 92(21):e2492-e2506, 2019). Previously described in WO2010120820 (which is incorporated herein by reference) and has the sequence (5' to 3')TCACTTTCATAATGCTGG (SEQ ID NO: 23), wherein each nucleoside comprises a 2'-MOE sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is 5-methylcytosine.

[0391] In certain embodiments, other previously described compounds, including Compound Nos. 387954, 396442, 443305, and 819735, are comparative compounds, although not approved for use in human therapy.

[0392] Compound No. 387954 was previously described in WO 2014 / 179620, which is incorporated herein by reference. Compound No. 387954 has the sequence (5' to 3') ATTCACTTTCATAATGCTGG (SEQ ID NO: 20), wherein each nucleoside comprises a 2'-MOE sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is 5-methylcytosine.

[0393] Compound No. 396442 was previously described in WO 2010 / 120820, which is incorporated herein by reference. Compound No. 396442 has the sequence (5' to 3') CACTTTCATAATGCTGGC (SEQ ID NO: 21), wherein each nucleoside comprises a 2'-MOE sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is 5-methylcytosine.

[0394] Compound No. 443305 was previously described in WO 2018 / 014041, which is incorporated herein by reference. Compound No. 443305 has the sequence (5' to 3') TCACTTTCATAATGCTGG (SEQ ID NO: 23), wherein each nucleoside comprises a 2'-NMA sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is a 5-methylcytosine.

[0395] Compound No. 819735 was previously described in WO 2018 / 014041, which is incorporated herein by reference. Compound No. 819735 has the sequence (5' to 3') CACTTTCATAATGCTGGC (SEQ ID NO: 21), wherein each nucleoside comprises a 2'-NMA sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is a 5-methylcytosine.

[0396] Table 1 Certain comparative compositions

[0397]

[0398] In certain embodiments, the compounds described herein are superior to the compounds described in WO 2007 / 002390, WO 2010 / 120820, WO 2015 / 161170, and WO 2018 / 014041 in that they exhibit one or more improved properties, such as potency, efficacy, and tolerability.

[0399] For example, Compound No. 1263789, Compound No. 1287745, and Compound No. 1358996 each exhibited improved in vivo efficacy compared to Compound No. 396443. As shown in Example 5, Compound No. 1263789, Compound No. 1287745, and Compound No. 1358996 achieved ED values ​​of 13.3, 8.8, and 7.4 in the spinal cord, respectively. 50 In contrast, compound number 396443 achieved an ED of 22.0 in the spinal cord. 50 Thus, each of Compound No. 1263789, Compound No. 1287745, and Compound No. 1358996 were more potent than Compound No. 396443 in this assay.

[0400] For example, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 each exhibited improved 3-hour FOB scores compared to Compound No. 396443, Compound No. 387954, and Compound No. 443305. As shown in Example 6, at 700 μg, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 achieved 3-hour FOB scores of 0, 3.25, 1, and 0, respectively. In contrast, at half the dose (350 μg), Compound No. 396443 achieved a 3-hour FOB score of 4.0; and at the same dose (700 μg), Compound No. 387954 and Compound No. 443305 achieved 3-hour FOB scores of 4.0 and 4.75, respectively. Thus, each of Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 was better tolerated than Compound No. 396443, Compound No. 387954, and Compound No. 443305 in this assay.

[0401] For example, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 each exhibited improved long-term tolerability compared to Compound No. 396442 and Compound No. 819735. As shown in Example 7, Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 showed no adverse effects, no Purkinje cell loss, and cortical GFAP mRNA levels less than 2-fold those of the control. In contrast, 396442 and 819735 each exhibited adverse events, Purkinje cell loss, and cortical GFAP mRNA levels greater than 2-fold those of the control in some treated animals. Thus, each of Compound No. 1263789, Compound No. 1287717, Compound No. 1287745, and Compound No. 1358996 was better tolerated than Compound No. 396442 and Compound No. 819735 in this assay.

[0402] Non-Limiting Disclosure and Incorporation by Reference

[0403] The documents and patent disclosures listed herein are each incorporated herein by reference in their entirety. Although certain compounds, compositions, and methods described herein have been particularly described according to certain embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to limit them. Each of the references, GenBank accession numbers, etc. cited in this application is incorporated herein by reference in their entirety.

[0404] Although the sequence listing accompanying this application identifies each sequence as "RNA" or "DNA" as needed, in fact, those sequences can be modified with any combination of chemical modifications. It will be readily understood by those skilled in the art that the nomenclature of such modified oligonucleotides, such as "RNA" or "DNA," is arbitrary in some cases. For example, an oligonucleotide comprising a nucleoside comprising a 2'-OH sugar moiety and a thymine base can be described as a DNA having a modified sugar moiety (2'-OH replacing one 2'-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) replacing uracil of RNA). Therefore, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compound having such a nucleobase sequence, whether modified or unmodified, including but not limited to: such compounds comprising RNA bases, such as a sequence having the sequence "AUCGAUCG"; and those having some DNA bases and some RNA bases, such as "AUCGATCG"; and oligomeric compounds having other modified nucleobases, such as "ATCGATCG". m CGAUCG", where m C represents a cytosine base containing a methyl group at the 5-position.

[0405] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers and thus produce enantiomers, diastereomers, and other stereoisomeric configurations, which can be defined in terms of absolute stereochemistry as (R) or (S), α or β (e.g., for sugar mutarotomers), or (D) or (L) (e.g., for amino acids), etc. Compounds drawn or described herein as having certain stereoisomeric configurations include only the indicated compounds. Unless otherwise indicated, compounds drawn or described herein as having indefinite stereochemistry include all such possible isomers, including their stereo-random and optically pure forms. Similarly, unless otherwise indicated, all cis and trans isomers and tautomeric forms of the compounds herein are also included. Oligomeric compounds described herein include chirally pure or chirally enriched mixtures and racemic mixtures. For example, oligomeric compounds having multiple thiophosphate internucleoside linkages include compounds in which the chirality of the thiophosphate internucleoside linkages is controlled or random. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.

[0406] The compounds described herein include variations in which one or more atoms are replaced by non-radioactive isotopes or radioactive isotopes of the indicated element. For example, a compound herein containing a hydrogen atom encompasses each 1 All possible deuterium substitutions of H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include, but are not limited to: 2 H or 3 H instead 1 H; 13 C or 14 C instead 12 C; 15 N instead 14 N; 17 O or 18 O instead 16 O; and 33 S. 34 S. 35 S or 36 S instead 32 In certain embodiments, non-radioactive isotope substitutions can confer novel properties on oligomeric compounds that are useful as therapeutic or research tools. In certain embodiments, radioactive isotope substitutions can render the compounds suitable for research or diagnostic purposes, such as imaging.

[0407] Example

[0408] The following examples illustrate certain embodiments of the present disclosure but are not limiting. Additionally, where specific embodiments are provided, the inventors contemplate the universal application of those specific embodiments.

[0409] Example 1: Design of modified oligonucleotides complementary to human SMN2 nucleic acid

[0410] Modified oligonucleotides complementary to human SMN2 nucleic acid were designed and synthesized as indicated in the table below.

[0411] The length of the modified oligonucleotides in the following table is 16, 17, 18, 19 or 20 nucleosides, as specified. The modified oligonucleotides contain 2'-MOE sugar moieties, 2'-NMA sugar moieties, cEt sugar moieties, 2'-OMe sugar moieties and / or 2'-β-D-deoxyribosyl sugar moieties, as specified. Each internucleoside linkage of the entire modified oligonucleotide is a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage, as specified. Cytosine is either unmethylated cytosine or 5-methylcytosine, as specified.

[0412] Unless otherwise specified, each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated from nucleotides 19939708 to 19967777). Non-complementary nucleobases are indicated in the nucleobase sequence column as Underline, bold, italic fonts Each modified oligonucleotide listed in the table below targets the active site of the SMN2 transcript to include exon 7. "Start Site" indicates the 5'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. "Stop Site" indicates the 3'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0413] Table 2

[0414] The length of the modified oligonucleotides in Table 2 below is 16, 17, 18, 19 or 20 nucleosides. Each nucleoside comprises a 2'-MOE sugar moiety. The sugar motif of each modified oligonucleotide is provided in the sugar motif column, wherein each 'e' represents a 2'-MOE sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is provided in the internucleoside linkage motif column, wherein each 's' represents a phosphorothioate internucleoside linkage, and each 'o' represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine.

[0415] Unless otherwise specified, each modified oligonucleotide listed in Table 2 below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated from nucleotides 19939708 to 19967777). Non-complementary nucleobases are indicated in the nucleobase sequence column as Underline, bold, italic fonts The "start site" indicates the 5'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. The "stop site" indicates the 3'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0416] Table 2 2'-MOE modified oligonucleotides with PS or mixed PS / PO internucleoside linkages

[0417]

[0418]

[0419]

[0420]

[0421]

[0422]

[0423]

[0424]

[0425]

[0426] Table 3

[0427] The length of the modified oligonucleotides in Table 3 below is 16, 17, 18, 19 or 20 nucleosides. Each nucleoside comprises a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is provided in the Sugar Motif column, wherein each 'n' represents a 2'-NMA sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is provided in the Internucleoside Linkage Motif column, wherein each 's' represents a phosphorothioate internucleoside linkage and each 'o' represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine.

[0428] Each modified oligonucleotide listed in Table 3 below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated from nucleosides 19939708 to 19967777). "Start Site" indicates the 5'-nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. "Stop Site" indicates the 3'-nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0429] Table 3 2'-NMA modified oligonucleotides with PS or mixed PS / PO internucleoside linkages

[0430]

[0431]

[0432]

[0433] Table 4

[0434] The modified oligonucleotides in Table 4 below are 18 or 19 nucleosides in length. Each nucleoside comprises a 2'-MOE sugar moiety or a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is provided in the Sugar Motif column, wherein each 'e' represents a 2'-MOE sugar moiety and each 'n' represents a 2'-NMA sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is provided in the Internucleoside Linkage Motif column, wherein each 's' represents a phosphorothioate internucleoside linkage. Each cytosine is 5-methylcytosine.

[0435] Unless otherwise specified, each modified oligonucleotide listed in Table 4 below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated from nucleotides 19939708 to 19967777). Non-complementary nucleobases are indicated in the nucleobase sequence column as Underline, bold, italic fonts The "start site" indicates the 5'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. The "stop site" indicates the 3'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0436] Table 4 Mixed 2'-MOE / 2'-NMA modified oligonucleotides with PS internucleoside linkages

[0437]

[0438] Table 5

[0439] The length of the modified oligonucleotides in Table 5 below is 16, 17, or 18 nucleosides. Each nucleoside comprises a 2'-MOE sugar moiety or a cEt sugar moiety. The sugar motif of each modified oligonucleotide is provided in the Sugar Motif column, wherein each 'e' represents a 2'-MOE sugar moiety and each 'k' represents a cEt sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is provided in the Internucleoside Linkage Motif column, wherein each 's' represents a phosphorothioate internucleoside linkage. Each cytosine is 5-methylcytosine.

[0440] Each modified oligonucleotide listed in Table 5 below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated from nucleosides 19939708 to 19967777). "Start Site" indicates the 5'-nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. "Stop Site" indicates the 3'-nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0441] Table 5 Mixed 2'-MOE / cEt modified oligonucleotides with PS internucleoside linkages

[0442]

[0443]

[0444]

[0445] Table 6

[0446] The modified oligonucleotides in Table 6 below are 19 or 20 nucleosides in length. Each nucleoside comprises a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, or a 2'-β-D-deoxyribosyl sugar moiety. The sugar motif of each modified oligonucleotide is provided in the Sugar Motif column, where each 'e' represents a 2'-MOE sugar moiety, each 'n' represents a 2'-NMA sugar moiety, each 'y' represents a 2'-OMe sugar moiety, and each 'd' represents a 2'-β-D-deoxyribosyl sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide provided in the Internucleoside Linkage Motif column is (5' to 3'): ssssssssssssssssso; wherein each 's' represents a phosphorothioate internucleoside linkage, and each 'o' represents a phosphodiester internucleoside linkage. Cytosine is either unmethylated cytosine or 5-methylcytosine, wherein each lowercase letter 'c' in the Nucleobase Sequence column represents an unmethylated cytosine, and each uppercase letter 'C' in the Nucleobase Sequence column represents a 5-methylcytosine.

[0447] Unless otherwise specifically stated, each nucleobase in the modified oligonucleotides listed in Table 6 below is complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated from nucleosides 19939708 to 19967777). Non-complementary nucleobases are indicated in the nucleobase sequence column with Underline, bold, italic fonts The "start site" indicates the 5'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. The "stop site" indicates the 3'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0448] Table 6 Modified oligonucleotides with mixed PS / PO internucleoside linkages

[0449]

[0450]

[0451] Table 7

[0452] The modified oligonucleotides in Table 7 below are 19 or 20 nucleosides in length. Each nucleoside comprises a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, or a 2'-β-D-deoxyribosyl sugar moiety. The sugar motif of each modified oligonucleotide is provided in the Sugar Motif column, wherein each 'e' represents a 2'-MOE sugar moiety, each 'n' represents a 2'-NMA sugar moiety, and each 'd' represents a 2'-β-D-deoxyribosyl sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide provided in the Internucleoside Linkage Motif column is (5' to 3'): ssssssssssssssssoo; wherein each 's' represents a phosphorothioate internucleoside linkage, and each 'o' represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine.

[0453] Unless otherwise specifically stated, each nucleobase in the modified oligonucleotides listed in Table 6 below is complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated from nucleosides 19939708 to 19967777). Non-complementary nucleobases are indicated in the nucleobase sequence column with Underline, bold, italic fonts The "start site" indicates the 5'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. The "stop site" indicates the 3'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0454] Table 7 Modified oligonucleotides with mixed PS / PO internucleoside linkages

[0455]

[0456]

[0457]

[0458] Table 8

[0459] The modified oligonucleotides in Table 8 below are each 19 nucleosides in length. Each nucleoside comprises a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, or a 2'-β-D-deoxyribosyl sugar moiety. The sugar motif of each modified oligonucleotide is provided in the Sugar Motif column, wherein each 'e' represents a 2'-MOE sugar moiety, each 'n' represents a 2'-NMA sugar moiety, and each 'd' represents a 2'-β-D-deoxyribosyl sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide provided in the Internucleoside Linkage Motif column is (5' to 3'): ssssssssssssososso; wherein each 's' represents a phosphorothioate internucleoside linkage, and each 'o' represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine.

[0460] Unless otherwise specified, each nucleobase in the modified oligonucleotides listed in Table 8 below is complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated from nucleosides 19939708 to 19967777). Non-complementary nucleobases are indicated in the nucleobase sequence column with Underline, bold, italic fonts The "start site" indicates the 5'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. The "stop site" indicates the 3'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0461] Table 8 Modified oligonucleotides with mixed PS / PO internucleoside linkages

[0462]

[0463] Table 9

[0464] The modified oligonucleotides in Table 9 below are each 19 nucleosides in length. Each nucleoside comprises a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, or a 2'-β-D-deoxyribosyl sugar moiety. The sugar motif of each modified oligonucleotide is provided in the Sugar Motif column, wherein each 'e' represents a 2'-MOE sugar moiety, each 'n' represents a 2'-NMA sugar moiety, and each 'd' represents a 2'-β-D-deoxyribosyl sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide provided in the Internucleoside Linkage Motif column is (5' to 3'): sssssssssssssosso; wherein each 's' represents a phosphorothioate internucleoside linkage, and each 'o' represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine.

[0465] Unless otherwise specifically stated, each nucleobase in the modified oligonucleotides listed in Table 9 below is complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated from nucleosides 19939708 to 19967777). Non-complementary nucleobases are indicated in the nucleobase sequence column with Underline, bold, italic fonts The "start site" indicates the 5'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. The "stop site" indicates the 3'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0466] Table 9 Modified oligonucleotides with mixed PS / PO internucleoside linkages

[0467]

[0468] Table 10

[0469] The modified oligonucleotides in Table 10 below are each 19 nucleosides in length. Each nucleoside comprises a 2'-MOE sugar moiety or a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is provided in the Sugar Motif column, wherein each 'e' represents a 2'-MOE sugar moiety and each 'n' represents a 2'-NMA sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide provided in the Internucleoside Linkage Motif column is (5' to 3'): osssssssssssssss; wherein each 's' represents a phosphorothioate internucleoside linkage and each 'o' represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine.

[0470] Unless otherwise specifically stated, each nucleobase in the modified oligonucleotides listed in Table 10 below is complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated from nucleosides 19939708 to 19967777). Non-complementary nucleobases are indicated in the nucleobase sequence column with Underline, bold, italic fonts The "start site" indicates the 5'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. The "stop site" indicates the 3'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0471] Table 10 Modified oligonucleotides with mixed PS / PO internucleoside linkages

[0472]

[0473] Table 11

[0474] The modified oligonucleotides in Table 11 below are each 20 nucleosides in length. Each nucleoside comprises a 2'-MOE sugar moiety or a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is provided in the Sugar Motif column, wherein each 'e' represents a 2'-MOE sugar moiety and each 'n' represents a 2'-NMA sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide provided in the Internucleoside Linkage Motif column is (5' to 3'): osssssssssssssssso; wherein each 's' represents a phosphorothioate internucleoside linkage and each 'o' represents a phosphodiester internucleoside linkage. Each cytosine is 5-methylcytosine.

[0475] Each modified oligonucleotide listed in Table 11 below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated from nucleosides 19939708 to 19967777). "Start Site" indicates the 5'-nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. "Stop Site" indicates the 3'-nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0476] Table 11 Modified oligonucleotides with mixed PS / PO internucleoside linkages

[0477]

[0478] Example 2: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (35 μg)

[0479] The activity of the selected modified oligonucleotides described above was tested in human SMN2 transgenic mice. The Taiwanese strain of SMA III mice was obtained from the Jackson Laboratory (Bar Harbor, Maine). These mice lack mouse SMN and are homozygous for human SMN2 (mSMN- / -; hSMN2+ / +; FVB.Cg-Tg(SMN2)2HungSMN1tm1Hung / J, stock number 005058; Bar Harbor, Maine), or are heterozygous for mouse SMN and are heterozygous for human SMN2 (mSMN+ / -; hSMN2+ / -; FVB.Cg-Tg(SMN2)2HungSMN1tm1Hung / J) obtained by breeding HOM / HOM (stock number 00005058) with FVB / NJ (stock number 001800).

[0480] deal with

[0481] Homozygous or heterozygous transgenic mice were grouped into groups of 4 mice. Each mouse received a single ICV bolus of 35 μg of the modified oligonucleotide. Comparative compounds Nos. 387954, 396442, and 396443 were also tested in this assay. One group of 4 mice received PBS as a negative control.

[0482] RNA analysis

[0483] Two weeks after treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. The primer probe set hSMN2vd#4_LTS00216_MGB (forward sequence: GCTGATGCTTTGGGAAGTATGTTA (SEQ ID NO: 11); reverse sequence: CACCTTCCTTCTTTTTGATTTTGTC, designated herein as SEQ ID NO: 12; probe sequence: TACATGAGTGGCTATCATACT (SEQ ID NO: 13)) was used to determine the expression of exon 7 (exon 7). + The amount of SMN2 RNA was determined by using the primer probe set hSMN2_Sumner68_PPS50481 (forward sequence: CATGGTACATGAGTGGCTATCATACTG (SEQ ID NO: 14); reverse sequence: TGGTGTCATTTAGTGCTGCTCTATG (SEQ ID NO: 15); probe sequence CCAGCATTTCCATATAATAGC (SEQ ID NO: 16)) excluding exon 7 (exon 7 - Total SMN2 RNA levels were measured using the primer probe set hSMN2_LTS00935 (forward sequence: CAGGAGGATTCCGTGCTGTT (SEQ ID NO: 17); reverse sequence: CAGTGCTGTATCATCCCAAATGTC, (SEQ ID NO: 18); probe sequence: ACAGGCCAGAGCGAT (SEQ ID NO: 19)).

[0484] Results are presented as fold change in RNA levels relative to PBS controls normalized to total SMN2 levels. Each of Tables 12-18 represents a different experiment.

[0485] Table 12

[0486] Effects of modified oligonucleotides on human SMN2 RNA splicing in homozygous transgenic mice

[0487]

[0488]

[0489] Table 13

[0490] Effects of modified oligonucleotides on human SMN2 RNA splicing in homozygous transgenic mice

[0491]

[0492]

[0493] Table 14

[0494] Effects of modified oligonucleotides on human SMN2 RNA splicing in homozygous transgenic mice

[0495]

[0496] Table 15

[0497] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0498]

[0499] Table 16

[0500] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0501]

[0502]

[0503] Table 17

[0504] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0505]

[0506] Table 18

[0507] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0508]

[0509] Example 3: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (15 μg)

[0510] The activity of the selected modified oligonucleotides described above was tested in human SMN2 transgenic mice essentially as described above in Example 2. Comparative compounds Nos. 396443 and 819735 were also tested in this assay. The transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of 15 μg of the modified oligonucleotide. One group of 4 mice received PBS as a negative control. Two weeks after treatment, the mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are presented as fold change in RNA levels normalized to total SMN2 levels relative to the PBS control. Each of Tables 19-23 represents a different experiment.

[0511] Table 19

[0512] Effects of modified oligonucleotides on human SMN2 RNA splicing in homozygous transgenic mice

[0513]

[0514] Table 20

[0515] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0516]

[0517] Table 21

[0518] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0519]

[0520] Table 22

[0521] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0522]

[0523] Table 23

[0524] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0525]

[0526] Example 4: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (70 μg)

[0527] The activity of the modified oligonucleotides was tested in human SMN2 transgenic mice essentially as described above in Example 2. Transgenic mice were divided into groups of four mice each. Each mouse received a single ICV bolus of 70 μg of the modified oligonucleotide. One group of four mice received PBS as a negative control. Two weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are presented as fold change in RNA levels relative to the PBS control, normalized to total SMN2 levels.

[0528] Table 24

[0529] Effects of modified oligonucleotides on human SMN2 RNA splicing in homozygous transgenic mice

[0530]

[0531] Example 5: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, multiple doses

[0532] Essentially as described above in Example 2, the activity of the selected modified oligonucleotides described above was tested in human SMN2 transgenic mice. Comparative compound No. 396443 was also tested in this assay. The transgenic mice were divided into groups of 4 mice per group. Each mouse received a single ICV bolus of the modified oligonucleotide at multiple doses as indicated in the table below. One group of 4 mice received PBS as a negative control. Two weeks after treatment, the mice were sacrificed and RNA was extracted from the coronary brain and spinal cord for real-time qPCR analysis of SMN2 RNA. The results are presented as the fold change of RNA levels normalized to total SMN2 levels relative to the PBS control. In GraphPad Prism 7, nonlinear regression 4-parameter dose-response curves [Y = bottom + (top - bottom) / (1 + (10^logEC50 / X)^Hill slope)] were used to calculate exon inclusion (exon 7 + ) 50 .

[0533] Table 25

[0534] Effects of modified oligonucleotides on human SMN2 RNA splicing in homozygous transgenic mice

[0535]

[0536] Example 6: Tolerance of modified oligonucleotides complementary to SMN2 in wild-type mice, 3-hour study

[0537] In wild-type female C57 / Bl6 mice, modified oligonucleotide described above is tested to assess tolerance. Wild-type female C57 / Bl6 mice each receive a single ICV dose of the modified oligonucleotide listed in the table below of 700 μg. Comparative compound number 396443 was also tested in this assay at a dosage of 350 μg. Comparative compound numbers 387954, 396442, 443305 and 819735 were also tested in this assay at a dosage of 700 μg. Each treatment group is made up of 4 mice. One group of 4 mice receives PBS as the negative control (identified in the following separate table) for each experiment. 3 hours after injection, mice were evaluated according to seven different standards. The criteria are (1) the mouse is intelligent, alert, and responsive; (2) the mouse stands or arches its back without stimulation; (3) the mouse shows any movement without stimulation; (4) the mouse exhibits forward movement after being lifted; (5) the mouse exhibits any movement after being lifted; (6) the mouse responds to a tail pinch; and (7) breathes evenly. For each of the 7 criteria, the mouse was given a subscore of 0 if it met the criteria, and a subscore of 1 (Functional Observation Board Composite Score or FOB) if it did not meet the criteria. After evaluating all 7 criteria, the scores were summed and averaged within each treatment group. The results are presented in the table below. Each of Tables 26-49 represents a different experiment.

[0538] Table 26 Tolerability scores in mice at a dose of 350 μg

[0539]

[0540] Table 27 Tolerability scores in mice at a dose of 700 μg

[0541]

[0542] Table 28 Tolerability scores in mice at a dose of 700 μg

[0543]

[0544]

[0545] Table 29 Tolerability scores in mice at a dose of 700 μg

[0546]

[0547]

[0548] Table 30 Tolerability scores in mice at a dose of 700 μg

[0549] Compound number 3 hours FOB PBS 0.00 396442 3.25 1212961 0.00 1212963 1.00 1212964 2.00 1212965 1.25 1212966 1.25 1212968 0.00 1212971 1.00 1212972 3.25 1212973 0.50 1212974 2.00 1212975 0.50 1212976 1.75

[0550] Table 31 Tolerability scores in mice at a dose of 700 μg

[0551]

[0552]

[0553] Table 32 Tolerability scores in mice at a dose of 700 μg

[0554] Compound number 3 hours FOB PBS 0.00 1212993 7.00 1212994 6.50 1212995 4.25 1212996 3.25 1212997 4.00 1212998 2.00 1212999 1.00 1213000 1.25 1213001 3.00 1213002 2.00 1213003 4.00 1213004 3.00 1213005 3.75 1213006 4.00 1213007 4.00 1213008 3.50

[0555] Table 33 Tolerability scores in mice at a dose of 700 μg

[0556]

[0557]

[0558] Table 34 Tolerability scores in mice at a dose of 700 μg

[0559]

[0560] Table 35 Tolerability scores in mice at a dose of 700 μg

[0561]

[0562]

[0563] Table 36 Tolerability scores in mice at a dose of 700 μg

[0564]

[0565]

[0566] Table 37 Tolerability scores in mice at a dose of 700 μg

[0567] Compound number 3 hours FOB PBS 0.00 1263826 0.00

[0568] Table 38 Tolerability scores in mice at a dose of 700 μg

[0569] Compound number 3 hours FOB PBS 0.00 387954 4.00 1287048 0.00 1287049 0.00 1287050 2.00 1287051 3.25 1287052 3.50 1287053 2.75 1287054 2.00 1287055 3.25 1287056 4.00 1287057 3.00 1287058 4.00 1287059 4.00 1287060 4.00 1287061 4.00 1287062 3.50

[0570] Table 39 Tolerability scores in mice at a dose of 700 μg

[0571] Compound number 3 hours FOB PBS 0.00 1287106 3.50 1287107 4.00 1287108 3.75 1287109 3.25 1287110 3.00 1287111 4.75 1287112 4.00 1287113 3.50 1287114 3.25 1287115 3.50 1287116 4.00 1287117 4.25 1287118 3.00 1287119 3.50 1287120 3.75 1287121 2.75

[0572] Table 40 Tolerability scores in mice at a dose of 700 μg

[0573] Compound number 3 hours FOB PBS 0.00 1287063 0.00 1287064 0.00 1287065 1.00 1287066 3.75 1287067 1.00 1287068 2.50 1287069 2.25 1287071 1.00 1287072 3.00 1287073 3.75 1287074 1.75 1287075 3.50 1287076 2.00

[0574] Table 41 Tolerability scores in mice at a dose of 700 μg

[0575] Compound number 3 hours FOB PBS 0.00 1287070 2.00 1287701 2.50 1287702 3.75 1287703 3.75 1287705 4.00 1287706 4.00 1287707 4.00 1287709 4.75 1287710 4.00 1287711 4.75 1287712 4.00 1287713 4.00 1287714 3.50 1287715 4.00 1287716 4.00 1287717 3.25

[0576] Table 42 Tolerability scores in mice at a dose of 700 μg

[0577]

[0578]

[0579] Table 43 Tolerability scores in mice at a dose of 700 μg

[0580] Compound number 3 hours FOB PBS 0.00 1287122 0.00 1287123 0.00 1287124 3.50 1287125 3.00 1287126 3.00 1287127 0.00 1287128 0.00 1287129 4.00 1287130 2.75 1287131 2.50 1287132 2.75 1287133 3.25 1287704 3.50 1287708 3.50

[0581] Table 44 Tolerability scores in mice at a dose of 700 μg

[0582]

[0583]

[0584] Table 45 Tolerability scores in mice at a dose of 700 μg

[0585] Compound number 3 hours FOB PBS 0.00 1318757 4.00 1318758 4.25 1318759 3.75 1318760 3.75 1318761 4.00 1318762 4.00 1318763 4.00 1318764 3.75 1318766 3.75 1318768 4.00 1318769 4.00

[0586] Table 46 Tolerability scores in mice at a dose of 700 μg

[0587]

[0588]

[0589] Table 47 Tolerability scores in mice at a dose of 700 μg

[0590] Compound number 3 hours FOB PBS 0.00 1332247 1.75 1332248 0.25 1332249 0.00 1332250 3.75 1332251 0.00 1332252 3.00 1332263 2.00 1332265 1.50 1332266 1.00 1332267 3.75 1332268 2.75 1332269 1.25 1332270 2.25 1332271 2.50 1333508 0.00

[0591] Table 48 Tolerability scores in mice at a dose of 700 μg

[0592] Compound number 3 hours FOB PBS 0.00 1332255 1.00 1332256 2.00 1332257 1.25 1332258 1.25 1332259 2.25 1332260 2.25 1332261 2.50 1332262 2.00

[0593] Table 49 Tolerability scores in mice at a dose of 700 μg

[0594] Compound number 3 hours FOB PBS 0.00 1358996 0.00 1364777 2.00 1364778 3.00 1364779 3.50 1364780 3.50 1364781 5.25 1364782 2.50 1364783 3.50 1364784 3.50

[0595] Example 7: Tolerability of modified oligonucleotides complementary to human SMN2 in rats, long-term evaluation

[0596] In a separate study conducted under the same conditions, the selected modified oligonucleotides described above were tested in Sprague Dawley rats to assess long-term tolerance. Comparative compound numbers 396442 and 819735 were also tested in this assay. Sprague Dawley rats each received a single intrathecal (IT) delivery dose of 3 mg oligonucleotide or PBS. Starting one week after treatment, each animal was weighed and evaluated for adverse events weekly by trained observers. Adverse events are defined as atypical neurological dysfunction in PBS-treated control animals, including but not limited to: abnormal limb opening, abnormal gait, tremor, abnormal breathing, paralysis and spasm. The onset of adverse events is defined as the week in which dysfunction is first recorded after administration. If no adverse events are achieved, there is no onset (-). The onset of adverse events is generally associated with growth disorders as defined by lack of weight gain / maintenance, similar to animals treated with PBS. Similar tolerability assessments are described in Oestergaard et al., Nucleic Acids Res., 2013 Nov, 41(21), 9634-9650 and Southwell et al., Mol Ther., 2014 Dec, 22(12), 2093-2106.

[0597] At the end of the study, rats were killed and tissues were collected. Histopathological examination was performed on cerebellar sections using calbindin staining. As indicated in the table below, Purkinje cell loss was observed in cerebellar sections stained with calbindin. Cerebellum and spinal cord were also evaluated using antibodies specific for modified oligonucleotides. Animals showing no oligonucleotide uptake were excluded from histopathological analysis. For animals killed in advance due to adverse events, histology was not completed. In addition, cortical GFAP, a marker for astrogliosis (astrogliosis) was measured using RT-PCR (Abdelhak et al., Scientific Reports, 2018, 8, 14798), and the average increase of >2 times is described below.

[0598] Table 50 Long-term tolerability in rats at a dose of 3 mg

[0599]

[0600] Example 8: Tolerability and Pharmacokinetics of Modified Oligonucleotides in Non-Human Primates, Single or Repeated Dosing

[0601] Cynomolgus monkeys were treated with modified oligonucleotides to determine their local and systemic tolerability and pharmacokinetics. Each group received artificial CSF or a single intrathecal lumbar bolus dose (IT) of the modified oligonucleotide, or for repeated dosing groups, an IT bolus dose on study day 1 followed by an IT bolus dose at later time points. Tissues were collected 1 week after the last injection.

[0602] In a single-dose study, monkeys were administered a single dose of the modified oligonucleotide and tolerability was assessed. Representative doses for single-dose studies in adult cynomolgus monkeys included 1 mg, 3 mg, 7 mg, and 35 mg.

[0603] In the repeat-dose studies, monkeys were administered an IT bolus dose on study day 1, followed by weekly (e.g., days 8, 15, and 22 of a four-week study) or monthly (e.g., days 29, 57, and 84 of a 13-week study) IT bolus doses. Representative doses studied in repeat-dose studies in adult cynomolgus monkeys include 1 mg, 3 mg, 7 mg, and 35 mg.

[0604] The assessment of tolerance is based on clinical observation, body weight, food consumption, physical and neurological examination (including sensory motor reflexes, brain reflexes and spinal reflexes), coagulation, hematology, clinical chemistry (blood and cerebrospinal fluid (CSF)), cell count and anatomic pathology evaluation. A complete necropsy is performed and any macroscopic abnormalities are recorded. Organs are weighed and microscopically examined. Blood is collected for supplementary analysis. In addition, blood, CSF and tissue (at necropsy) are collected for toxicokinetic evaluation.

[0605] The tolerance of modified oligonucleotides in brain and spinal cord tissue was analyzed by measuring Aif1 and Gfap levels in cynomolgus monkeys treated with modified oligonucleotides or controls. Brain and spinal cord samples were collected and flash-frozen in liquid nitrogen and stored frozen (-60°C to -90°C). At the time of sampling, samples were collected from frozen tissue using a 2mm biopsy punch for RNA analysis. Punching was performed in multiple brain and spinal cord regions.

[0606] Example 9: Phase Ia human clinical trial with compound No. 1263789, 1287717, 1287745 or 1358996

[0607] The safety, tolerability, pharmacokinetics, pharmacodynamics, and efficacy of modified oligonucleotides complementary to human SMN2 were evaluated in a clinical trial setting. Single and / or multiple doses of the modified oligonucleotides were evaluated in patients with confirmed SMA (e.g., SMA Type I, SMA Type II, SMA Type III, or SMA Type IV).

[0608] Patient safety was closely monitored during the study. Safety and tolerability assessments included: physical examination and standard neurological assessment (including baseline), vital signs (HR, BP, postural changes, weight), ECG, AEs and concomitant medications, Columbia Suicide Severity Rating Scale (C-SSRS), CSF safety labs (cell count, protein, glucose), plasma lab tests (clinical chemistry, hematology), and urinalysis.

[0609] Select efficacy assessments that are appropriate for age and type and include, for example: the Hammersmith Motor Function Scale-Expanded (HFMSE), a reliable and validated tool for assessing motor function in children with SMA; the Pediatric Quality of Life Questionnaire (PedsQL TM ) Measurements 4.0 General Applicability Core Scale; Children's Quality of Life Questionnaire 3.0 Neuromuscular Module; Compound Muscle Action Potential (CMAP); Motor Unit Number Estimation (MUNE); Upper Limb Module (ULM); and 6-Minute Walk Test (6MWT) (Darras et al., Neurology, 2019, 92:e2492-e2506).

[0610] Example 10: Design of modified oligonucleotides complementary to human SMN2 nucleic acid

[0611] Modified oligonucleotides complementary to human SMN2 nucleic acid were designed and synthesized as indicated in the table below.

[0612] Each modified oligonucleotide listed in the following tables is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NT_006713.14, truncated from nucleosides 19939708 to 19967777). "Start Site" indicates the 5'-nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. "Stop Site" indicates the 3'-nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0613] The length of the modified oligonucleotides in the following table is 18 nucleosides. Each nucleoside comprises a 2'-MOE sugar moiety or a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is provided in the Sugar Motif column, wherein each 'e' represents a 2'-MOE sugar moiety and each 'n' represents a 2'-NMA sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, a methoxypropylphosphonate internucleoside linkage, or a methylsulfonylphosphonoamidate (MsP) internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is provided in the Internucleoside Linkage Motif column, wherein each 's' represents a phosphorothioate internucleoside linkage, each 'o' represents a phosphodiester internucleoside linkage, each 'x' represents a methoxypropylphosphonate internucleoside linkage, and each 'z' represents a methylsulfonylphosphonoamidate (MsP) internucleoside linkage. Each cytosine is 5-methylcytosine. Modified oligonucleotide 449320 has been previously described in WO 2015 / 161170 A2.

[0614] Table 51

[0615] MOE with mixed PO / PS, PO / MsP, uniform MsP or PS / MOP internucleoside linkages

[0616] and NMA-modified oligonucleotides

[0617]

[0618] The modified oligonucleotides in the following table all consist of the following sequence (5' to 3'): TCACTTTCATAATGCTGG (SEQ ID NO: 23). Each modified oligonucleotide listed in the following tables is 100% complementary to SEQ ID NO: 1 (described herein above). The "start site" indicates the 5'-nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. The "stop site" indicates the 3'-nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0619] The length of the modified oligonucleotides in the following table is 18 nucleosides. Each nucleoside comprises a 2'-MOE sugar moiety or a 2'-NMA sugar moiety. The sugar motif of each modified oligonucleotide is provided in the Sugar Motif column, wherein each 'e' represents a 2'-MOE sugar moiety and each 'n' represents a 2'-NMA sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, or a methylsulfonylphosphamidate (MsP) internucleoside linkage. The internucleoside linkage motif of each modified oligonucleotide is provided in the Internucleoside Linkage Motif column, wherein each 's' represents a phosphorothioate internucleoside linkage, each 'o' represents a phosphodiester internucleoside linkage, and each 'z' represents a methylsulfonylphosphamidate (MsP) internucleoside linkage. Each cytosine is 5-methylcytosine. The modified oligonucleotides in the table below are conjugated with a 6-palmitamidohexyl phosphate conjugate group attached to the 5'-OH of the oligonucleotide. The structure of the conjugate group is:

[0620]

[0621] Table 52

[0622] 6-Palmitamidohexylphosphate-conjugated MOE and NMA-modified oligonucleotides with mixed PO / PS, PO / MsP, or uniform MsP internucleoside linkages

[0623]

[0624] The modified oligonucleotides in the table below all consist of the following sequence (5' to 3'): TCACTTTCATAATGCTGG (SEQ ID NO: 23), with the start site being 27062 on SEQ ID No: 1 (described herein above) and the end site being 27079, wherein the "start site" indicates the 5'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide, and wherein the "end site" indicates the 3'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide.

[0625] The modified oligonucleotides in the table below are 18 nucleosides in length. The sugar and internucleoside linkage motifs of each modified oligonucleotide are provided in the sequence and chemical notation columns, wherein each subscript 'n' represents a 2'-NMA sugar moiety, each subscript '[DMA]' represents a 2'-O-(N,N-dimethyl)acetamide moiety, each subscript '[NEA]' represents a 2'-O-(N-ethyl)acetamide moiety, each subscript '[NPA]' represents a 2'-O-(N-propyl)acetamide moiety, each subscript '[NcPA]' represents a 2'O-(N-cyclopropyl)acetamide moiety, each subscript '[McPA]' represents a 2'-O-(N-cyclopropylmethyl)acetamide moiety, and each subscript 's' represents a phosphorothioate internucleoside linkage. Each cytosine is 5-methylcytosine, wherein in the cytosine residue ( m The subscript 'm' before C) represents 5-methylcytosine. The structure of each sugar shown in the table below is:

[0626]

[0627] Table 53 NMA and NMA analog modified oligonucleotides with uniform PS internucleoside linkages

[0628]

[0629] Example 11: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (35 μg)

[0630] The activity of selected modified oligonucleotides described above was tested in human SMN2 transgenic mice essentially as described above in Example 2.

[0631] deal with

[0632] Transgenic mice were divided into groups of 4 mice per group. Each mouse received a single ICV bolus of the modified oligonucleotide at the dose indicated in the table below. One group of 4 mice received PBS as a negative control. Two weeks after treatment, mice were sacrificed and RNA was extracted from the coronary brain and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are presented as fold change in RNA levels normalized to total SMN2 levels relative to the PBS control. Exon inclusion (exon 7) was calculated using a nonlinear regression 4-parameter dose response curve [Y = bottom + (top - bottom) / (1 + (10^logEC50 / X)^Hill slope)] in GraphPad Prism 7. + ) 50 .

[0633] RNA analysis

[0634] Two weeks after treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. Primer probe set hSMN2vd#4_LTS00216_MGB was used to determine the expression of exon 7 ( + The amount of SMN2 RNA was determined using the primer probe set hSMN2_Sumner68_PPS50481, which does not include exon 7 ( - Total SMN2 RNA levels were measured using the primer probe set hSMN2_LTS00935. Results are presented as fold change in RNA levels normalized to total SMN2 levels relative to the PBS control.

[0635] Table 54

[0636] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0637]

[0638] Table 55

[0639] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0640]

[0641] Indicates that fewer than four samples are available

[0642] Example 12: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (15 μg)

[0643] The activity of selected modified oligonucleotides described above was tested in human SMN2 transgenic mice essentially as described above in Example 2.

[0644] deal with

[0645] Transgenic mice were divided into groups of 4 mice per group. Each mouse received a single ICV bolus of the modified oligonucleotide at the dose indicated in the table below. One group of 4 mice received PBS as a negative control. Two weeks after treatment, mice were sacrificed and RNA was extracted from the coronary brain and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are presented as fold change in RNA levels normalized to total SMN2 levels relative to the PBS control. Exon inclusion (exon 7) was calculated using a nonlinear regression 4-parameter dose response curve [Y = bottom + (top - bottom) / (1 + (10^logEC50 / X)^Hill slope)] in GraphPad Prism 7. + ) 50 .

[0646] RNA analysis

[0647] Two weeks after treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. Primer probe set hSMN2vd#4_LTS00216_MGB was used to determine the expression of exon 7 ( + The amount of SMN2 RNA was determined using the primer probe set hSMN2_Sumner68_PPS50481, which does not include exon 7 ( - Total SMN2 RNA levels were measured using the primer probe set hSMN2_LTS00935. Results are presented as fold change in RNA levels normalized to total SMN2 levels relative to the PBS control.

[0648] Table 56

[0649] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0650]

[0651]

[0652] Example 13: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, multiple doses

[0653] The activity of selected modified oligonucleotides described above was tested in human SMN2 transgenic mice essentially as described above in Example 2.

[0654] deal with

[0655] Transgenic mice were divided into groups of 4 mice per group. Each mouse received a single ICV bolus of the modified oligonucleotide at multiple doses as indicated in the table below. One group of 4 mice received PBS as a negative control. Two weeks after treatment, mice were sacrificed and RNA was extracted from coronary brain and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are presented as fold change in RNA levels normalized to total SMN2 levels relative to the PBS control. Exon inclusion (exon 7) was calculated using a nonlinear regression 4-parameter dose response curve [Y = bottom + (top - bottom) / (1 + (10^logEC50 / X)^Hill slope)] in GraphPad Prism 7. + ) 50 .

[0656] RNA analysis

[0657] Two weeks after treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. Primer probe set hSMN2vd#4_LTS00216_MGB was used to determine the expression of exon 7 ( + The amount of SMN2 RNA was determined using the primer probe set hSMN2_Sumner68_PPS50481, which does not include exon 7 ( - Total SMN2 RNA levels were measured using the primer probe set hSMN2_LTS00935. Results are presented as fold change in RNA levels normalized to total SMN2 levels relative to the PBS control.

[0658] Table 57

[0659] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0660]

[0661] Table 58

[0662] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0663]

[0664]

[0665] Indicates that fewer than four samples are available

[0666] Table 59

[0667] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0668]

[0669] Example 15: Tolerance of modified oligonucleotides complementary to SMN2 in wild-type mice

[0670] The modified oligonucleotides described above were tested in wild-type female C57 / Bl6 mice to assess the tolerability of the oligonucleotides. Wild-type female C57 / Bl6 mice each received a single ICV dose of 700 μg of the modified oligonucleotides listed in the table below. Each treatment group consisted of 4 mice. One group of 4 mice received PBS as a negative control for each experiment (identified in the separate table below). Three hours after injection, the mice were evaluated according to seven different criteria. The criteria were (1) the mouse was intelligent, alert, and responsive; (2) the mouse stood or arched its back without stimulation; (3) the mouse showed no movement without stimulation; (4) the mouse exhibited forward movement after being lifted; (5) the mouse exhibited no movement after being lifted; (6) the mouse responded to tail pinching; and (7) breathing evenly. For each of the 7 criteria, the mouse was given a subscore of 0 if it met the criteria, and a subscore of 1 (Functional Observational Combined Score or FOB) if it did not meet the criteria. After evaluating all 7 criteria, the scores for each mouse were summed and averaged within each treatment group. The results are presented in the table below.

[0671] Table 60 Tolerability scores in mice at a dose of 700 μg

[0672] Compound number 3 hours FOB PBS 0.00 1287723 2.00 1287724 1.00 1287727 2.00

Claims

1. An oligomeric compound comprising a modified oligonucleotide consisting of 16, 17, 18, 19 or 20 linked nucleosides and a nucleobase sequence comprising at least 15 or at least 16 consecutive nucleobases of any one of the nucleobase sequences SEQ ID NOs: 20-50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

Citation Information

Patent Citations

  • Nuclease resistant chimeric oligonucleotides

    US20030158403A1

  • Nuclease resistant chimeric oligonucleotides

    US20030175906A1

  • Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation

    US20080039618A1

  • 2' and 5' modified monomers and oligonucleotides

    US20130203836A1

  • Bicyclic cyclohexose nucleic acid analogs

    US20150191727A1