Application of porin protein PorA in improving ammonia nitrogen utilization capacity of methanotroph

By manipulating the gene of the inactivated porin PorA, the utilization capacity of the methanogenic bacterium Methylotuvimicrobium buryatense to ammonium nitrogen was improved, solving its sensitivity to ammonium nitrogen, reducing cultivation costs and the accumulation of harmful substances, and promoting its industrial application.

CN119306809BActive Publication Date: 2025-11-04NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411367723.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-29
Publication Date
2025-11-04
Estimated Expiration
2044-09-29

AI Technical Summary

Technical Problem

The methanogenic bacterium *Methylotuvimicrobium buryatense* is sensitive to ammonium nitrogen, resulting in high cultivation costs and limiting its industrial application.

Method used

The ability of strains to utilize ammonium nitrogen can be improved by knocking out, mutating, or silencing the gene of the inactivating porin PorA.

Benefits of technology

It reduced the fermentation and cultivation cost of methanogenic bacteria, improved the ammonium nitrogen utilization efficiency of the strains, reduced the accumulation of harmful substances, and promoted their industrial application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119306809B_ABST
    Figure CN119306809B_ABST
Patent Text Reader

Abstract

The application discloses application of a porin PorA in improving the ammonium nitrogen utilization capacity of a methanotrophic bacterium. The porin PorA has an amino acid sequence as shown in SEQ ID NO. 1. The coding gene porA of the porin PorA has a nucleotide sequence as shown in SEQ ID NO. 2. The application of the porin PorA in improving the ammonium nitrogen utilization capacity of Methylotuvimicrobium buryatense. Inactivation of the porin PorA can make the methanotrophic bacterium Methylotuvimicrobium buryatense grow by utilizing ammonium nitrogen, reduce the cost of fermenting the bacterium, and is of great significance for industrial application of the bacterium.
Need to check novelty before this filing date? Find Prior Art

Description

Technical fields:

[0001] This invention belongs to the field of biotechnology and relates to a method for improving the ammonia nitrogen utilization ability of the methanogenic bacterium Methylotuvimicrobiumburyatense and its application. Background technology:

[0002] Methanogenic bacteria can grow using methane as their sole carbon and energy source and are widely distributed in wetlands, lakes, and oceans, playing a crucial role in the Earth's methane cycle. Since the last century, the role of these microorganisms in methane biotransformation and methane pollution decontamination has received considerable attention. Methane biotransformation refers to the use of methanogenic bacteria to convert methane into products such as single-cell proteins, biodegradable plastics, carotenoids, and tetrahydropyrimidines. Methane pollution decontamination utilizes methanogenic bacteria to eliminate methane emissions from point sources such as landfills and wastewater treatment systems, reducing the amount of methane entering the atmosphere.

[0003] While there have been numerous commercial attempts in methane bioconversion and engineering efforts in methane elimination, sustained success in both areas remains lacking. Economic viability is a significant limiting factor. One way to improve economic viability is to reduce the cost of large-scale cultivation of methanogenic bacteria. From the perspective of culture medium raw materials, the form of nitrogen source affects fermentation costs. Because methanogenic bacteria are generally sensitive to ammonium nitrogen, nitrate nitrogen is typically used as their nitrogen source. However, potassium nitrate is about five times more expensive than ammonium chloride. Replacing nitrate nitrogen with ammonium nitrogen would significantly reduce the cultivation cost of methanogenic bacteria.

[0004] *Methylotuvimicrobium buryatense* is a type of methanogenic bacteria with industrial application value. These bacteria are characterized by rapid growth, alkaliphilicity, resistance to contamination, and tolerance to impurities in natural gas (PNAS, 2023, https: / / doi.org / 10.1073 / pnas.2310046120). In recent years, this type of bacteria has been developed into an important model strain and a chassis host for metabolic engineering. However, this bacteria is highly sensitive to ammonium nitrogen and can typically only be cultured using nitrate nitrogen. Improving the utilization of ammonium nitrogen by this bacteria would significantly reduce the cost of large-scale cultivation and greatly benefit its industrial application.

[0005] This invention provides a method for improving the ammonia nitrogen utilization capacity of methanogenic bacteria Methylotuvimicrobiumburyatense by inactivating porins and its application in fermentation culture. Summary of the Invention:

[0006] Purpose of the invention: The present invention aims to address the problem of the sensitivity of the methanogenic bacterium Methylotuvimicrobium buryatense to ammonium nitrogen. The present invention provides a method for improving its ammonia nitrogen utilization capacity by deactivating porins and its application.

[0007] To solve the above-mentioned technical problems, the present invention discloses the following technical solution:

[0008] In a first aspect, the present invention discloses a porin PorA and its encoding gene porA that affect the utilization capacity of ammonium nitrogen in Methylotuvimicrobium buryatense.

[0009] Porin PorA, the amino acid sequence of which is shown in SEQ ID NO.1.

[0010] The nucleotide sequence of the gene encoding the porin PorA is shown in SEQ ID NO.2.

[0011] Secondly, this invention discloses the application of the aforementioned porin PorA in improving the utilization capacity of ammonium nitrogen in Methylotuvimicrobiumburyatense.

[0012] The inactivation of the porin PorA can improve the utilization capacity of ammonium nitrogen in Methylotuvimicrobium buryatense.

[0013] The inactivation of the porin PorA can be achieved through gene knockout, gene mutation, or gene silencing of porA.

[0014] The application of the gene encoding porin PorA in improving the ammonium nitrogen utilization capacity of Methylotuvimicrobium buryatense can be achieved by gene knockout, gene mutation, or gene silencing of porA.

[0015] Applications of substances that inactivate porin PorA through gene knockout, gene mutation, or gene silencing in improving the utilization of ammonium nitrogen in Methylotuvimicrobium buryatense.

[0016] In summary, this invention provides a method for improving the ammonia nitrogen utilization capacity of methanogenic bacteria *Methylotuvimicrobium buryatense* by inactivating porins and its application.

[0017] Beneficial effects:

[0018] This invention discloses a porin that affects the efficiency of ammonium ion uptake by the methanogenic bacterium *Methylotuvimicrobium buryatense*. Inactivation of this porin enables *Methylotuvimicrobium buryatense* to grow using ammonium nitrogen, reducing the cost of fermenting and culturing this microorganism, which is of great significance for the industrial application of this microorganism. Attached image description:

[0019] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0020] Figure 1 A method for screening 5GB1C mutants with strong ammonia nitrogen utilization capabilities.

[0021] Figure 2 Growth ability of strains WT, ΔporA, and ΔporA-Com with ammonium salt as nitrogen source was tested.

[0022] Figure 3 3D structural simulation diagram of PorA.

[0023] Figure 4 The growth capacity of strain △porA was tested in shake flasks using fed ammonium chloride.

[0024] Figure 5 The accumulation of harmful products during the ammonia nitrogen process was tested using strain △porA. Detailed implementation method:

[0025] This invention first screens for mutants of the methanogenic bacterium *Methylotuvimicrobium buryatense* that can tolerate ammonium nitrogen by transposon random insertion mutations, and then determines the role of the porin gene *porA* through gene knockout and complementation experiments.

[0026] Example 1

[0027] like Figure 1As shown in the reference (AEM, 2013. https: / / doi:10.1128 / AEM.02478-13), a transposon random insertion library for strain Methylotuvimicrobium buryatense 5GBC1 was constructed using the pSC123 plasmid carrying the Himar1 mariner transposon. Methylotuvimicrobium buryatense 5GBC1 is a type strain of methanogenic bacteria, derived from reference (AEM, 2015. https: / / doi:10.1128 / AEM.03795-14). Mutants were screened on NMS2 and NMS2N (NMS2 + 8mM NH4Cl) media, respectively. The starting strain could only grow on NMS2 plates and not on NMS2N plates. Using this method, a mutant that could grow on NMS2N was screened and named 5G-P. The method described in reference (AEM, 2007, https: / / doi.org / 10.1128 / AEM.02973-06) determined the insertion site of the transposon in mutant 5G-P using chromosome walking. The inserted and inactivated gene was named porA. Note that mutant 5G-P can also be repeatedly obtained through genetic engineering using the method described in "Example 2".

[0028] Example 2

[0029] To verify that porA inactivation enhances the ammonium nitrogen utilization ability of strain 5GBC1, a pheS-based assay was performed. AG The marker-free gene knockout system knocked out porA in strain 5GBC1 to obtain strain ΔporA (Frontiers in Microbiology, 2020, https: / / doi.org / 10.3389 / fmicb.2020.00441). The specific steps are as follows: A 450bp fragment downstream of the target region to be deleted was used as a direct repeat (DR) sequence and added before the PZ box (the PZ box contains the tac promoter, RBSmmoX, and artificially synthesized pheS). AG(And the zeo resistance gene). Then, the left and right homologous arms (LF, RF) were fused in the order LF-DR-PZ-RF using overlap PCR. The fused DNA fragment was purified and recovered, and then transformed into 5GB1C competent cells by electroporation (Frontiers in Microbiology, 2020, https: / / doi.org / 10.3389 / fmicb.2020.00441). Transformants that successfully recombined into the target region using bleomycin were screened, and then the transformants obtained in the first step were reverse-screened using p-Cl-Phe. The traceless knockout strain was identified by PCR. Fragment LF was amplified using primers LF-F (GCAGAAGAAGAACGGCAAAT) and LF-R (AAAAGGC GACACTTGGTTTTGAAAACGGCCTCAAA); fragment DR was amplified using primers DR-F (AGGCCGTTTTCAAAACCAAG TGTCGCCTTTTTAAGTA) and DR-R (TGTCAACAGCTCATTTCAGAGTGAGTATAAAGGGAGTATGTCG); fragment PZ was amplified using primers PZ-F (CTCTGAAATGAGCTGTTGACA) and PZ-R (TCAGTCCTGCTCCTCGGCCA C); and fragment RF was amplified using primers RF-F (GTGGCCGAGGAGCAGGACTGACTAGAAACGAATGATCGCATC) and RF-R (TACGGCGTGGATGCTGCTTAT).

[0030] The low-transcriptional site (160485) in the 5GB1C genome was used as the integration site for porA complementation. Furthermore, porA was integrated into the chromosome of ΔporA using a homologous double crossover method, resulting in the complemented strain ΔporA-Com. The specific steps were as follows: using total DNA from strain 5GB1C as a template, the upstream and downstream homologous arms CLF and CRF of the complementation site, and the porA gene fragment CPA containing the original promoter region were amplified. Using pAWP89 as a template, the kanamycin resistance gene fragment KAN (AEM, 2015, http: / / dx.doi.org / 10.1128) was amplified. These four fragments were fused in the order CLF, CPA, KAN, and CRF. The recovered fragments were then transformed into competent cells of strain ΔporA via electroporation. Screening with kanamycin was performed, and the target strain was verified by PCR and sequencing. The CLF fragment was amplified using primers CLF-F (GGTGTCGATGGCATGCTCAA) and CLF-R (CA AGGCGAAGTTGAAGGCGC); the CPA fragment was amplified using primers CPA-F (GCGCCTTCAACTTCGCCTTGACCGTCGT GAACCCATTCAT) and CPA-R (TGCTCGATGAGTTTTTCTAACTAGAAACGAATGATCGCAT); the KAN fragment was amplified using primers KAN-F (TTAGAAAAACTCATCGAGCA) and KAN-R (CGCGTATAGCTTGCCGGAAG); and the CRF fragment was amplified using primers CRF-F (CTTCCGGCAAGCTATACGCGATCGATCTCCGCGATAATCT) and CRF-R (GTTACAGGCGTTACGTTACGTT).

[0031] like Figure 2 As shown, strain ΔporA can grow in AMS2 medium (with the same components as NMS2 medium except for the nitrogen source, using ammonium chloride as the nitrogen source) using 1 mM and 2 mM NH4Cl, while the starting strain 5GBC1 and the supplemented ΔporA-Com have difficulty growing. These results indicate that inactivating porA can improve the ability of strain 5GBC1 to utilize ammonium nitrogen.

[0032] Structural simulation prediction of PorA using AlphaFold 3, such as Figure 3 As shown, the results indicate that PorA possesses typical characteristics of porins, consisting of 16 β-chains arranged in a β-barrel shape and organized as a trimer. Viewed in cross-section perpendicular to this structure, the channel interior exhibits an hourglass shape, with the narrowest portion being the "contraction zone," formed by an outer ring.

[0033] Example 3: The inactivation of the porin-encoding gene porA enhances the ability of Methylotuvimicrobium buryatense5GBC1 to utilize ammonium nitrogen.

[0034] To verify whether the porA gene knockout strain ΔporA could obtain a high biomass by utilizing ammonium nitrogen, strain ΔporA was cultured overnight in AMS2 medium at 30°C and 180 rpm in a shake flask. Then, it was inoculated at 1% into 50 mL of AMS2 liquid medium and cultured at 30°C and 180 rpm, with 0.5 mM NH4Cl added every 6 hours and the gas in the shake flask replaced every 12 hours. Figure 4 As shown, strain ΔporA can continue to grow under continuous NH4Cl supplementation, indicating that ammonium nitrogen can be used instead of nitrate nitrogen for the fermentation culture of strain ΔporA, which is of great significance for reducing the cost of fermentation culture of Methylotuvimicrobiumburyatense.

[0035] Example 4: Deactivation of the porA gene, which encodes a porin, reduces the accumulation of harmful products.

[0036] Methanogenic bacteria can convert ammonia into harmful substances such as hydroxylamine, nitrite, and nitrous oxide. To test whether the inactivation of the porA gene would reduce these harmful substances, the starting strain *Methylotuvimicrobium buryatense5GBC1* and the knockout strain ΔporA were cultured overnight in NMS2 medium at 30°C and 180 rpm until the exponential phase. The cells were then collected by centrifugation and transferred to AMS2 medium for overnight culture at 30°C and 180 rpm. The accumulated hydroxylamine, nitrite, and nitrous oxide levels were measured (methods referenced in *Analytical Chemistry*, 1955, https: / / doi.org / 10.1021 / ac60106a054 and *PNAS*, 2016, https: / / doi.org / 10.1073 / pnas.1611051113). Figure 5 As shown, compared with the starting strain, strain ΔporA showed a reduction of approximately 60% in nitrite accumulation, approximately 50% in hydroxylamine accumulation, and approximately 50% in nitrous oxide accumulation in the culture medium supernatant.

[0037] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. Application of porin PorA in improving the ammonium nitrogen utilization ability of the methanogenic bacterium *Methylotuvimicrobium buryatense*, wherein inactivation of the porin PorA improves... Methylotuvimicrobium buryatense The ammonium nitrogen utilization capacity, the amino acid sequence of the porin PorA is shown in SEQ ID NO.

1.

2. The gene encoding the porin PorA as described in claim 1. porA Increasing the number of methanogenic bacteria Methylotuvimicrobium buryatense Its application in the utilization of ammonium nitrogen is characterized by, pass porA Gene knockout or gene silencing can improve Methylotuvimicrobium buryatense The ability to utilize ammonium nitrogen, and the gene encoding the porin PorA. porA The nucleotide sequence is shown in SEQ ID NO.2.