Novel pore protein BCP34 as well as mutant and application thereof

Abstract

The invention provides a novel pore protein BCP34 as well as a mutant and application thereof. Specifically, the wild type pore protein BCP34 is a nonaglymer protein, and the amino acid sequence of a monomer of the wild type pore protein BCP34 is SEQ ID NO: 1; the mutant of the pore protein BCP34 monomer comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95% or at least 99% identity with SEQ ID NO: 1, and an amino acid sequence having mutation at one or more positions in a sensor region, a transmembrane region, an inlet, a barrel inner wall and an outlet of a wild type pore protein BCP34 monomer. The wild type pore protein BCP34 provided by the invention has the capability of being applied to nanopore sequencing, and the pore protein BCP34 mutant obtained by optimization has higher library capture capability and nanopore sequencing accuracy.

Description

Novel porin BCP34, its mutants and applications Technical Field

[0001] The present invention relates to the field of nanopore sequencing technology, and in particular to a novel porin BCP34, a mutant thereof and applications thereof. Background Art

[0002] Nanopore sequencing, a newly emerging third-generation sequencing technology, has revolutionized the gene sequencing industry with its advantages of long read length, high throughput, low cost, and portability. This technology has broad applications in fundamental life science research and biomedical clinical practice. Nanopore sequencing is an electrical signal-based sequencing technology that can be applied to DNA, RNA, and protein sequencing. It achieves sequencing by recording the continuous electrical signal generated by the passage of analytes through nanopore proteins in real time, then analyzing and converting it into sequence information.

[0003] Oxford Nanopore Technologies in the UK has developed a series of nanopore sequencers, including the MinION, GridION, and PromethION. Qi Carbon Technology has also developed the QNome-3841 nanopore sequencer. However, these technologies still have significant shortcomings in sequencing accuracy, throughput, and chip stability, failing to meet the ultimate requirements of molecular biology research. Therefore, a single-molecule sequencer with high accuracy, high integration, and high stability is needed in this field.

[0004] Nanopore sequencing requires a sufficiently sharp sensor region within the pore protein to achieve high spatial resolution in both the lateral and longitudinal directions. Among the pore proteins studied, three main categories hold potential for sequencing: pore-forming toxins produced by bacteria or other organisms that disrupt cell membrane permeability; transporter proteins that serve as pathways for the transport of various biomolecules, both macromolecules and small molecules, within and outside the cell; and viral connectors that provide a pathway for viral genome transport during host infection. Currently, only a few naturally occurring proteins, such as the Mycobacterium smegmatis porin A (MspA) and the curli-specific transporter (CsgG), meet sequencing requirements. However, in in vitro recombinant protein expression and purification systems, the pore stability of recombinant nanopore proteins may not meet the requirements of single-molecule detector instrumentation. Finding more nanopore proteins that meet sequencing requirements remains an unresolved challenge.

[0005] Summary of the Invention

[0006] The purpose of the present invention is to provide a novel porin BCP34 and its mutants, and to use the porin BCP34 and its mutants for nanopore sequencing and other related applications.

[0007] In a first aspect, the present invention provides a porin monomer, wherein the porin monomer is a protein having an amino acid sequence as shown in SEQ ID NO: 1 or a mutant thereof having the function of a porin monomer.

[0008] In a second aspect, the present invention provides a construct comprising 7-11 porin monomers according to the first aspect; preferably, the construct comprises 9 porin monomers according to the first aspect.

[0009] In a third aspect, the present invention provides a protein pore comprising 7-11 porin monomers according to the first aspect; preferably, the protein pore comprises 9 porin monomers according to the first aspect.

[0010] In a fourth aspect, the present invention provides a membrane having the protein pore according to the third aspect.

[0011] In a fifth aspect, the present invention provides a complex for characterizing a target analyte, wherein the complex comprises the protein pore according to the third aspect and a rate-controlling protein used in conjunction therewith.

[0012] In a sixth aspect, the present invention provides a nucleic acid encoding the porin monomer of the first aspect, the construct of the second aspect, the protein pore of the third aspect, or the complex of the fifth aspect.

[0013] In a seventh aspect, the present invention provides a vector or a host cell comprising the nucleic acid according to the sixth aspect.

[0014] In an eighth aspect, the present invention provides a method for producing a protein pore or a polypeptide thereof, comprising transforming a host cell with the vector of the seventh aspect, and inducing the host cell to express the protein pore or the polypeptide thereof.

[0015] In a ninth aspect, the present invention provides a method for determining the presence, absence, or one or more characteristics of a target analyte, the method comprising:

[0016] a. contacting the target analyte with the protein pore on the membrane of the fourth aspect, or the complex or the protein pore in the complex of the fifth aspect, so that the target analyte moves relative to the protein pore;

[0017] b. Taking one or more measurements as the target analyte moves relative to the protein pore to determine the presence, absence, or one or more characteristics of the target analyte.

[0018] In the tenth aspect, the present invention provides a kit for determining the presence, absence or one or more characteristics of a target analyte, the kit comprising the construct of the second aspect, the protein pore of the third aspect, the membrane of the fourth aspect, the complex of the fifth aspect, the nucleic acid of the sixth aspect or the vector or host cell of the seventh aspect.

[0019] In an eleventh aspect, the present invention provides a device for determining the presence, absence or one or more characteristics of a target analyte, the device comprising the protein pore of the third aspect, the membrane of the fourth aspect, or the complex of the fifth aspect.

[0020] By adopting the above scheme, the beneficial effects of the present invention are as follows: the wild-type porin BCP34 has very low protein sequence homology with the prior art and has the ability to be applied to nanopore sequencing; the porin BCP34 mutant obtained by optimization has higher library capture capacity and nanopore sequencing accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 shows a side view of the predicted structure of BCP34.

[0022] FIG2 shows a top view of the predicted structure of BCP34.

[0023] FIG3 shows a schematic diagram of the sensor region of the predicted structure of BCP34.

[0024] FIG4 shows a schematic diagram of important amino acid residues in the sensor region of the predicted structure of BCP34.

[0025] FIG5 shows a schematic diagram of four membrane-facing charged and polar amino acid residues in the transmembrane region of the predicted structure of BCP34.

[0026] FIG6 shows a schematic diagram of key amino acid residues in the entrance region of the predicted structure of the BCP34 monomer.

[0027] FIG7 shows a schematic diagram of the charge distribution in the entrance region of the predicted structure of BCP34.

[0028] FIG8 shows a schematic diagram of key amino acid residues in the barrel inner wall and exit region in the predicted structure of the BCP34 monomer.

[0029] FIG9 shows an SDS-PAGE image of BCP34 after purification in an example of the present invention.

[0030] FIG10 shows a schematic diagram of the sequencing library structure in an embodiment of the present invention, wherein a: sense strand; b: antisense strand; c: double-stranded target fragment to be tested; d: helicase BCH105; e: single-stranded DNA with cholesterol.

[0031] FIG11 shows the nanopore biosensing current of wild-type BCP34 when voltages of 0.02 V, 0.04 V, 0.10 V, 0.14 V, and 0.18 V are applied in accordance with an embodiment of the present invention.

[0032] FIG12 shows the nanopore biosensing current of BCP34 mutant 1 when voltages of 0.02 V, 0.04 V, 0.10 V, 0.14 V and 0.18 V are applied according to an embodiment of the present invention.

[0033] FIG13 shows the current trace changes of library DNA passing through BCP34 mutant 1 under an applied voltage of 0.14 V in an embodiment of the present invention.

[0034] FIG. 14 shows local details of the current trace when BCP34 mutant 1 performs DNA sequencing under an applied voltage of 0.14 V in an embodiment of the present invention.

[0035] FIG15 shows the capture results of QCDNA by two porins, wherein FIG15A shows the capture results of QCDNA by BCP34 mutant 1 porin, and FIG15B shows the capture results of QCDNA by the prior art nanoporin CSGG-Y51A / F56Q. DETAILED DESCRIPTION

[0036] Hereinafter, the present invention will be described in detail with reference to the accompanying drawings. It should be understood that the following description is merely illustrative of the present invention and is not intended to limit the scope of the present invention. The scope of protection of the present invention shall be subject to the appended claims. Furthermore, those skilled in the art will appreciate that the technical solutions of the present invention may be modified without departing from the spirit and purpose of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0037] Unless otherwise specified, the scientific and technical terms used in this application have the meanings commonly understood by those skilled in the art. In order to better understand the present invention, the following definitions and explanations of relevant terms are provided.

[0038] The term "comprising" means that any listed elements must be included and other elements may also be optionally included. "Consisting of" means that all unlisted elements are excluded. Embodiments defined by each of these terms are within the scope of the present invention.

[0039] "One or more positions" refers to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ... or all positions. For example, one or more positions of 5 amino acids means 1, 2, 3, 4 or 5 positions.

[0040] The term "wild-type" refers to a gene or gene product isolated from a naturally occurring source.

[0041] The term "amino acid" is used in its broadest sense and is meant to include organic compounds containing amine (NH2) and carboxyl (COOH) functional groups and side chains (eg, R groups) that are unique to each amino acid.

[0042] The terms "protein," "polypeptide," and "peptide" are used interchangeably herein to refer to polymers of amino acid residues, as well as variants and synthetic analogs of amino acid residues. Thus, these terms apply to amino acid polymers in which one or more amino acid residues is a synthetic non-naturally occurring amino acid, such as a chemical analog of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. Polypeptides may also undergo maturation or post-translational modification processes, which may include, but are not limited to, glycosylation, proteolytic cleavage, lipidation, signal peptide cleavage, propeptide cleavage, phosphorylation, and the like.

[0043] The term "nucleic acid" refers to a single-stranded or double-stranded covalently linked sequence of nucleotides, wherein the 3' and 5' ends of each nucleotide are linked by a phosphodiester bond. Nucleic acids can include DNA and RNA and can be synthesized in vitro or isolated from natural resources. The length of a nucleic acid is usually expressed in terms of the number of base pairs for double-stranded polynucleotides, or in terms of the number of nucleotides in the case of single-stranded polynucleotides. Polynucleotides with a length of less than about 40 nucleotides are usually referred to as "oligonucleotides." The term "polynucleotide" refers to a macromolecule comprising two or more nucleotides, which can be single-stranded or double-stranded. The polynucleotide or nucleic acid can comprise any combination of any nucleotides. The nucleotides can be naturally occurring or artificially synthesized.

[0044] The term "sequence identity" refers to the degree to which the sequences are identical based on nucleotide or amino acid sequence by nucleotide in a comparison window. "Percentage sequence identity" can be calculated in the following manner: two sequences are compared in a comparison window, the number of positions in which identical nucleic acid bases (e.g., A, T, C, G, U) or identical amino acid residues (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys, and Met) are present in the two sequences is determined to obtain the number of matching positions, the number of matching positions is divided by the total number of positions in the comparison window (i.e., window size), and the result is multiplied by 100% to obtain "percentage sequence identity". In order to calculate "percentage sequence identity", it can be achieved in a variety of ways known in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software, those skilled in the art can determine the appropriate parameters for aligning sequences. When screening protein mutants, obtaining an amino acid sequence that has at least a certain percentage (such as 75%, 80%, 85%, 90%, 95% or 99%) identity with the wild-type protein sequence is a common approach in the art.

[0045] The term "construct" refers to a genetic vector that contains a specific nucleic acid sequence and is capable of transferring the target nucleic acid sequence into a host cell to obtain a recombinant cell. According to embodiments of the present invention, the form of the construct is not particularly limited and includes, but is not limited to, at least one of a plasmid, a phage, an artificial chromosome, a cosmid, and a virus, preferably a plasmid.

[0046] The term "protein pore" is a transmembrane protein structure that defines a channel or pore that allows molecules and ions to translocate from one side of the membrane to the other. A "nanopore" is a protein pore in which the minimum diameter of the channel through which a molecule or ion passes is on the order of nanometers (10 -9 The protein pore can be a transmembrane protein pore. The transmembrane protein structure of the protein pore can be monomeric or oligomeric in nature. Typically, the pore comprises a plurality of polypeptide subunits arranged around a central axis, thereby forming a protein-lined channel extending substantially perpendicular to the membrane in which the nanopore resides.

[0047] The term "rate-controlling protein" refers to a protein that can control the speed (e.g., slow down) of a target analyte (e.g., a polynucleotide) relative to a protein pore, thereby enabling detection of the presence, absence, or one or more characteristics of the target analyte (e.g., sequencing of the polynucleotide). The protein pore and rate-controlling protein are used in conjunction to characterize the target analyte. In one embodiment, the rate-controlling protein slows the speed at which the polynucleotide passes through the protein pore, thereby enabling sequencing.

[0048] The term "amphiphilic molecule" refers to a molecule having at least one hydrophilic portion and at least one lipophilic portion, for example, phospholipids have both hydrophilic and lipophilic properties.

[0049] As mentioned above, the present invention aims to provide a novel porin BCP34 and its mutants. Porin BCP34 is a nonameric protein, and its monomer sequence was mined from the metagenomic database of the Mariana Trench at a depth of 11,000 meters. The amino acid sequence of the wild-type porin BCP34 monomer is SEQ ID NO: 1, and the DNA sequence is SEQ ID NO: 2. The sequence shown in SEQ ID NO: 1 is MKRFIAFAVSMTLVGCASFSPPKGQTSIRDRAQPLSATVTRNALTKLPPPLAPIPAAVYNIKDQTGQYKPSPSNGFSTAVMQGATSVLVKALLDSRWFIPLEREGL QNLLTERKIIRARDSKKDLSNLAAASVIIEGSIIAYDSNVRTGGAGAKYLGIGLSEQYREDQVTVNLRAINVNNGRILQSVTSTKMIFSRQLDSGAFGYIRFKKLLEIESGYSYNEPAQLCVIDAIESALIQLIYEGVVGGTWKLKNPADIDSPIFTHYAGQNGPEGQAIM.The sequence shown in SEQ ID NO: 2 is.

[0050] Therefore, in a first aspect, the present invention provides a porin monomer, wherein the porin monomer is a protein having an amino acid sequence as shown in SEQ ID NO: 1 or a mutant thereof having the function of a porin monomer.

[0051] In one embodiment, the mutant is an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95% or at least 99% identity to the amino acid sequence of SEQ ID NO: 1 and having the function of a porin monomer, or an amino acid sequence having mutations in one or more positions in the sensor region (S71, N74, G75, F76), transmembrane region (E162, R196, S200, S216), inlet, barrel inner wall and outlet (K62, D63, R103, E104, E112, R113, K114, R117, R119, D120, K122, D124, K154, R165, D199, R207, K209, K210, E213, E215) of the porin BCP34 monomer; preferably, the mutations include:

[0052] Sensor area:

[0053] Mutations at position S71 include mutations to G, A, or T;

[0054] Mutations at position N74 include mutations to G, A, S, or T;

[0055] Mutations at position G75 include mutations to A, S, T, N, or Q;

[0056] Mutations at position F76 include mutations to G, A, S, T, N, or Q;

[0057] Transmembrane region:

[0058] Mutations at position E162 include mutations to A, G, V, L, I, Y, F, or W;

[0059] Mutations at position R196 include mutations to A, G, V, L, I, Y, F, or W;

[0060] Mutations at position S200 include mutations to A, G, V, L, I, Y, F, or W;

[0061] Mutations at position S216 include mutations to A, G, V, L, I, Y, F, or W;

[0062] Entrance:

[0063] Mutations at position K62 include mutations to A, G, S, T, N, or Q;

[0064] Mutations at position D63 include mutations to K, R, A, G, S, T, N, or Q;

[0065] Mutations at position R103 include mutations to A, G, S, T, N, or Q;

[0066] Mutations at position E104 include mutations to K, R, A, G, S, T, N, or Q;

[0067] Mutations at position E112 include mutations to K, R, A, G, S, T, N, or Q;

[0068] Mutations at position R113 include mutations to A, G, S, T, N, or Q;

[0069] Mutations at position K114 include mutations to A, G, S, T, N, or Q;

[0070] Mutations at position R117 include mutations to A, G, S, T, N, or Q;

[0071] Mutations at position R119 include mutations to A, G, S, T, N, or Q;

[0072] Mutations at position D120 include mutations to K, R, A, G, S, T, N, or Q;

[0073] Mutations at position K122 include mutations to A, G, S, T, N, or Q;

[0074] Mutations at position D124 include mutations to K, R, A, G, S, T, N, or Q;

[0075] Inner wall of barrel:

[0076] Mutations at position K154 include mutations to A, G, S, T, N, or Q;

[0077] Mutations at position R165 include mutations to A, G, S, T, N, or Q;

[0078] Mutations at position D199 include mutations to A, G, S, T, N, or Q;

[0079] Mutations at position E213 include mutations to A, G, S, T, N, or Q;

[0080] Mutations at position E215 include mutations to A, G, S, T, N, or Q;

[0081] Exit:

[0082] Mutations at position R207 include mutations to A, G, S, T, N, Q, D, or E;

[0083] Mutations at position K209 include mutations to A, G, S, T, N, Q, D, or E;

[0084] Mutations at the K210 position include mutations to A, G, S, T, N, Q, D or E.

[0085] In the present invention, wild-type BCP34 refers to a nonameric protein composed of protein monomers with the amino acid sequence shown in SEQ ID NO: 1, and a BCP34 mutant refers to a protein containing mutant protein monomers. The BCP34 mutant can be a heptamer, an octamer, a nonamer, a decamer, or an undemer. The number of mutant protein monomers in the mutant is not limited. For example, a heptamer BCP34 mutant can include 3 wild-type protein monomers and 4 mutant protein monomers; or, a decamer BCP34 mutant can include 5 wild-type protein monomers and 5 mutant protein monomers.

[0086] In a second aspect, the present invention provides a construct comprising 7-11 porin monomers according to the first aspect; preferably, the construct comprises 9 porin monomers according to the first aspect.

[0087] In a third aspect, the present invention provides a protein pore comprising 7-11 porin monomers according to the first aspect; preferably, the protein pore comprises 9 porin monomers according to the first aspect.

[0088] In one embodiment, the porin monomers in the construct and protein pore are linked covalently or polymerized non-covalently.

[0089] In a fourth aspect, the present invention provides a membrane having the protein pore according to the third aspect.

[0090] In one embodiment, the membrane is an amphiphilic layer, ie a monolayer or a bilayer formed from amphiphilic molecules.

[0091] In a preferred embodiment, the amphiphilic molecule is a phospholipid.

[0092] In a fifth aspect, the present invention provides a complex for characterizing a target analyte, wherein the complex comprises the protein pore according to the third aspect and a rate-controlling protein used in conjunction therewith.

[0093] In a sixth aspect, the present invention provides a nucleic acid encoding the porin monomer of the first aspect, the construct of the second aspect, the protein pore of the third aspect, or the complex of the fifth aspect.

[0094] In a seventh aspect, the present invention provides a vector or a host cell comprising the nucleic acid according to the sixth aspect.

[0095] In an eighth aspect, the present invention provides a method for producing a protein pore or a polypeptide thereof, comprising transforming a host cell with the vector of the seventh aspect, and inducing the host cell to express the protein pore or the polypeptide thereof.

[0096] In a ninth aspect, the present invention provides a method for determining the presence, absence, or one or more characteristics of a target analyte, the method comprising:

[0097] a. contacting the target analyte with the protein pore on the membrane of the fourth aspect, or the complex or the protein pore in the complex of the fifth aspect, so that the target analyte moves relative to the protein pore;

[0098] b. Taking one or more measurements as the target analyte moves relative to the protein pore to determine the presence, absence, or one or more characteristics of the target analyte.

[0099] In one embodiment, the target analyte interacts with the protein pore such that the target analyte moves relative to the protein pore.

[0100] In the tenth aspect, the present invention provides a kit for determining the presence, absence or one or more characteristics of a target analyte, the kit comprising the construct of the second aspect, the protein pore of the third aspect, the membrane of the fourth aspect, the complex of the fifth aspect, the nucleic acid of the sixth aspect or the vector or host cell of the seventh aspect.

[0101] In an eleventh aspect, the present invention provides a device for determining the presence, absence or one or more characteristics of a target analyte, the device comprising the protein pore of the third aspect, the membrane of the fourth aspect, or the complex of the fifth aspect.

[0102] The target analytes include, but are not limited to, polysaccharides, amino acids, peptides, nucleotides, oligonucleotides, polynucleotides, dyes, drugs, diagnostic agents, explosives, and environmental pollutants.

[0103] Example

[0104] It should be noted that the terms used in the description of the present invention are intended only to describe specific embodiments and are not intended to limit the present invention. The above summary of the invention and the detailed description below are intended only to illustrate the present invention and are not intended to limit the present invention in any way. Without departing from the spirit and purpose of the present invention, the scope of the present invention is determined by the appended claims.

[0105] Prediction of the structure of wild-type BCP34 using Alphafold2 multimer

[0106] The amino acid sequence of the wild-type porin BCP34 monomer was obtained from the Mariana Trench metagenomic database. The nonamer structure of wild-type BCP34 was predicted using Alphafold2 multimerization. The predicted structure is shown in Figures 1 and 2, which show the side view and top view of the BCP34 nonamer structure, respectively.

[0107] The amino acid composition of the sensor region may play a crucial role in generating current signals, so we investigated BCP34 mutants targeting the sensor region. Figures 3 and 4 show the side chain structures of key amino acids in the predicted BCP34 sensor region, showing the four amino acids in the side chains: S71, N74, G75, and F76.

[0108] The amino acids in the transmembrane region of porins tend to be hydrophobic, while charged and polar amino acids may affect pore insertion efficiency. Figure 5 shows the four membrane-facing charged and polar amino acids in the transmembrane region of BCP34: E162, R196, S200, and S216.

[0109] Because nucleic acids are negatively charged, positively charged amino acids at the porin entrance may increase the library capture rate for nanopore sequencing; conversely, negatively charged amino acids may reduce the library capture rate. Furthermore, the strength of library-porin binding may also affect sequencing speed and sequencing current signal. Figure 6 shows some key amino acids in the entrance region of the BCP34 monomer: K62, D63, R103, E104, E112, R113, K114, R117, R119, D120, K122, and D124. Figure 7 shows the charge distribution in the entrance region of the predicted BCP34 structure, demonstrating the presence of a significant positive charge in the entrance region of the BCP34 porin, a feature that supports enhanced library capture capabilities compared to existing technologies.

[0110] At the same time, some amino acids on the inner wall and outlet of the barrel may have a certain impact on the smooth penetration and exit of the analyte from the nanopore. Figure 8 shows some amino acids on the inner wall and outlet of the barrel of the BCP34 monomer that may affect the smooth penetration of the analyte, especially the charged amino acids, namely K154, R165, D199, R207, K209, K210, E213 and E215.

[0111] Construction of expression vectors for wild-type BCP34 and its mutant 1

[0112] The amino acid composition of the sensor region plays a decisive role in the generation of current signals during sequencing. Therefore, we constructed mutant 1 for the sensor region of the BCP34 monomer. The mutation sites are N74S, G75N, and F76A. The amino acid sequence is SEQ ID NO: 3, and the DNA sequence is SEQ ID NO: 4. The sequence shown in SEQ ID NO: 3 is MKRFIAFAVSMTLVGCASFSPPKGQTSIRDRAQPLSATVTRNALTKLPPPLAPIPAAVYNIKDQTGQYKPSPSSNASTAVMQGATSVLVKALLDSRWFIPLEREGLQNLLTERKIIRARDSKKDLSNLAAASVIIEGSIIAYDSNVRTGGAGAKYLGIGLSEQYREDQVTVNLRAINVNNGRILQSVTSTKMIFSRQLDSGAFGYIRFKKLLEIESGYSYNEPAQLCVIDAIESALIQLIYEGVVGGTWKLKNPADIDSPIFTHYAGQNGPEGQAIM.The sequence shown in SEQ ID NO: 4 is ATGAAGCGCTTTATTGCCTTTGCAGTTAGCATGACCCTGGTTGGTTGTGCAAGCTTTAGCCCGCCGAAAGGTCAGACCAGCATTCGTGATCGTGCACAGCCTCTGAGTGCAACCGTTACCCGTAATGCACTGACCAAACTGCCTCCTCCTCTGGCACCTATTCCGGCAGCAGTTTACAATATCAAGGATCAGACCGGTCAGTATAAACCGGCACCGGCAAGCAATCAGAGCACCGCAGTTATGCAGGGTGCAACCAGCGTTCTGGTTAAAGCATTACTGGATAGCCGTTGGTTTATTCCGCTGGAACGTGAAGGTCTGCAGAATCTGCTGACCGAACGCAAAATTATTCGTGCACGCGACAGCAAAAAAGATCTGAGCAATCTGGCAGCAGCAAGCGTTATTATTGAGGGTAGCATCATCGCCTATGATAGCAATGTTCGTACCGGTGGTGCAGGTGCAAAATATCTGGGTATTGGTCTGAGCGAACAGTATCGTGAAGATCAGGTTACCGTTAAT CTGCGCGCAATCAATGTTAACAACGGCCGTATTCTGCAGAGCGTTACCAGCACCAAAATGATTTTTAGCCGTCAGCTGGATAGCGGTGCATTTGGTTATATTCGCTTCAAGAAGCTGCTGGAGATTGAAAGCGGTTACAGCTATAATGAACCGGCACAGCTGTGTGTTATTGATGCAATTGAGAGCGCACTGATTCAGCTGATTTATGAGGGTGTTGTTGGTGGTACCTGGAAACTGAAAAATCCGGCCGATATTGATAGCCCGATCTTTACCCATTATGCCGGTCAGAATGGTCCTGAAGGTCAGGCAATTATGTAA. In this article, the nanosensor protein BCP34 mutant 1 refers to a nonamer composed of protein monomers with the amino acid sequence of SEQ ID NO: 3.,

[0113] Using an in-fusion method, the porin BCP34 DNA sequence was inserted into the multiple cloning region of the pET24a vector after digestion with NdeI and XhoI. A StrepII amino acid tag was added to the C-terminus of the wild-type BCP34 amino acid sequence (SEQ ID NO: 1) as a purification tag. The selection tag was kanamycin. The constructed vector was named pET24a-BCP34. Mutant 1 was constructed using an Agilent site-directed mutagenesis kit and the porin BCP34 expression vector as a template.

[0114] Cultivation and induction of wild-type BCP34 and its mutant 1 strain

[0115] The constructed wild-type BCP34 or mutant 1 expression plasmid was transformed into the E. coli BL21(DE3) expression strain. The bacterial suspension was evenly spread on a plate containing 50 μg / mL kanamycin and cultured overnight at 37°C. The next day, a single colony was picked and incubated in 5 mL of LB medium containing 50 μg / mL kanamycin at 37°C, 200 rpm, and incubated overnight. The resulting bacterial suspension was inoculated at a ratio of 1:100 into 50 mL of LB medium containing 50 μg / mL kanamycin and incubated at 37°C, 200 rpm, for 4 hours. The expanded culture was inoculated at a ratio of 1:100 into 2 L of LB medium containing 50 μg / mL kanamycin and incubated at 37°C, 200 rpm. When the OD600 value reached approximately 0.6-0.8, IPTG was added to a final concentration of 0.5 mM and the culture was incubated at 16°C, 200 rpm, for approximately 16-18 hours. The bacterial solution was collected by centrifugation at 8000 rpm and the bacteria were frozen at -20°C until use.

[0116] Extraction and purification of recombinant wild-type BCP34 and its mutant 1 protein

[0117] Purification Buffer preparation:

[0118] Buffer A: 20mM Tris-HCl, 250mM NaCl, 1% DDM, pH 8.0.

[0119] Buffer B: 20mM Tris-HCl, 250mM NaCl, 0.05% DDM, pH 8.0.

[0120] Buffer C: 20 mM Tris-HCl, 250 mM NaCl, 0.05% DDM, 5 mM desthiobiotin, pH 8.0.

[0121] Purification steps:

[0122] Resuspend 1 g of cells in 10 mL of Buffer A. Disrupt the cells by sonication until the solution is clear. Rotate overnight at 4°C. The next day, centrifuge at 18,000 rpm for 1 hour at 4°C. Remove the supernatant, filter through a 0.22 μm filter, and store at 4°C until ready for use.

[0123] A Strep-Tactin beads (IBA Lifesciences) column was equilibrated with Buffer A for 5 CV using an AKTA pure chromatography instrument and loaded with sample at 2 mL / min. After loading, the column was washed with Buffer B for 20 CV and eluted with Buffer C to collect the target protein.

[0124] The resulting protein was concentrated to 1 mL and passed through a Superdex 6 increase 10 / 300GL (Cytiva) column equilibrated with Buffer B. The protein was collected and stored at -80°C for subsequent nanopore sequencing experiments. Figure 9 shows an SDS-PAGE image of the purified BCP34. Lanes 2 and 3 show the gel bands after uncooking and 95°C cooking, respectively. The results show that the target protein is in an aggregated state before cooking and in a monomeric state after cooking.

[0125] Library construction

[0126]

[0127] Construction of nanopore biosensors using wild-type BCP34 and its mutant 1

[0128] Single-channel nanopore current measurement is based on an amplifier in a digital device. Ag / AgCl electrodes are immersed in sequencing buffer (0.47M KCl, 25mM HEPES, 1mM EDTA, 5mM ATP, 25mM MgCl2, pH 7.6) and positioned in the cis and trans regions of the electrolytic cell, respectively. The sequencing library and nanopore reagents are added to the cis region. After the nanopore protein is diluted to a predetermined multiple in 1xPBS buffer, a single nanopore is inserted into a phospholipid bilayer composed of diacylphosphatidylcholine (DPhPC) under an applied electric field to form a nanopore biosensor. An applied voltage is applied to obtain the current amplitude of a single porin. Figures 11 and 12 show the nanopore biosensor currents of wild-type BCP34 and mutant 1 when voltages of 0.02 V, 0.04 V, 0.10 V, 0.14 V, and 0.18 V were applied, respectively. The results show that the pore opening current noise of wild-type BCP34 is very large, while the pore opening current noise of mutant 1 is very small, indicating that the mutation in the sensor region can effectively reduce the pore opening current noise.

[0129] DNA sequencing using wild-type BCP34 and its mutant 1

[0130] A sequencing library containing the pUC57 sequence and cholesterol-laden single-stranded DNA (SEQ ID NO: 9) were mixed with sequencing buffer and added to the nanopore biosensor. Upon application of an external voltage of 0.14V or 0.18V, DNA was observed to be captured by the nanopore, generating a characteristic retarded current amplitude. As the DNA moved through the nanopore, the current amplitude varied. Different DNA sequences produced different retarded current amplitudes. The cholesterol-laden single-stranded DNA can bind to the phospholipid bilayer, facilitating nanopore capture of the sequencing library and reducing the amount of sequencing library loaded.

[0131] Under an applied voltage of 0.14V, the current trace changes of library DNA passing through wild-type BCP34 were too noisy to be discerned. The current trace changes of library DNA passing through Mutant 1 are shown in Figure 13, demonstrating that Mutant 1 effectively reduces sequencing current noise. Figure 14 shows a detailed current trace of Mutant 1 during DNA sequencing. The results indicate that mutations in the porin BCP34 sensor region can improve the properties of nanopore sequencing currents and have the potential to increase sequencing accuracy.

[0132] BCP34 mutant 1 has stronger library capture ability than existing technologies

[0133] Nanopores were embedded in the nanopores of the nanopore protein BCP34 mutant 1 and the prior art porin CSGG-Y51A / F56Q. After embedding, individual pores were selected based on the opening current. 3 μl of 10 μM QcDNA (SEQ ID NO: 10) was added to the cis region of the electrolytic cell. The sequence of SEQ ID NO: 10 is TTTTTTTTTTGGTGGTGTGGTTGG. QcDNA can form a G4 structure, which can be pulled apart under the action of an electric field. Upon application of an external voltage of 0.14 V, QcDNA was observed to be captured by the nanopore, generating a retarding current. After the QcDNA completely passed through the nanopore, the current returned to the opening current, indicating the capture of new QcDNA. Figure 15A shows the capture of QcDNA by the nanopore protein BCP34 mutant 1 at a voltage of 0.14 V; Figure 15B shows the capture of QcDNA by the prior art nanopore protein CSGG-Y51A / F56Q at a voltage of 0.14 V. It can be seen that the capture ability of BCP34 mutant 1 for QCDNA is significantly stronger than that of the porin CSGG-Y51A / F56Q in the prior art.

[0134] Given the strong capture ability of the porin BCP34 mutant 1 for libraries, its use in nanopore sequencing has the potential to increase sequencing throughput or reduce library loading compared to existing technologies.

[0135] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A porin monomer, characterized in that The porin monomer is a protein with an amino acid sequence as shown in SEQ ID NO: 1 or a mutant thereof having the function of a porin monomer.

2. The porin monomer according to claim 1, characterized in that The mutant is an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95% or at least 99% identical to the amino acid sequence of SEQ ID NO: 1 and has the function of a porin monomer.

3. The porin monomer according to claim 1, characterized in that The mutant comprises amino acid mutations at one or more positions corresponding to S71, N74, G75 and F76 of SEQ ID NO: 1; preferably, Mutations at position S71 include mutations to G, A, or T; Mutations at position N74 include mutations to G, A, S, or T; Mutations at position G75 include mutations to A, S, T, N, or Q; Mutations at position F76 include mutations to G, A, S, T, N, or Q.

4. The porin monomer according to claim 1, characterized in that The mutant comprises a mutation of an amino acid at one or more positions corresponding to E162, R196, S200 and S216 of SEQ ID NO: 1; preferably, Mutations at position E162 include mutations to A, G, V, L, I, Y, F, or W; Mutations at position R196 include mutations to A, G, V, L, I, Y, F, or W; Mutations at position S200 include mutations to A, G, V, L, I, Y, F, or W; Mutations at position S216 include mutations to A, G, V, L, I, Y, F or W.

5. The porin monomer according to claim 1, characterized in that The mutant comprises a mutation of an amino acid at one or more positions corresponding to K62, D63, R103, E104, E112, R113, K114, R117, R119, D120, K122, D124, K154, R165, D199, R207, K209, K210, E213 and E215 of SEQ ID NO: 1; preferably, Mutations at position K62 include mutations to A, G, S, T, N, or Q; Mutations at position D63 include mutations to K, R, A, G, S, T, N, or Q; Mutations at position R103 include mutations to A, G, S, T, N, or Q; Mutations at position E104 include mutations to K, R, A, G, S, T, N, or Q; Mutations at position E112 include mutations to K, R, A, G, S, T, N, or Q; Mutations at position R113 include mutations to A, G, S, T, N, or Q; Mutations at position K114 include mutations to A, G, S, T, N, or Q; Mutations at position R117 include mutations to A, G, S, T, N, or Q; Mutations at position R119 include mutations to A, G, S, T, N, or Q; Mutations at position D120 include mutations to K, R, A, G, S, T, N, or Q; Mutations at position K122 include mutations to A, G, S, T, N, or Q; Mutations at position D124 include mutations to K, R, A, G, S, T, N, or Q; Mutations at position K154 include mutations to A, G, S, T, N, or Q; Mutations at position R165 include mutations to A, G, S, T, N, or Q; Mutations at position D199 include mutations to A, G, S, T, N, or Q; Mutations at position R207 include mutations to A, G, S, T, N, Q, D, or E; Mutations at position K209 include mutations to A, G, S, T, N, Q, D, or E; Mutations at position K210 include mutations to A, G, S, T, N, Q, D, or E; Mutations at position E213 include mutations to A, G, S, T, N, or Q; Mutations at position E215 include mutations to A, G, S, T, N, or Q.

6. A construct, characterized in that The construct comprises 7 to 11 porin monomers according to any one of claims 1 to 5; preferably, the construct comprises 9 porin monomers according to any one of claims 1 to 5.

7. The construct according to claim 6, characterized in that The porin monomers are polymerized by covalent linkage or non-covalent bonding.

8. A protein pore, characterized in that The protein pore comprises 7-11 porin monomers according to any one of claims 1-5; preferably, the protein pore comprises 9 porin monomers according to any one of claims 1-5.

9. The protein pore according to claim 8, wherein The porin monomers are polymerized by covalent linkage or non-covalent bonding.

10. A film, characterized in that The membrane has the protein pore according to claim 8 or 9.

11. The membrane according to claim 10, characterized in that The membrane is an amphiphilic layer, ie a monolayer or a bilayer formed of amphiphilic molecules.

12. The membrane according to claim 11, characterized in that The amphiphilic molecule is a phospholipid.

13. A complex for characterizing a target analyte, characterized in that The complex comprises the protein pore according to claim 8 or 9 and a rate-controlling protein used in conjunction therewith.

14. A nucleic acid, characterized in that The nucleic acid encodes the porin monomer of any one of claims 1 to 5, the construct of claim 6 or 7, the protein pore of claim 8 or 9, or the complex of claim 13.

15. A vector or host cell, characterized in that The vector or host cell comprises the nucleic acid of claim 14.

16. A method for producing a protein pore or a polypeptide thereof, characterized in that: The method comprises transforming a host cell with the vector according to claim 15, and inducing the host cell to express a protein pore or a polypeptide thereof.

17. Use of the porin monomer of any one of claims 1-5, the construct of claim 6 or 7, the protein pore of claim 8 or 9, the membrane of any one of claims 10-12, the complex of claim 13, the nucleic acid of claim 14, or the vector or host cell of claim 15 in single molecule sequencing, wherein the single molecule includes but is not limited to DNA, RNA, polysaccharide, or polypeptide.

18. Use of the porin monomer of any one of claims 1 to 5, the construct of claim 6 or 7, the protein pore of claim 8 or 9, the membrane of any one of claims 10 to 12, the complex of claim 13, the nucleic acid of claim 14, or the vector or host cell of claim 15 in detecting the presence, absence or one or more characteristics of a target analyte or in preparing a product for detecting the presence, absence or one or more characteristics of a target analyte.

19. A method for determining the presence, absence, or one or more characteristics of a target analyte, characterized in that The method comprises: a. contacting the target analyte with the protein pore on the membrane according to any one of claims 10 to 12, or the complex or the protein pore in the complex according to claim 13, so that the target analyte moves relative to the protein pore; b. Taking one or more measurements as the target analyte moves relative to the protein pore to determine the presence, absence, or one or more characteristics of the target analyte.

20. The method according to claim 19, wherein The target analyte interacts with the protein pore such that the target analyte moves relative to the protein pore.

21. A kit for determining the presence, absence or one or more characteristics of a target analyte, characterized in that The kit comprises the construct of claim 6 or 7, the protein pore of claim 8 or 9, the membrane of any one of claims 10-12, the complex of claim 13, the nucleic acid of claim 14 or the vector or host cell of claim 15.

22. A device for determining the presence, absence, or one or more characteristics of a target analyte, characterized in that The device comprises the protein pore of claim 8 or 9, the membrane of any one of claims 10-12, or the complex of claim 13.

23. The use, method, kit or device according to any one of claims 18 to 22, characterized in that The target analytes include polysaccharides, amino acids, peptides, nucleotides, oligonucleotides, polynucleotides, dyes, drugs, diagnostic agents, explosives, environmental pollutants.