A haplotype molecular marker affecting sheep loin muscle area and its application
Through genome association analysis, haplotype molecular markers that affect the loin muscle area of Suffolk sheep were screened out, which solved the problem of insufficient purebred resources of Suffolk sheep and improved the meat production performance of Suffolk sheep.
Patent Information
- Application Number
- CN202510983272.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-17
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2045-07-17
AI Technical Summary
At present, my country's Suffolk sheep purebred resources are insufficient, and some populations suffer from inbreeding depression, which affects genetic diversity. The loin muscle area is an important indicator for measuring the carcass quality of Suffolk sheep, and existing technology cannot effectively improve its meat production performance.
Through genomic association analysis, haplotype molecular markers affecting the loin muscle area trait of Suffolk sheep were screened out, including 7 loci from LOC105603993-SNP1 to LOC105603993-SNP7. The haplotype combination TTAAGGAACCTTCC was constructed for the identification and breeding of Suffolk sheep with large loin muscle area.
By selecting Suffolk sheep individuals with a specific haplotype combination as parents, the waist muscle area of the offspring was increased and the meat production performance of the Suffolk sheep was improved.
Smart Images

Figure CN120464758B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic breeding, and in particular to a haplotype molecular marker affecting sheep loin muscle area traits and an application thereof. Background Art
[0002] Suffolk sheep are native to Suffolk, Norfolk, Cambridge, and Essex in southeast England, UK. They are one of the world's largest meat sheep breeds, boasting a prominent physique, high reproductive rate, meat yield, daily weight gain, and excellent meat quality, making them suitable as terminal sires for meat hybrids. With increasing consumer demand for high-quality mutton, high-end Suffolk meat products hold a promising market prospect. However, my country currently faces a shortage of purebred Suffolk sheep, with some populations experiencing inbreeding depression, which impacts genetic diversity. Loin muscle area is a key indicator of carcass quality in Suffolk sheep, reflecting overall growth and development. To further improve meat production in Suffolk sheep, it is crucial to identify haplotype-specific molecular markers influencing loin muscle area through genomic association analysis. Summary of the Invention
[0003] To solve the above technical problems, the present invention provides a haplotype molecular marker affecting the psoas muscle area trait of sheep and its application, which is used to identify the psoas muscle area trait of Suffolk sheep and breed Suffolk sheep with large psoas muscle area.
[0004] The present invention is achieved through the following technical solutions:
[0005] In a first aspect, the present invention provides a haplotype molecular marker that affects the area trait of sheep loin muscle, wherein the haplotype molecular marker comprises LOC105603993 -SNP1~ LOC105603993 -SNP7 has a total of 7 sites.
[0006] in, LOC105603993 - The gene location of SNP1 is 101 bp in the nucleotide sequence shown in SEQ ID NO. 1, where a mutation from T to G occurs. The nucleotide sequence shown in SEQ ID NO. 1 is the 100 bp before and after the mutation site.
[0007] LOC105603993 - The gene location of SNP2 is 101 bp of the nucleotide sequence shown in SEQ ID NO. 2, where a mutation from A to C occurs. The nucleotide sequence shown in SEQ ID NO. 2 is the 100 bp before and after the mutation site.
[0008] LOC105603993- The gene location of SNP3 is 101 bp in the nucleotide sequence shown in SEQ ID NO. 3, where a mutation from G to T occurs. The nucleotide sequence shown in SEQ ID NO. 3 is the 100 bp before and after the mutation site.
[0009] LOC105603993 - The gene location of SNP4 is a mutation from A to T at 101 bp of the nucleotide sequence shown in SEQ ID NO. 4. The nucleotide sequence shown in SEQ ID NO. 4 is the 100 bp before and after the mutation site.
[0010] LOC105603993 - The gene location of SNP5 is a C to T mutation at 101 bp of the nucleotide sequence shown in SEQ ID NO. 5. The nucleotide sequence shown in SEQ ID NO. 5 is the 100 bp before and after the mutation site.
[0011] LOC105603993 - The gene location of SNP6 is 101 bp in the nucleotide sequence shown in SEQ ID NO. 6, where a T-to-C mutation occurs. The nucleotide sequence shown in SEQ ID NO. 6 is the 100 bp before and after the mutation site.
[0012] LOC105603993 - The gene location of SNP7 is 101 bp in the nucleotide sequence shown in SEQ ID NO. 7, where a C to T mutation occurs. The nucleotide sequence shown in SEQ ID NO. 7 is the 100 bp before and after the mutation site.
[0013] The nucleotide sequence of SEQ ID NO.1 is as follows:
[0014] GGGGATCTTCCTGACGGGATCAAACCTGCATCTCTTATACCTCCTGCATTGACAGGTGGGTTCTTTACTACTGGTGCCGCCTGGGAAGCCCCAGATTGGC[T / G]TTACTAATTTCTAATTCAAAGCAAAGTTCAGATTATTTTACTTCTACTTCAGTTTCCTCATCTGTAAATTGTTGTAATGTCTTTATAAGAGTTTTATTAT.
[0015] The nucleotide sequence of SEQ ID NO.2 is shown below:
[0016] CCGCCTGGGAAGCCCCAGATTGGCTTTACTAATTTCTAATTCAAAGCAAAGTTCAGATTATTTTACTTCTACTTCAGTTTCCTCATCTGTAAATTGTTGT[A / C]ATGTCTTTATAAGAGTTTTATTATTTTTATGTTTGAGAATTAAACAAACCCGGCTTATGTTTATGATATACATAGAATCTAAAAGTGATATGTACATGAC.
[0017] The nucleotide sequence of SEQ ID NO.3 is as follows:
[0018] TTCTTTCACATATTTTGCAAAACATGTTCATGAAGAGTCTAAAAGAATAAATATGAATAATTGATCCCTATAGAGTGCTTCCACTTTTTTGTCACACTCT[G / T]AATTGTTTTTATTAAAATTTTTAGGTTAATATTTCATGCAAAAAATGAAATAAGGCTAAAAACAAAGAGAAAAACTACACATTTGCTTCTACCCCAGGTA.
[0019] The nucleotide sequence of SEQ ID NO.4 is shown below:
[0020] TAGTGCTTGTTCTAATATTTAGATTTGAACATTTCCACCTGGAGAGCTTGTCAAAGGGGCAGTGAGGAGCGTGCTCCTCTGCTAGTTTCCCTGGTAACTG[A / T]TGAGACAACCTGTTGTCAATTCCCTTACAGCCAGTAACTACCTCTGCTGCTGCTGCTGCTAAGTCACTTCAGTCATGTCCGACTCTGTGCAACCTCTGT.
[0021] The nucleotide sequence of SEQ ID NO.5 is shown below:
[0022] AGGTACAGGTGCAACTTCAGGGCTGCCACTCACTAACGAGGGCCCGTAAAGTTGTGGGCTGATCCTGAAAGTCGCAGAGGAAATCCTGGGGGTGGGCTATC[C / T]GCTAGTATGTGGGGCTCTGTTGTGGTCATCCTTGATGAATGGGGGCTCTCAAGCAAGTATAGGGAACTCATAGACACCCCTAAGGCTGCTGGGGAGATAC.
[0023] The nucleotide sequence of SEQ ID NO.6 is shown below:
[0024] TGTAGCTCGGGGCCATGGCGCAGGCTGCTGGGCAGACACTGATGGAGTCCCGGTGGTGGTGCAGCTGGGCCTCCAGGCTTTTCTTCTCCAGCCCAGAGGA[T / C]GCAGCTGGGACATGAAGACCTTGTGTGGACAGTAATGACCTCACGGTTCCAATTGCCTGCTGGCAGAACCTACAATATGAACGTCAAAGTTGGCCTGAGA.
[0025] The nucleotide sequence of SEQ ID NO.7 is shown below:
[0026] CGTATGTACACTTCCATTATTGGCTCTGTGAATTTTCTTAATCCCAAATTTTATTAGTTGATAAGCTTTTGTACAATAGAGAGTAGACACACAGTGATT[C / T]CTAGAAGGTGAATTAGGTCAACATAAATTAGAAAGCTGTGTCTAGAATTTTTCATTTCCATAGATTCCCCTTTTTTGTTGCTACTTGAGAGCCGCTGCC.
[0027] The second aspect of the present invention provides the use of haplotype molecular markers that affect the sheep psoas muscle area trait in identifying the sheep psoas muscle area trait.
[0028] Preferably, the identification of sheep psoas muscle area traits comprises the following steps:
[0029] Extract genomic DNA from sheep blood.
[0030] The genomic DNA is fragmented to obtain DNA fragments, and then a library is constructed using the DNA fragments. The library is sequenced to obtain sequencing data.
[0031] The sequencing data were used to identify and screen the variant sites, and the haplotype molecular markers of sheep were detected using genome-wide association analysis. LOC105603993 - The genotype of SNP1 at 13505215bp on chromosome 21 is TT, LOC105603993 - The genotype of SNP2 at 13505291bp on chromosome 21 is AA, LOC105603993 - The genotype of SNP3 at 13506045bp on chromosome 21 is GG, LOC105603993 - The genotype of SNP4 at 13506244bp on chromosome 21 is AA, LOC105603993 - The genotype of SNP5 at 13506983bp on chromosome 21 is CC, LOC105603993 - The genotype of SNP6 at 13508428bp on chromosome 21 is TT and LOC105603993 -When the genotype of SNP7 at 1351395bp on chromosome 21 is CC, the haplotype combination composed of the genotypes of the seven SNP sites is TTAAGGAACCTTCC, and the waist muscle area of sheep is larger than that of other haplotype combinations.
[0032] Preferably, the length of the DNA fragment is 320 bp to 380 bp.
[0033] Preferably, the threshold of the genome-wide association analysis is set to P=1 / 620054.
[0034] The third aspect of the present invention provides the application of the haplotype molecular marker affecting the sheep psoas muscle area trait in sheep genetic breeding.
[0035] Preferably, the psoas muscle area of the offspring is increased by selecting individuals with the haplotype combination of TTAAGGAACCTTCC as parents.
[0036] Preferably, the sheep are Suffolk sheep.
[0037] Compared with the prior art, the present invention has the following beneficial effects:
[0038] The present invention provides a haplotype molecular marker affecting the sheep loin muscle area trait, the haplotype molecular marker includes LOC105603993 -SNP1~ LOC105603993 -SNP7 has a total of 7 sites; among them, LOC105603993 -SNP1 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.1, where a T-to-G mutation occurs; LOC105603993-SNP2 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.2, where a mutation from A to C occurs; LOC105603993 -SNP3 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.3, where a G to T mutation occurs; LOC105603993 -SNP4 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO. 4, where an A to T mutation occurs; LOC105603993 -SNP5 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.5, where a C to T mutation occurs; LOC105603993 -SNP6 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.6, where a T-to-C mutation occurs; LOC105603993 -SNP7 is located at a C-to-T mutation at 101 bp of the nucleotide sequence shown in SEQ ID NO. 7. The present invention, through genome sequencing, variant site identification, and genome-wide association analysis, screened for haplotype molecular markers encompassing seven SNPs that affect the psoas muscle area in Suffolk sheep. These markers are used to identify the psoas muscle area trait in sheep. By selecting individuals with the TTAAGGAACCTTCC haplotype combination as either sires or dams, the psoas muscle area of offspring can be increased. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0040] Figure 1 The variation characteristics of the Suffolk population are Figure 1 In the figure, A is the Suffolk sheep SNP type distribution map, the X-axis represents the mutation type, and the Y-axis represents the number of mutations; B is the Suffolk sheep SNP position annotation result statistical map, the X-axis represents the various functional areas, and the Y-axis represents the number of genetic variations in different functional areas; C is the SNP function annotation statistical map of the CDS region, the X-axis represents the various functions, and the Y-axis represents the number of genetic variations in various functions.
[0041] Figure 2 This is the distribution diagram of SNPs in the 1Mb window of chromosome after quality control. The left Y-axis represents the chromosome name and the upper X-axis represents the window size.
[0042] Figure 3 For principal component analysis plot, the first two explained variance percentages PC1 and PC2 are used as X and Y axes.
[0043] Figure 4 This is a visualization diagram of the IBS genetic distance matrix.
[0044] Figure 5 Manhattan plots and QQ-plots show the GWAS results for loin muscle area in Suffolk sheep, with genome-wide significant SNPs shown in red. Figure 5 In the figure, A is the Manhattan plot of the loin muscle area of Suffolk sheep; B is the QQ plot of the loin muscle area of Suffolk sheep.
[0045] Figure 6 On chromosome 21 LOC105603993 Seven SNPs at 13505215bp, 13505291bp, 13506045bp, 13506244bp, 13506983bp, 13508428bp and 1351395bp of the gene constitute a haplotype block analysis result diagram; Figure 6 A is on chromosome 21 of Suffolk sheep. LOC105603993 Visualization D' map of linkage disequilibrium of 7 SNPs at 13505215bp, 13505291bp, 13506045bp, 13506244bp, 13506983bp, 13508428bp and 1351395bp of the gene; B is the ... LOC105603993 Visualization of linkage disequilibrium of 7 SNPs at 13505215bp, 13505291bp, 13506045bp, 13506244bp, 13506983bp, 13508428bp and 1351395bp of the gene 2 Figure; C shows the haplotype results of SNPs related to loin muscle area in Suffolk sheep. DETAILED DESCRIPTION
[0046] To facilitate understanding of the present invention, the present invention will be described more fully below, along with preferred embodiments of the present invention. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the disclosure of the present invention.
[0047] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.
[0048] The beneficial effects of the present invention are described below through specific examples.
[0049] Example 1
[0050] Source of experimental animals and phenotypes:
[0051] The experimental sheep in this invention were all obtained from Sino Sheep Breeding Technology Co., Ltd. in Inner Mongolia Autonomous Region. Phenotypic records of the psoas muscle area trait were measured in live Suffolk sheep from 2020 to 2024, as shown in Table 1. Blood samples were collected from 300 Suffolk sheep. All samples were immediately stored at -80°C after collection, transported to the laboratory on dry ice, and then stored at -80°C for a long time.
[0052] Table 1 Description of body weight traits of Suffolk sheep
[0053]
[0054] 1. Genomic DNA Extraction and Quality Inspection
[0055] DNA was extracted from blood samples using the phenol-chloroform method. DNA concentration, the absorption wavelength ratio of the highest absorption peaks of nucleic acids, proteins, and phenols (260 nm / 280 nm), and the absorption wavelength ratio of the highest absorption peak of carbohydrates (260 nm / 230 nm) were measured using a NanoDrop 2000 spectrophotometer. DNA quality was assessed by 1% agarose gel electrophoresis.
[0056] 2. Library Construction and Sequencing
[0057] After processing qualified genomic DNA samples, the DNA was randomly fragmented into 350bp fragments using a Covaris ultrasonic disruptor. The DNA fragments were then subjected to end-repair, poly A addition, sequencing adapters, purification, and PCR amplification to complete library preparation. After library construction, preliminary quantification was performed using Qubit 2.0, and the effective concentration of the library was accurately quantified using qPCR to ensure library quality. After passing the library quality test, sequencing was performed using the BGI-T7 sequencing platform in PE150 mode.
[0058] 3. Identification, screening and annotation of variant sites
[0059] The raw sequencing data were quality controlled and preprocessed using fastp software version V0.20.0 to obtain clean reads data. A genome index was established for the reference genome, and the quality-controlled clean reads were aligned with the sheep reference genome Oar_v4.0, GCF_000298735.2 using Burrows-WheelerAligner software version V0.7.17. The aligned sam files were converted into bam files and sorted using SAMtools software version V1.8-20. The MarkDuplicates program in the Genome Analysis Tool kit software version V3.8 was used to remove duplicate data from the sorted bam files to obtain the final bam files. The final bam files were indexed, and the HaplotypeCaller module in the GATK software was used for SNP variation detection. The obtained vcf files were filtered using the VariantFiltration module. The ANNOVAR software package is used to perform functional annotation on the detected genetic variants. Based on the location of the variant site on the reference genome and the gene position information on the reference genome, the region where the variant site occurs in the genome, such as the intergenic region, intron region or CDS region, and the impact of the variant, such as synonymous and non-synonymous mutations, can be obtained.
[0060] Whole genome resequencing was performed on 300 individuals of Suffolk sheep to establish a genotype database, generating a total raw read size of 17243.32 Gb. A total of 47506993 SNPs were obtained, of which 31258829 were transition types C / T and G / A, and 16248164 were transversion types A / C, A / T, C / G and G / T. The transition transversion ratio was 193.75%, as shown in Figure 2. Figure 1 Then, all detected variants in Suffolk sheep were annotated using the gene annotation file downloaded from the Ensembl database, and it was found that the most variants were found in intergenic regions (58.90%) and intronic regions (33.25%), as shown in Figure 1. Figure 1 As shown in Figure B, only 0.70% of them are located in the coding regions, including 139,877 synonymous mutations and 136,655 non-synonymous mutations. Figure 1 These potential functional variants provide valuable genetic resources for exploring the genetic structure and functional genes of Suffolk sheep.
[0061] 4. Data Quality Control and Population Stratification Correction
[0062] Detection rate, English name is call rate; minimum allele frequency, English abbreviation is MAF; Hardy-Weinberg equilibrium, English abbreviation is HWE.
[0063] The obtained genotyping data were quality controlled using Plink software version V1.90. Individuals with genotype detection rates <98%, SNPs with detection rates <98%, SNPs with minimum allele frequencies <5%, and SNPs with Hardy-Weinberg equilibrium test P values <10 were excluded. -6 A total of 20,182,599 high-quality SNPs were identified in the Suffolk population. These sites were evenly distributed on the 26 pairs of autosomes in sheep. Figure 2 shown.
[0064] The first five principal components were calculated using the "--pca5" parameter of Plink software version V1.90. PCA was plotted using R version V3.6.0. The results are shown in the figure below. Figure 3 As shown in Figure 1, the experimental samples were stratified and the genetic correlation between individuals was high. The first five principal components needed to be used as covariates to correct the stratification of the Suffolk sheep population. The population was analyzed based on the IBS genetic distance matrix using Plink v1.90. The results are shown in Figure 1. Figure 4 As shown, Figure 4 Each small square in the figure represents the genetic distance between the first and last samples. The larger the value and the closer it is to blue, the more distant the relationship between the two individuals, and vice versa, indicating that the Suffolk sheep individuals are more distantly related.
[0065] 5. Genome-wide association analysis
[0066] The association analysis between SNPs and body weight traits was performed using the fastGWA-mlm model in the GCTA software V1.94.0beta.
[0067] y=X snp β snp +X c β c +g+e;
[0068] Where y is the phenotype vector; X snp is the genotype vector, whose effect is β snp ;X c is the correlation matrix with sex, measurement year and the first five PCAs as fixed covariates, and the corresponding coefficient is β c ; g is the vector of total genetic effects captured by the SNP-derived genetic relationship matrix, g~N(0, ); π is the genetic relationship matrix vector derived from SNPs, where all off-diagonal elements are set to 0; e is the residual vector, e~N(0, ).
[0069] Because the Bonferroni correction method is used, the significance threshold of 0.05 / number of SNPs is too strict to determine the significance threshold of GWAS. After the linkage disequilibrium (LD) screening is performed to remove redundancy, independent SNPs are obtained and used to calculate the threshold. The parameters are 50: window size, i.e., number of SNPs; 10: step length, i.e., number of SNPs; 0.2: r 2 value, delete one of the SNP pairs with LD greater than 0.2. The threshold for genome-wide significant association was adjusted to P=1 / 620054, where 620054 is the number of independent SNPs that have been screened by LD. The genomic expansion factor of the test statistic, λ, was calculated by the slope of the linear regression between the observed quantile and the theoretical quantile in R version V3.6.0. After calculation, the λ value of the weight trait was 1.033, indicating that there was no genomic expansion. Based on the resequencing data of 300 Suffolk sheep, 75 significant SNP sites associated with the waist muscle area trait were detected. These sites were located on chromosomes 1, 2, 3, 6, 9, 14, 17, and 21, and gene annotation and enrichment analysis were performed on the significant SNPs. LOC105603993 Gene ID: 105603993 is associated with the sheep psoas muscle area trait, as shown in Table 2 and Figure 5 shown.
[0070] Table 2 Significant SNPs associated with lumbar muscle area traits
[0071]
[0072] Table 2 continued
[0073]
[0074] Table 2 continued
[0075]
[0076] Note: “-” in the table means no such item.
[0077] six, LOC105603993 Gene haplotype combination construction
[0078] Data statistics and analysis were performed based on the significant SNP sites obtained from GWAS. According to the calculation principles of parameters such as allele frequency, genotype frequency, homozygosity and heterozygosity, Excel functions were written to calculate population genetic parameters and test whether the significant SNPs conformed to the Hardy-Weinberg equilibrium, as shown in Table 3. Haplotypes were then constructed using Haploview software and it was found that the genotype on chromosome 21 was LOC105603993Seven SNPs at 13505215bp, 13505291bp, 13506045bp, 13506244bp, 13506983bp, 13508428bp and 1351395bp of the gene constitute a haplotype block, and the seven SNPs are marked as LOC105603993 -SNP1~ LOC105603993 -SNP7, this domain block includes six haplotypes, named H1, H2, H3, H4, H5, and H6, as shown in Table 4 and Figure 6 shown.
[0079] Table 3 Area characteristics of loin muscle of Suffolk sheep LOC105603993 Intragenic SNPs population genetic parameters
[0080]
[0081] Table 4 LOC105603993 Construction of different haplotypes of genes
[0082]
[0083] seven, LOC105603993 Association analysis between gene haplotype combinations and loin muscle area traits in Suffolk sheep
[0084] SAS9.2 software was used to analyze the relationship between haplotype combinations and lumbar muscle area traits in individuals. Table 5 lists LOC105603993 -SNP1~ LOC105603993 -Statistics of loin muscle area in Suffolk sheep under the haplotype combination of SNP7 gene. LOC105603993 -SNP1~ LOC105603993 -The lumbar muscle area of the H1H1 haplotype combination of the SNP7 gene is significantly higher than that of the H2H2 combination, P <0.05, see Table 5. Therefore, select LOC105603993 Gene H1H1, that is LOC105603993 - The genotype of SNP1 at 13505215bp on chromosome 21 is TT, LOC105603993 - The genotype of SNP2 at 13505291bp on chromosome 21 is AA, LOC105603993 - The genotype of SNP3 at 13506045bp on chromosome 21 is GG, LOC105603993 - The genotype of SNP4 at 13506244bp on chromosome 21 is AA, LOC105603993 - The genotype of SNP5 at 13506983bp on chromosome 21 is CC, LOC105603993 - The genotype of SNP6 at 13508428bp on chromosome 21 is TT and LOC105603993When the genotype of SNP7 at 1351395 bp on chromosome 21 is CC, the haplotype combination composed of the genotypes of the seven SNP sites is TTAAGGAACCTTCC, which is used as a screening marker for screening Suffolk sheep with excellent psoas muscle area traits.
[0085] Table 5 LOC105603993 Loin muscle area of Suffolk sheep under different haplotype combinations
[0086]
[0087] Note: Different letters indicate significant differences when performing variance analysis between haplotype combinations with "H". P <0.05, the same letter indicates no significant difference P >0.05.
[0088] In summary, the present invention provides a method for analyzing the relationship between the area of the loin muscle of Suffolk sheep. LOC105603993 -SNP1~ LOC105603993 -SNP7 site, LOC105603993 - The genotype of SNP1 at 13505215bp on chromosome 21 is TT, LOC105603993 - The genotype of SNP2 at 13505291bp on chromosome 21 is AA, LOC105603993 - The genotype of SNP3 at 13506045bp on chromosome 21 is GG, LOC105603993 - The genotype of SNP4 at 13506244bp on chromosome 21 is AA, LOC105603993 - The genotype of SNP5 at 13506983bp on chromosome 21 is CC, LOC105603993 - The genotype of SNP6 at 13508428bp on chromosome 21 is TT and LOC105603993 When the genotype of SNP7 at 1351395bp on chromosome 21 is CC, and the haplotype combination formed by the genotypes of the seven SNP sites is TTAAGGAACCTTCC, this combination can be used as a screening marker for screening or detecting Suffolk sheep with excellent psoas muscle area traits; in addition, Suffolk sheep individuals with the haplotype combination of TTAAGGAACCTTCC can be selected as sires or dams to increase the psoas muscle area trait of offspring Suffolk sheep.
[0089] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments.
[0090] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0091] The above-described embodiments merely represent several implementation methods of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the patent. A person skilled in the art would be able to make various modifications and improvements without departing from the spirit of the present invention, and these modifications and improvements fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be based on the appended claims.
Claims
1. A typing detection reagent for a haplotype molecular marker affecting sheep psoas muscle area trait in identifying sheep psoas muscle area trait, characterized in that: The haplotype molecular markers include LOC105603993 -SNP1~ LOC105603993 -SNP7 has 7 sites in total; in, LOC105603993 -SNP1 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.1, where a T-to-G mutation occurs; LOC105603993 -SNP2 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.2, where a mutation from A to C occurs; LOC105603993 -SNP3 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.3, where a G to T mutation occurs; LOC105603993 -SNP4 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO. 4, where an A to T mutation occurs; LOC105603993 -SNP5 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.5, where a C to T mutation occurs; LOC105603993 -SNP6 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.6, where a T-to-C mutation occurs; LOC105603993 -SNP7 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.7, where a C to T mutation occurs; The sheep are Suffolk sheep.
2. The use according to claim 1, characterized in that Described identification sheep psoas muscle area trait comprises the following steps: Extract genomic DNA from sheep blood; The genomic DNA is fragmented to obtain DNA fragments, and then a library is constructed using the DNA fragments. The library is sequenced to obtain sequencing data; The sequencing data were used to identify and screen the variant sites, and the haplotype molecular markers of sheep were detected using genome-wide association analysis. LOC105603993 - The genotype of SNP1 at 101 bp of the nucleotide sequence shown in SEQ ID NO.1 is TT, LOC105603993 - The genotype of SNP2 at 101 bp of the nucleotide sequence shown in SEQ ID NO.2 is AA, LOC105603993 - The genotype of SNP3 at 101 bp of the nucleotide sequence shown in SEQ ID NO.3 is GG, LOC105603993 - The genotype of SNP4 at 101 bp of the nucleotide sequence shown in SEQ ID NO.4 is AA, LOC105603993 - The genotype of SNP5 at 101 bp of the nucleotide sequence shown in SEQ ID NO.5 is CC, LOC105603993 - The genotype of SNP6 at 101 bp of the nucleotide sequence shown in SEQ ID NO.6 is TT and LOC105603993 -When the genotype of SNP7 at 101 bp of the nucleotide sequence shown in SEQ ID NO. 7 is CC, and the haplotype combination composed of the genotypes of the seven SNP sites is TTAAGGAACCTTCC, the waist muscle area of the sheep is larger than that of the haplotype combination GTCATGTATCCTTC and the haplotype combination GGCCTTTTTTCCTT.
3. The use according to claim 2, characterized in that The length of the DNA fragment is 320 bp to 380 bp.
4. The use according to claim 2, characterized in that The threshold for the genome-wide association analysis was set to P = 1 / 620054.
5. The use of the typing detection reagent for the haplotype molecular marker affecting the sheep psoas muscle area trait as claimed in claim 1 in the genetic breeding of the sheep psoas muscle area trait, characterized in that: The sheep are Suffolk sheep.
6. The use according to claim 5, characterized in that By selecting individuals with the haplotype combination TTAAGGAACCTTCC as parents, the psoas muscle area of the offspring can be increased.