Cyprinus carpio sex determining gene ccMD and application thereof in sex identification or sex control of cyprinus carpio

Abstract

The invention provides a cyprinus carpio sex determining gene ccMD and application thereof in cyprinus carpio sex determination or sex control, the full length of the cyprinus carpio sex determining gene ccMD is as shown in SEQ ID NO.1, the CDS sequence is as shown in SEQ ID NO.2, and the protein coded by the gene is as shown in SEQ ID NO.3. The cyprinus carpio sex determining gene ccMD can be applied to cyprinus carpio sex determination or sex control. Specific primers are designed according to the gene sequence characteristics, and XX, XY and YY carps can be rapidly and accurately identified. The gene is taken as a target gene, a gene editing technology and a gene transfer technology are adopted, hormone treatment is not needed, and a genetically male carp and a physiologically female carp or a genetically female carp and a physiologically male carp can be rapidly obtained.

Description

Common carp sex-determining gene ccMD and its application in common carp sex identification or sex control Technical Field

[0001] The present invention belongs to the field of molecular biology, and specifically relates to the isolation and cloning of a transcriptional regulatory factor ccMD from common carp (Cyprinus carpio). It also relates to the application of this gene in common carp sex identification, sex-controlled breeding, and prevention and control of alien species invasion. Using the gene provided by the present invention as a target sequence, the sex of common carp (different strains of the genus Cyprinus) can be quickly and accurately identified. By using conventional methods in the field to mutate and overexpress the ccMD gene, the sex of common carp can be precisely controlled. Background Art

[0002] Fish account for over half of all living vertebrate species. Cyprinidae are the largest group of freshwater fish worldwide, comprising approximately 2,420 species. These fish are comprised of 12 subfamilies, including Leuciscinae, Cultrinae, Barbinae, Cyprininae, and Hypophthalmichthyinae. They play a crucial role in the origin of species and the evolution of biological systems. While over 20 sex-determining genes have been discovered in fish, no single sex-determining gene has been identified for cyprinidae (Chen et al., 2022).

[0003] Carp is one of the representative fishes of the Cyprinidae, Cyprininae, and Cyprinidae genus. The Cyprininae subfamily is composed of multiple genera such as Cyprinidae, Carassius, Barbus, Procyprinus, and Carassius. The identification of sex-determining genes in carp is of great significance to the identification of sex-determining genes and the study of sex-determination mechanisms in the Cyprininae subfamily and even the entire Cyprinidae family.

[0004] Common carp exhibits significant sexual dimorphism in growth rate, with females growing approximately 30% faster than males. Therefore, sex-controlled breeding of all-female common carp has significant application value. Common carp have an XX / XY sex determination pattern. Traditional all-female common carp breeding methods require using gynogenesis to produce XX females of known genetic sex. These gynogenetic females are then fed a hormone-containing diet for three consecutive months before sexual differentiation to produce sex-reversed XX pseudo-males. The following year, when the XX pseudo-males reach sexual maturity, they are then hybridized with females to produce all-female common carp (Wu Qingjiang and Gui Jianfang, 1999). This method is not only cumbersome and time-consuming, but also requires the use of hormones during the breeding of pseudo-male common carp, potentially impacting aquatic safety. More importantly, after cessation of hormone treatment, the XX pseudo-male common carp often revert to female or exhibit a significant decrease in sperm production, making it unsuitable for large-scale industrial production. By identifying common carp sex-determining genes and combining them with gene editing technology to precisely manipulate these sex-determining genes, precise and efficient sex control of common carp is possible, offering broad application prospects.

[0005] Common carp has been listed as one of the world's 100 most threatening invasive alien species (Luque et al., 2014). In parts of the Americas, Oceania, and Africa, particularly in the United States, Canada, and Australia, common carp are widely distributed in lakes and streams, causing severe damage to local aquatic communities and ecosystems (Zambrano et al., 2006; Chapman and Hoff, 2011; Weber and Brown, 2011; Forsyth et al., 2013; Bajer and Sor ensen, 2015; Vilizzi et al., 2015; Bajer et al., 2016). Currently, artificial removal methods such as water level control, netting, electrofishing, and whole-lake poisoning are primarily used to control invasive carp populations. However, in most cases, these methods are impractical to eliminate the carp invasion (Gutierrez and Teem, 2006; Britton et al., 2011; Vilizzi, 2012; Koehn et al., 2016). The sex ratio of a population is a key indicator for regulating population size. Based on this, Gutierrez and Teem proposed the "Trojan Y chmosome," a new biological invasion control strategy, in 2006. This strategy involves regularly releasing YY females into specific waters to reduce the number of females. By manipulating the sex ratio of invasive fish, this strategy achieves targeted biological control. This is considered the most promising biological control strategy for invasive fish with an XX / XY genetic sex determination system (Wang et al., 2016). The production of YY female carp involves a series of steps, including mating, genetic sex determination, and artificial sex reversal. In theory, mating artificially induced sex-reversed XY pseudo-female carp with wild XY male carp would yield a population of offspring consisting of a 1 / 4 XX, 2 / 4 XY, and 1 / 4 YY population. Estrogen could then be administered to the 1 / 4 YY population of the offspring to produce a YY pseudo-female population. However, under conventional conditions, it is impossible to effectively distinguish between XX, XY, and YY carp during the juvenile stage. Both artificially sex-reversed XY pseudo-female carp and candidate YY carp must be tested after sexual maturity. XY pseudo-female carp must then be test-crossed with wild XY male carp, and candidate YY carp with XX female carp. The sex of the offspring can then be analyzed separately to verify their genetic sex type. This process is not only labor-intensive and time-consuming, but has also been reported to date. Therefore, there is an urgent need to develop molecular techniques that can quickly and accurately distinguish and identify XX, XY, and YY carp.In carp with an XX / XY sex-determining system, the male sex-determining gene is a Y-chromosome-specific gene. By amplifying the presence of the sex-determining gene sequence and quantifying copy number differences, rapid and precise identification of XX, XY, and YY carp can be achieved. Therefore, identification of the carp sex-determining gene also has important practical applications for the rapid and efficient identification of YY carp and the prevention and control of carp invasions.

[0006] Sex-specific molecular marker-assisted breeding of carp also has important application value for ornamental koi. Female koi are more valuable than male koi due to their larger size (faster growth rate), rounder abdomen, plump body, slow and graceful swimming style, etc. In aquaculture production, male and female koi can generally only be identified during the adult stage through macroscopic indicators such as the appearance of the abdomen and cloaca, and body shape. Currently, there is a lack of technical means to distinguish the sex of XX and XY male and female koi in the juvenile stage. Therefore, the development of sex-specific molecular markers that can be applied to koi has important application value for realizing early sex identification and single-sex breeding of ornamental koi, thereby improving breeding efficiency.

[0007] Summary of the Invention

[0008] The present invention aims to provide a sex-determining gene for common carp. The gene is a transcription factor isolated and cloned from Yellow River carp. No research reports have been found on the gene. Based on the inventors' functional research on the gene, the inventors named the gene ccMD (Cyprinus carpio Male Determinator). The protein encoded by the gene is shown in SEQ ID NO.3.

[0009] Another object of the present invention is to provide an application of the carp sex determination gene ccMD in carp sex identification.

[0010] The last object of the present invention is to provide an application of the carp sex determination gene ccMD in carp sex control.

[0011] In order to achieve the above purpose, the present invention adopts the following technical measures

[0012] Based on gene cloning technology, the inventors identified a Y chromosome-specific transcription factor from Yellow River carp. No research reports have been found on this gene. Based on the inventors' functional research on the gene, the applicant named it ccMD, and its sequence structure characteristics are shown in Figure 1; open reading frame (ORF) prediction analysis found that the gene contains an open reading frame with a length of 231bp, encoding a small molecule protein of 76 amino acids with a molecular weight of 8.35kDa, and the protein contains an HLH (helix-loop-helix) domain, belongs to the bHLH superfamily, and is a transcription factor. The gene encodes the protein shown in SEQ ID NO.3, the full length of the gene is shown in SEQ ID NO.1, and the CDS sequence is shown in SEQ ID NO.2.

[0013] The inventors further analyzed the sequence and expression characteristics of the Yellow River carp ccMD gene and discovered that ccMD is specific to the male carp genome and is specifically expressed during the early stages of testis differentiation. Using chromosomal fluorescence in situ hybridization, the applicants discovered that the ccMD gene is located on the Y chromosome of the Yellow River carp, and that XX, XY, and YY carp contain 0, 1, and 2 copies of the ccMD gene, respectively. Based on this characteristic, quantitative PCR primers can be designed using the gene represented by SEQ ID NO. 1 or SEQ ID NO. 2, enabling rapid and accurate identification of XX, XY, and YY carp in the juvenile stage. Furthermore, reagents for detecting the ccMD gene can be used to identify the sex of XX and XY carp.

[0014] Therefore, reagents for detecting the gene encoding the protein shown in SEQ ID NO. 3 also fall within the scope of protection of the present invention, and the reagents include but are not limited to primers and DNA probes.

[0015] The use of a reagent for detecting the gene encoding the protein shown in SEQ ID NO. 3 in carp sex identification is also within the scope of protection of the present invention.

[0016] In the above application, preferably, the primers are ccMD-rtF1: 5'-AGAACATGCTCTGGCAAACG-3' and ccMD-rtR1: 5'-TTTAGGGTTCACACCTCAGCG-3'.

[0017] Among the above applications, preferably, it can be used for sex identification of ornamental koi.

[0018] A method for controlling the sex of carp using the common carp sex-determining gene ccMD is described. The ccMD gene is knocked out in XY male carp using molecular biology methods, causing the protein encoded by the ccMD gene to lose its original activity. The resulting knockout carp exhibits a complete sex reversal of gonadal development from testis to ovary. The ccMD gene is overexpressed in XX female carp using molecular biology methods, resulting in a complete sex reversal of gonadal development from ovary to testis in the transgenic adult fish.

[0019] In the above application, preferably, the carp is Yellow River carp (Cyprinus carpio Huanghe var.), Xingguo red carp (Cyprinus carpio var. singuonensis), purse red carp (Cyprinus carpio var. wuyuanens is), mirror carp (Cyprinus carpio carpio), koi (Cyprinus carpio var. rubrofuscus) and / or sharp-finned carp (Cyprinus acutidorsalis).

[0020] In the above application, preferably, when the ccMD gene is knocked out, the protein coding key region of the ccMD gene of the XY genetic male carp is mutated or deleted by using CRISPR / Cas9 gene editing technology;

[0021] In the above application, preferably, the knockout XY genetic male carp contains the gene shown in SEQ ID NO.4 or SEQ ID NO.6;

[0022] In the above applications, preferably, when the ccMD gene is overexpressed, a ccMD gene overexpression vector is constructed and the ccMD gene is introduced into XX genetic female carp for expression using gene transfer technology.

[0023] In the above application, preferably, the obtained XX genetic female carp after ccMD overexpression contains the sequence shown in SEQ ID NO.5.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] The applicant isolated and cloned the carp sex determination gene ccMD from common carp (Cyprinus carpio) for the first time. The protein encoded by this gene is shown in SEQ ID NO.3, and the corresponding polynucleotide in common carp is shown in SEQ ID NO.1.

[0026] By using the gene sequence characteristics to design specific primers, XX, XY and YY carp can be quickly and accurately identified.

[0027] By using this gene as the target gene and gene editing technology and gene transfer technology, genetically male and physiologically female carp or genetically female and physiologically male carp can be quickly obtained without hormone treatment.

[0028] The present invention provides precise gene targets for carp sex identification and sex-controlled breeding, and provides new genetic resources for the creation of excellent carp germplasm in aquaculture and ornamental farming, as well as for the prevention and control of carp as an alien species invasion. Description of the drawings:

[0029] FIG1 is a schematic diagram of the ccMD gene sequence and gene structure of the Yellow River carp of the present invention;

[0030] A is the full-length sequence of the ccMD gene mRNA, with the start and stop codons indicated in red; B is the protein sequence encoded by the ccMD gene, with the helix-loop-helix domain sequence in the ccMD protein indicated by the red box; C is a schematic diagram of the ccMD gene structure.

[0031] FIG2 is a schematic diagram of the male-specific identification of the Yellow River carp ccMD gene sequence of the present invention;

[0032] Among them: A is the amplification and identification result of 48 male and 48 female wild carp in Hubei region; B is the amplification result of 71 all-female carp in Hubei region, PC is the positive control; C is the identification of 48 male and 48 female wild carp in Anhui region; D is the amplification result of 18 male and 24 female wild carp in Henan region, NC is the negative control.

[0033] FIG3 shows the chromosome location and spatial organization expression characteristics of the ccMD gene of Yellow River carp of the present invention.

[0034] Among them: A is the result of chromosome fluorescence in situ hybridization; B is the result of DNA fluorescence quantitative PCR; C is the expression level of ccMD gene in the spatial organization of male and female carp in the early stage of gonad differentiation.

[0035] FIG4 is a schematic diagram of the construction and propagation of the pure line of the Yellow River carp ccMD gene mutation of the present invention.

[0036] FIG5 is a schematic diagram of the identification of pure lines of ccMD gene mutations and gonadal phenotype analysis of Yellow River carp according to the present invention.

[0037] Among them: A is the genotype PCR identification analysis; B is the protein coding prediction result; C is the quantitative analysis of the temporal expression of the ccMD gene in the mutant pure line; D is the result of the gonad temporal tissue section.

[0038] FIG6 is a schematic diagram of the construction and propagation of the Yellow River carp ccMD gene overexpression pure line of the present invention.

[0039] FIG7 is a schematic diagram of the identification of pure lines overexpressing the ccMD gene of Yellow River carp and the gonadal phenotype of the present invention.

[0040] Among them: A is the genotype PCR identification analysis; B is the analysis of the expression level of the ccMD gene in the overexpression pure line; C is the results of the dissection and tissue section of the adult fish gonad; D is the expression level of genes related to male and female sex differentiation in adult fish;

[0041] FIG8 is a schematic diagram of the conservation analysis of the Yellow River carp ccMD gene of the present invention in Xingguo red carp, purse red carp, mirror carp, koi carp, and sharp-finned carp.

[0042] Among them: AE are the amplification and identification analysis of the Yellow River carp ccMD gene specific primers in male and female populations of Xingguo red carp, purse red carp, mirror carp, koi carp and sharp-fin carp; F is the pure line phenotype of the Xingguo red carp ccMD gene mutation; G is the overexpression result of Xingguo red carp and koi P0 generation. DETAILED DESCRIPTION

[0043] The present invention is described in detail below with reference to specific embodiments. According to the following description and embodiments, those skilled in the art can determine the basic characteristics of the present invention, and without departing from the spirit and scope of the present invention, various changes and modifications can be made to the present invention to make it applicable to various uses and conditions. After a long period of natural differentiation and artificial breeding, carp has formed a series of local populations and varieties with diverse morphologies, rich body colors, scales or no scales, and strong adaptability to special environments. Mainstream carp strains are mostly named according to their distribution areas and morphological characteristics. Although there are many species, traditional morphology and modern molecular biology research have shown that all current carp populations or strains belong to the genus Cyprinus from a taxonomic point of view. In the present application, the applicant collected carp populations or strains distributed in different regions of China for verification, which showed that the gene sequence of the present invention is conservative and generally applicable to all carp of the genus Cyprinus.

[0044] Example 1:

[0045] Obtaining and identifying the male-specific ccMD gene in Yellow River carp

[0046] The whole genome of an XY male common carp with a clear genetic background was sequenced using the PacBio Sequel platform. A full-sib population of 50 females and 50 males derived from a testcross between the XY male and XX common carp was whole-genome resequenced using the Hise q 4000 platform. Bioinformatics differential comparison initially screened 606 candidate male-specific sequences totaling approximately 14.7 Mb in length. Using this pool of candidate sequences as templates, primers were designed one by one and PCR amplified and identified in DNA from both male and female common carp. Ultimately, a fragment with different lengths on the X and Y chromosomes was successfully amplified using a primer combination (BS14-F1: 5'TGGTATCGATTTGATGACTCTGTAG-3' and BS15-R1: 5'CTTCATTGTGCAGATGCCTACATTA-3'). Further cloning and sequencing yielded a 1487 bp male-specific fragment (shown as SEQ ID NO. 1).

[0047] Through transcriptome annotation and full-length RACE-PCR cloning, a male-specific gene consisting of two exons was successfully identified from this 1487bp sequence. Because its function has not yet been reported, it was named ccMD. The full-length ccMD gene was amplified, with the polynucleotide sequence shown in SEQ ID NO.1 and the CDS sequence shown in SEQ ID NO.2. It encodes the protein shown in SEQ ID NO.3. This gene contains a 231bp open reading frame and encodes a small protein of 76 amino acids with a molecular weight of 8.35kDa. This protein contains an HLH (helix-loop-helix) domain, belonging to the bHLH superfamily and a transcription factor.

[0048] DNA from Yellow River carp with multiple genetic backgrounds collected from Hubei, Anhui, and Henan provinces was used as a template for PCR amplification and identification using common Taq enzyme. The amplification system and procedure are shown in Table 1 and Table 2, respectively. The primers used were ccMD gene-specific primers: F1: 5'-AACTGCTAGTTGGTCAGACTTGCGA-3' and R: 5'-CACATATTTAGGGTTCACACCTCAG-3' (the primer design positions are shown in Figure 4A).

[0049] Table 1 ccMD gene specific primer amplification system

[0050] Table 2 PCR program for identification and amplification of ccMD gene specific primers

[0051] Agarose gel electrophoresis results showed that ccMD gene-specific primers exhibited male-specific PCR amplification results in a wild population of 48 males and 48 females from Hubei (see Figure 2A), an all-female population of 71 females from Hubei (see Figure 2B), a wild population of 48 males and 48 females from Anhui (see Figure 2C), and a wild population of 18 males and 24 females from Henan (see Figure 2D). This demonstrates that the ccMD gene DNA sequence is male-specific and has broad applicability, with consistent results across a variety of carp backgrounds.

[0052] Example 2:

[0053] Analysis of ccMD chromosome location and spatial organization expression pattern in Yellow River carp

[0054] Using the 1487 bp male-specific DNA sequence (the red-marked region A in FIG4 ) where the ccMD gene is located as a template, a digoxigenin-labeled specific DNA probe was prepared. The specific DNA probe sequence is shown in SEQ ID NO. 1. The probe sequence of the present invention is completely consistent with the 1487 bp male-specific DNA sequence.

[0055] Fluorescence in situ hybridization analysis of chromosomes was carried out on preparations of mitotic metaphase chromosomes of XX, XY, and YY carp. The results showed that the specific probe was located on 0, 1, and 2 mitotic metaphase chromosomes in XX, XY, and YY carp, respectively (results are shown in Figure 3A). In addition, the morphology of the mitotic metaphase chromosomes located by the specific probe in XY and YY carp was consistent, and both were acrocentric chromosomes, indicating that the Y chromosome of Yellow River carp is acrocentric chromosome and the ccMD gene is located at the end of the Y chromosome away from the centromere.

[0056] The ccMD gene copy number was quantitatively determined using DNA from XX, XY, and YY Yellow River carp as templates and the sGnRH gene, which has a constant copy number in Yellow River carp, as an internal reference. The ccMD gene quantification primers used were: ccMD-rtF1: 5'-AGAACATGCTCTGGCAAACG-3' and ccMD-rtR1: 5'-TTTAGGGTTCACACCTCAGCG-3'. The internal reference sGnRH gene quantification primers used were: sGnRH-rtF1: 5'-ATGGAGTGGAACGGAAGGT-3' and sGnRH-rtR1: 5'-CAGACAAATGAGAACAAGAGGAA-3'. Consistent with the results of fluorescence in situ hybridization (FISH), qPCR results also showed that the ccMD gene copy number in YY carp was approximately twice that of XY carp (see Figure 3, B). This further demonstrates that the ccMD gene is specific to the Y chromosome of Yellow River carp and can be used to rapidly distinguish and identify XX, XY, and YY carp in juvenile stages.

[0057] The tissue expression pattern of ccMD was analyzed by quantitative PCR using the β-actin gene as an internal reference gene and cDNA from the hypothalamus, heart, liver, spleen, kidney, gonads (testes in males and ovaries in females), intestine, muscle, and gills of male and female carp during the gonadal differentiation phase as templates. The β-actin qPCR primers used were: β-actin-rtF: 5'-GATGATGAAATTGCCGCACTG-3' and β-actin-rtR: 5'-ACCAACCATGACACCCTGATGT-3'; and the ccMD qPCR primers were: ccMD-rtF: 5'-TGACAAATTTATTAAAAAGGCATGG-3' and ccMD-rtR: 5'-CACATATTTAGGGTTCACACCTCAG-3'. Spatial tissue fluorescence quantitative analysis revealed that ccMD exhibits tissue-specific expression, being expressed exclusively in the gonads (testes) of male carp during sexual differentiation (see Figure 3, C).

[0058] Example 3:

[0059] Knockout and phenotypic analysis of ccMD gene in Yellow River carp

[0060] 1) ccMD gene editing gRNA target design

[0061] Using the ccMD gene ORF sequence as a template, the ZiFiT gene editing target online prediction tool (http: / / zifit.partners.org / ZiFiT / CSquare9Nuclease.aspx) was used to design three highly efficient gRNA sequences targeting the ccMD protein coding region and the upstream and downstream non-coding regions of the ccMD protein (see Figure 4A for a schematic diagram of target design). They were named gRNA7 (target sequence GGCCAGAGCAGAAATGTTG), gRNA4 (target sequence GGACGTGTGGAGAGAGAGGA), and gRNA1 (target sequence GGCAGAAGACATGTGTGTAG), respectively.

[0062] The gRNA amplification primers used were: T7-gRNA7-F: 5'-TGTAATACGACTCACTATAggccagagcagaaatgttgGTTTTAGAGCTAGAAAT-3', T7-gRNA4-F: 5'-TGTAATACGACTCACTATAggacgtgtggagagagaggaGTTTTAGAGCTAGAAAT-3', T7-gRNA1-F: 5'-TGTAATACGACTCACTATAggcagaagacatgtgtgtagGTTTTAGAGCTAGAAAT-3', and gRNA-RP: 5'-AAAAAAAGCACCGACTCGGTGCCAC-3'. Subsequently, gRNA7, gRNA4, and gRNA1 were mixed-target injected to efficiently obtain P0 generation positive carp with complete loss of ccMD gene function.

[0063] 2) gRNA synthesis

[0064] The DNA template required for gRNA in vitro transcription was amplified by PCR and MEGAshortscript was used. TM gRNA was transcribed in vitro using a transcription kit (Ambion, USA). The gRNA obtained by in vitro transcription was recovered using the mirVana™ miRNA isolation kit (Ambio n, USA). CAS9 protein TrueCut was prepared on ice at a final concentration of 500 ng / μL. TM Cas9 Protein v2 (Invitrogen, USA), 50 ng / μL ccMDgRNA, and 10% volume ratio of phenol red (Sigma-Aldrich, USA) were mixed and set aside.

[0065] 3) Development of ccMD gene knockout carp

[0066] XY Yellow River carp male embryos were obtained by hybridization using a YY Yellow River carp (Jiang et al., 2018) as the male parent and a common XX Yellow River carp as the female parent. Using a microinjector (Eppendorf, Germany), a mixture of ccMD gRNA, CAS9 protein, and phenol red was microinjected into one-cell-stage XY all-male Yellow River carp embryos to generate XY carp with ccMD gene knockout.

[0067] The conventional method of constructing fish CRISPR / Cas9 gene editing families in the art was used to subculture the obtained ccMD gene knockout carp to construct a family, and homozygous mutant carp of the ccMD gene were obtained in the F2 generation (B in Figure 4).

[0068] 4) Phenotypic analysis of ccMD gene knockout carp

[0069] Using the F2 / R identification primers (Figure 4A, the sequence of the F2 primer is 5'-CACATATTTAGGGTTCACACCTCAG-3', and the sequence of the R primer is shown in Example 1), PCR amplification and identification were performed on the F2 generation homozygous families of the ccMD mutation (the results are shown in Figure 5A), and the mutant XY with a ccMD base deletion of 288 bp was screened. -288 and YY -288 (YY -288 Only one ccMD copy is mutated in the carp, and theoretically it can still develop into a male carp). The carp with a 288bp deletion of the ccMD gene contains the gene shown in SEQ ID NO.4, which is effective for XY -288 The prediction of ccMD protein coding in homozygous mutants (Figure 5B) showed that compared with the absence of a specific main band in XX, XY and XY -288 、YY -288 The target site amplification showed a large band, a small main band, and two main bands, one large and one small, and XY -288 The homozygous ccMD-encoded protein exhibits large deletions and frameshifts and is predicted to be nonfunctional. Therefore, sex transformation from male to female carp can be achieved by mutating the ccMD gene, rendering the ccMD-encoded protein nonfunctional.

[0070] Real-time fluorescence quantitative analysis of ccMD expression during the gonadal development of homozygous families was performed (see Figure 5C). The quantitative results of the key gonadal development time series at 23 dpf and 60 dpf showed that XY and YY -288 Between, and XX and XY -288 The expression levels of ccMD genes were consistent between the XY and YY -288 The expression of ccMD gene in individuals with the same genotype at each time point was significantly higher than that in XX and XY -288 The genotyped individuals showed that the constructed F2 generation ccMD gene mutation homozygous family was effective.

[0071] The gonadal development phenotype of the homozygous families was analyzed by tissue section, and the results of H&E staining (see Figure 5D) showed that before sex determination at 15 dpf, XY, XY, and XY -288 、YY -288 There is no obvious difference in the gonadal structure of carp, which is mainly composed of gonadal somatic cells. At 30dpf, the critical period for sex determination, the gonads of the above types of carp begin to differ. -288 The gonadal structure of XX carp is consistent with that of female carp, and both have female-specific ovarian cavity structures, while XY and YY -288The gonads of carp do not have this structure. -288 The gonadal structure of XX carp remains the same, the ovarian cavity is enlarged, and the egg cells continue to proliferate and grow, while XY and YY -288 The gonads of carp are also consistent, gradually entering the spermatogenesis process with typical masculinization characteristics. These results together indicate that after ccMD mutation, XY -288 The mutant homozygotes showed typical feminized developmental characteristics at all stages of gonadal development, indicating that the ccMD gene is essential for male sex determination in male Yellow River carp.

[0072] Example 4:

[0073] Overexpression and phenotypic analysis of ccMD gene in Yellow River carp

[0074] 1) Overexpression vector construction:

[0075] The ccMD overexpression vector was based on the pSK_MCS_EGFP_Tol2 vector (Xia et al., 2018). The pSK_MCS_EGFP_Tol2 plasmid was first digested with EcoRI and XbaI, and then a 3 kb sequence containing the complete ccMD gene structure (shown in SEQ ID NO. 5) was ligated into the vector via homologous recombination (see Figure 6A for a schematic diagram of the vector construction). DNA from XY male carp was used as a template for PCR amplification using the following primers: EcoRI-BS14-F1: 5′-TCGATAAGCTTGATATCGTGGTATCGATTTGATGACTCTGTAG-3′ and XbaI-BS15-R1: 5′-ATACGACTCACTATAGTTCTTCATTGTGCAGATGCCTACATTA-3′.

[0076] 2) Development of ccMD-overexpressing carp:

[0077] Prepare the linearized overexpression plasmid vector at a final concentration of 50 ng / μL, Tol2 mRNA at 100 ng / μL, and phenol red at a 10% volume ratio, mix well, and set aside. XX Yellow River carp were obtained by hybridization using a XX pseudo-male common carp (Jiang et al., 2020) as the male parent and a normal XX Yellow River carp as the female parent. Using microinjection, the mixed ccMD overexpression vector solution was microinjected into XX fully female Yellow River carp embryos at the one-cell stage to obtain XX carp overexpressing the ccMD gene. Using conventional methods for establishing transgenic fish families, serial passages were performed to obtain a homozygous family of carp overexpressing ccMD in the F1 generation (Figure 6B).

[0078] 3) Phenotypic analysis of carp overexpressing the ccMD gene:

[0079] PCR identification and real-time fluorescence quantitative PCR were used to identify the ccMD gene overexpression families (results are shown in Figure 7A and B), genetic sex identification (forward primer F1: 5'-AACTGCTAGTTGGTCAGACTTGCGA-3', reverse primer R1: 5'-ATGAACTGGATTTTCTGCAACACTG-3', primer design is shown in Figure 6A) and overexpression type identification (forward primer Tol2-RF: 5'-AAAGTATCTGGCTAGAATCTTACT-3', reverse primer R 2:5'-TGTTGAGTGACTGGTGAGGTGAAGG-3', primer design see Figure 6A). The results showed that the overexpression F1 generation family was indeed composed of two genotypes: wild-type XX and ccMD gene overexpression homozygote XX / Tg(ccMD). The results of ccMD gene time-series fluorescence quantitative analysis showed that in the homozygous families at 35 dpf, 45 dpf, and 60 dpf, the ccMD gene expression level of the XX / Tg(ccMD) overexpression homozygote was significantly higher than that of the wild-type XX genotype individuals, indicating that the construction of the F1 generation homozygous family was effective.

[0080] Gonadal developmental phenotypes of the 120-dpf overexpression homozygous families were analyzed through gonadal dissection and tissue sectioning (see Figure 7, C). The results showed that the gonads of wild-type XX carp appeared translucent and ovarian, with sections filled with primary-stage oocytes. In contrast, the gonads of XX / Tg(ccMD) carp were grayish-white stripes composed of male germ cells at various stages of meiosis, displaying typical male gonadal developmental characteristics. Quantitative analysis of the male sex differentiation-related genes amh and dmrt1, and the female sex differentiation-related genes cyp19a1a and foxl2, in the 120-dpf overexpression families (see Figure 7, D) revealed that XX / Tg(ccMD) overexpression homozygotes also exhibited distinct masculinization at the gene expression level, more consistent with wild-type XY carp.

[0081] These results, obtained in Yellow River carp, demonstrate that ccMD is specifically present in the male carp genome and expressed during the early stages of testicular differentiation. Knockout of ccMD in XY carp results in female development. Introducing ccMD into XX female carp leads to a complete sex reversal of their gonadal fate from female to male. These findings indicate that ccMD is the male sex-determining gene in Yellow River carp.

[0082] Example 5:

[0083] The ccMD gene of Yellow River carp is conserved in freshwater fish species of the genus Cyprinus:

[0084] To explore the conservation of sex-determining genes among different geographical strains or subspecies of common carp, studies were conducted in Xingguo red carp (Cyprinus carpio var.singuonensis), purse red carp (Cyprinus carpio var.wuyuanensis), mirror carp (Cyprinus carpio carpio), koi (Cyprinus carpio var.rubrofuscus), and sharp-fin carp (Cyprinus acutidorsalis).

[0085] Using DNA from wild male and female populations of Xingguo red carp, purse red carp, mirror carp, koi carp, and sharp-fin carp as templates, the Yellow River carp c cMD gene-specific primer combination F1 / R was used for sequential amplification and identification. The amplification results showed obvious male specificity, indicating that the Yellow River carp ccMD gene-specific primer combination can also accurately identify the sex of Xingguo red carp (Figure 8A), purse red carp (Figure 8B), mirror carp (Figure 8C), koi carp (Figure 8D), and sharp-fin carp (Figure 8E).

[0086] Similar to the method used in Yellow River carp, CRISPR / Cas9 gene editing technology and subsequent passage construction were used to obtain a Xingguo red carp -7bp ccMD mutation homozygous family (this family contains the gene shown in SEQ ID NO.6). It was predicted that the deleted protein had lost its original function. The results of gonadal dissection and tissue sectioning of 4-month-old adult fish showed that compared with the gray-white bands and typical spermatogenic testis structure of wild-type XY male carp, XY -7 The gonads of homozygous ccMD mutations were consistent with those of wild-type XX female carp, both showing a zona pellucida shape, and the section results showed typical ovarian structures filled with primary growth oocytes, indicating that the ccMD gene is also essential for male sex determination in Xingguo red carp.

[0087] Using the ccMD overexpression vector consistent with that of Yellow River carp, ccMD overexpression analysis was performed in Xingguo red carp and koi carp. Screening and identification were performed using genetic sex identification primers and overexpression type identification primers. P0 generation positive fish with XX / Tg (ccMD) genotype overexpression in Xingguo red carp and XX / Tg (ccMD) genotype overexpression in koi were obtained. The results of semen extraction from adult fish (see Figure 8, G) showed that both P0 generation positive fish with two genotypes overexpression had semen, which showed typical male gonadal development characteristics, suggesting that the ccMD gene is also sufficient to initiate male sex determination in Xingguo red carp and koi carp.

Claims

1. An artificially cloned carp sex-determining gene ccMD, and the protein encoded by the gene is as shown in SEQ ID NO.

3.

2. The gene according to claim 1, wherein: the gene is as shown in SEQ ID NO.1 or SEQ ID NO.

2.

3. A reagent for detecting the gene encoding the protein shown in SEQ ID NO.

3.

4. The reagent according to claim 3, and the reagent is a primer or a DNA probe.

5. The reagent according to claim 4, and the primers are ccMD-rtF1: 5’-AGAACATGCTCTGGCAAACG-3’ and ccMD-rtR1: 5’-TTTAGGGTTCACACCTCAGCG-3’.

6. Use of the reagent according to claim 3 in carp sex identification.

7. Use of the gene according to claim 1 in carp sex control.

8. According to the use described in claim 7, the application process includes: Knocking out the ccMD gene in XY male carp by molecular biology methods, so that the protein encoded by the ccMD gene loses its original activity, and the gonad development of the obtained gene knockout carp undergoes a complete reversal from testis to ovary; or overexpressing the ccMD gene in XX female carp by molecular biology methods, and the gonad development of the transgenic carp undergoes a complete reversal from ovary to testis.

9. According to the use described in claim 8, when knocking out the ccMD gene, it is to mutate or delete the key region of the protein coding of the ccMD gene in XY genetic male carp by CRISPR / Cas9 gene editing technology; when overexpressing the ccMD gene, it is to construct an overexpression vector of the ccMD gene and use gene transfer technology to introduce the ccMD gene into XX genetic female carp for overexpression.

10. According to the use described in claim 9, wherein: The obtained XY genetic male carp after ccMD knockout contains the gene shown in SEQ ID NO.4 or SEQ ID NO.6, and the obtained XX genetic female carp after ccMD overexpression contains the sequence shown in SEQ ID NO.

5.

11. According to the use described in claim 6 or 7, the carp is Cyprinus carpio Huanghe var., Cyprinus carpio var. singuonensis, Cyprinus carpio var. wuyuanensis, Cyprinus carpio carpio, Cyprinus carpio var. rubrofuscus, and / or Cyprinus acutidorsalis.

Images