Compound and application thereof in preparation of living cell nucleus staining reagent

Abstract

The invention discloses a compound and application thereof in preparation of a living cell nucleus staining reagent. The compound is a compound as shown in a formula (I) or a stereoisomer thereof, and can enter a cell nucleus of a living cell within ten minutes, uniformly dye the cell nucleus and display bright fluorescence, a rinsing step is not needed, and background fluorescence interference outside the cell nucleus does not exist; the method has the advantages of simplicity in operation, low cytotoxicity, good light stability, no influence of intracellular pH value and the like. # imgabs0 #

Description

Technical Field

[0001] The present invention belongs to the field of chemical biology, and specifically relates to a new compound and its application, and more specifically to the compound, the application of the compound in living cell nuclear staining, and a method for performing cell nuclear staining using the compound. Background Art

[0002] Live cell nuclear fluorescence staining technology is one of the core tools in life science research. Its core value lies in achieving non-invasive real-time observation of dynamic biological processes such as the cell cycle, gene expression regulation, and cell differentiation. Compared with fixed cell staining, live cell nuclear labeling technology can avoid the chromatin condensation artifacts caused by aldehyde fixatives and preserve the natural conformation of protein-DNA interactions in the cell nucleus. In the field of drug development, this technology has been successfully applied to anticancer drug screening, and the effects of drugs on the cell cycle are evaluated by real-time monitoring of nuclear membrane rupture events. In regenerative medicine, in vivo tracking of morphological changes in stem cell nuclei provides key spatiotemporal information for studying the mechanism of cell reprogramming.

[0003] However, despite the significant significance of live-cell nuclear staining, this field currently faces numerous challenges. Currently, mainstream live-cell nuclear probes can be categorized into two main systems: small-molecule dyes and genetically encoded probes. Small-molecule dyes, exemplified by Hoechst 33342 and DAPI, produce blue fluorescence under UV excitation through AT-specific binding. The advantage of these dyes is their ability to penetrate the membrane of living cells without the need for transfection, but their spectral properties limit colocalization studies with other fluorescent markers. Furthermore, Hoechst 33342 causes G1 arrest at concentrations >5 μg / mL, a dose-dependent cell cycle disruption that severely restricts long-term live-cell observation. DAPI, due to its strong DNA binding, causes irreversible cytotoxicity and is therefore only suitable for endpoint detection. Genetically encoded systems, exemplified by the H2B-GFP fusion protein, achieve precise nuclear localization through the fusion expression of histone H2B and green fluorescent protein, but are limited by transfection efficiency and photobleaching.

[0004] Live-cell imaging typically requires minute-level temporal resolution, but conventional nuclear dyes (such as SYTO 24 and SYTO 63) have a half-life of less than 10 minutes under continuous excitation. Commercial antifade reagents (such as oxyrase) can extend fluorescence lifetime but alter the intracellular redox state. Two-photon microscopy has reduced photodamage by 60%, but the accompanying femtosecond laser system significantly increases the barrier to use.

[0005] Given the importance of staining living cell nuclei in biological and medical research, as well as the current technical challenges, it is urgent to develop a new fluorescent dye with high selectivity, excellent biocompatibility, low background noise, and the ability to quickly penetrate the cell membrane for staining. Summary of the Invention

[0006] The present invention aims to solve at least one of the technical problems existing in the prior art.

[0007] One object of the present invention is to provide a compound or a stereoisomer thereof, wherein the compound has good biocompatibility, low cytotoxicity, minimal damage to biological samples, and good resistance to photobleaching, can rapidly stain living cell nuclei, and achieve effective observation of cell samples for a long time, and is not affected by intracellular potassium ion concentration and pH value.

[0008] The compound provided by the present invention has a structural formula as shown in formula (I):

[0009]

[0010] In formula (I),

[0011] R1 is selected from: alkyl, alkoxy;

[0012] R2 and R3 are each independently selected from the group consisting of hydrogen, halogen, alkyl, alkoxy, alkylhydroxy, alkyl-substituted amino, haloalkyl, haloalkoxy, phenyl, alkyl-substituted phenyl, alkoxy-substituted phenyl;

[0013] X is selected from the group consisting of: CH2, NH, oxygen, sulfur, and selenium;

[0014] Y - represents a counter ion, which can be selected from any one of chloride ion, bromide ion, iodide ion or alkylsulfonate ion.

[0015] Specifically, R1 can be C 1-6 Straight chain or branched chain alkyl or C 1-6 Alkyl hydroxyl group;

[0016] R2 and R3 are each independently selected from: hydrogen, halogen, C 1-6 Straight-chain or branched alkyl, C 1-6 amino substituted with straight or branched alkyl groups, C 1-6 Alkoxy substituted with a straight-chain or branched alkyl group.

[0017] The above compounds may specifically be the following compounds:

[0018]

[0019] The counter ion in compounds (1), (2), (3), and (4) is Br - ,Cl - , I - or an alkylsulfonic acid group.

[0020] The compounds of the embodiments of the present invention have good membrane permeability and do not require cell fixation, permeabilization, or other treatments. They can specifically stain cell nuclei while maintaining cell activity. They also have the advantages of good biocompatibility, low cytotoxicity, and minimal damage to biological samples. They also have good resistance to photobleaching, enabling effective observation of cell samples for a long time.

[0021] Another object of the present invention is to provide a method for preparing the compound represented by formula (I), comprising the following steps:

[0022]

[0023] in,

[0024] (1) Compound a reacts with compound b to obtain compound c;

[0025] (2) Compound c reacts with compound d to produce e;

[0026] (3) Compound e undergoes a ring-opening reaction to produce compound f;

[0027] (4) Compound f reacts with compound g to obtain a compound represented by formula (I);

[0028] Wherein, R3 and X in compound a and compound c are the same as those in the compound represented by formula (I);

[0029] Y and R1 in compound d are the same as those in the compound represented by formula (I);

[0030] R3, X, Y, and R1 in compound e and compound f are the same as those in the compound represented by formula (I);

[0031] R2 in compound g is the same as defined in the compound represented by formula (I).

[0032] Another object of the present invention is to provide the use of the aforementioned compound or its stereoisomer in the preparation of a living cell nucleus staining reagent.

[0033] Due to the advantages of good membrane permeability and biocompatibility, low cytotoxicity, little damage to biological samples, and good anti-photobleaching properties, this compound can be used for fluorescence imaging of cell nuclei without the need for cell fixation, permeabilization, and other treatments. The cell nucleus can be specifically stained while maintaining cell activity, and effective observation of cell samples for a longer period of time can be achieved.

[0034] Another object of the present invention is to provide a method for staining living cell nuclei and performing fluorescence imaging.

[0035] The method for staining living cell nuclei and performing fluorescence imaging provided by the present invention comprises the following steps:

[0036] 1) mixing the compound or its stereoisomer with a solvent to obtain a compound mother solution;

[0037] 2) diluting the compound stock solution and contacting and culturing the solution with cells to obtain fluorescently labeled cells;

[0038] 3) Performing fluorescence imaging on the fluorescently labeled cells.

[0039] In step 1) of the above method, the solvent is selected from at least one of physiological saline, tris-hydrochloric acid buffer solution, phosphate buffer solution, methanol solution, ethanol solution, acetonitrile solution, dimethyl sulfoxide solution and dimethylformamide (DMF) solution.

[0040] Specifically, the solvent is tris(hydroxymethylaminomethane)-hydrochloric acid buffer solution or phosphate buffer solution, with a pH value of 6.2-8.2 and a concentration of 0-50 mmol / L.

[0041] The concentration of the compound in the obtained compound mother solution is 0.1-10 mmol / L, and the concentration of the compound in the contact culture system is 0.1-10 μmol / L.

[0042] The compound of the present invention can enter the nuclei of living cells within ten minutes, uniformly staining the nuclei and producing bright fluorescence. No rinsing steps are required, and there is no background fluorescence interference outside the nucleus. It has multiple advantages, including simple operation, low cytotoxicity, good photostability, and no influence from intracellular pH. The present invention aims to obtain a fluorescent dye that overcomes the shortcomings of existing technologies, meet the growing needs of scientific research and clinical practice, and promote breakthrough research in related fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Cell viability after incubation with different concentrations of compounds (1), (2), (3), and (4) for 48 hours;

[0044] Figure 2 The fluorescence spectra of compounds (1), (2), (3), and (4) in buffer solutions containing different potassium ion concentrations are shown;

[0045] Figure 3 The fluorescence spectra of compounds (1), (2), (3), and (4) in buffer solutions with different pH values are shown;

[0046] Figure 4 are the absorption and fluorescence spectra of the interaction between compound (2) and different nucleic acid structures;

[0047] Figure 5aThis is the fluorescence imaging of living HeLa cells stained with compound (2) (2 μM, Ex=488 nm) over time. Figure 5b This is a fluorescence imaging diagram of living HeLa cells stained with Hoechst33342 (5μM, Ex=405nm) over time. Figure 5c This is a fluorescence imaging diagram of living HeLa cells stained with SYTO Green (2μM, Ex=488nm) over time. Figure 5d Fluorescence imaging of living HeLa cells stained with SYTO 63 (0.5 μM, Ex=633 nm) over time.

[0048] Figure 6 These are confocal images of compound (2) (2 μM, Ex = 488 nm), DAPI (5 μM, Ex = 405 nm), and PI (5 μM, Ex = 559 nm) in fixed HeLa cells over time.

[0049] Figure 7 These are confocal images of Hoechst 33342 (Ex = 405 nm), compound (2) (Ex = 488 nm), SYTO Green (Ex = 488 nm), and SYTO 63 (Ex = 633 nm) entering the nucleus of living HeLa cells and then continuously irradiated with laser for 4 minutes.

[0050] Figure 8 Fluorescence imaging of living MCF-7 cells stained with compound (1) over time.

[0051] Figure 9 Fluorescence imaging of living A549 cells stained with compound (3) over time.

[0052] Figure 10 This is the co-localization fluorescence imaging of compound (4) and Hoechst33342 in HUVEC cells. DETAILED DESCRIPTION

[0053] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0054] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0055] Compound

[0056] According to one aspect of the present invention, the present invention provides a compound or a stereoisomer thereof. According to an embodiment of the present invention, the compound has a structure shown in formula (I),

[0057]

[0058] In formula (I),

[0059] R1 is selected from: alkyl, alkoxy;

[0060] R2 and R3 are each independently selected from the group consisting of hydrogen, halogen, alkyl, alkoxy, alkylhydroxy, alkyl-substituted amino, haloalkyl, haloalkoxy, phenyl, alkyl-substituted phenyl, alkoxy-substituted phenyl;

[0061] X is selected from the group consisting of: CH2, NH, oxygen, sulfur, and selenium;

[0062] Y - represents a counter ion, which can be selected from any one of chloride ion, bromide ion, iodide ion or alkylsulfonate ion.

[0063] The compounds according to the embodiments of the present invention have good membrane permeability, eliminating the need for cell fixation or permeabilization, and specifically staining cell nuclei while maintaining cell viability. They also exhibit good biocompatibility, low cytotoxicity, minimal damage to biological samples, and excellent resistance to photobleaching, enabling effective observation of cell samples for extended periods of time without being affected by intracellular pH. Furthermore, the probes are simple in composition and simple and rapid in detection, making them promising universal dyes for detecting the nuclei of living cells.

[0064] The term "alkyl" refers to a saturated linear or branched monovalent hydrocarbon group of 1 to 20 carbon atoms, or 1 to 10 carbon atoms, or 1 to 8 carbon atoms, or 1 to 6 carbon atoms, or 1 to 4 carbon atoms, or 1 to 3 carbon atoms, wherein the alkyl group may be independently and optionally substituted with one or more substituents described herein.

[0065] Examples of alkyl groups include, but are not limited to, methyl (Me, -CH3), ethyl (Et, -CH2CH3), n-propyl (n-Pr, -CH2CH2CH3), isopropyl (i-Pr, -CH(CH3)2), n-butyl (n-Bu, -CH2CH2CH2CH3), isobutyl (i-Bu, -CH2CH(CH3)2), sec-butyl (s-Bu, -CH(CH3)CH2CH3), tert-butyl (t-Bu, -CH(CH3)CH2CH3), -C(CH3)3), n-pentyl (-CH2CH2CH2CH2CH3), 2-pentyl (-CH(CH3)CH2CH2CH3), 3-pentyl (-CH(CH2CH3)2), 2-methyl-2-butyl (-C(CH3)2CH2CH3), 3-methyl-2-butyl (-CH(CH3)CH(CH3)2), 3-methyl-1-butyl (-CH2CH2CH(CH3)2), 2-methyl-1- Butyl (-CH2CH(CH3)CH2CH3), n-hexyl (-CH2CH2CH2CH2CH2CH3), 2-hexyl (-CH(CH3)CH2CH2CH2CH3), 3-hexyl (-CH(CH2CH3)(CH2CH2CH3)), 2-methyl-2-pentyl (-C(CH3)2CH2CH2CH3), 3-methyl-2-pentyl (-CH(CH3)CH(CH3)CH2CH3 ), 4-methyl-2-pentyl (-CH(CH3)CH2CH(CH3)2), 3-methyl-3-pentyl (-C(CH3)(CH2CH3)2), 2-methyl-3-pentyl (-CH(CH2CH3)CH(CH3)2), 2,3-dimethyl-2-butyl (-C(CH3)2CH(CH3)2), 3,3-dimethyl-2-butyl (-CH(CH3)C(CH3)3), n-heptyl, n-octyl, and the like.

[0066] The term "alkyl" and its prefix "alkane" as used herein include both straight and branched saturated carbon chains.

[0067] The term "alkoxy" as used herein refers to an alkyl group, as defined herein, connected to a main carbon chain via an oxygen atom, such examples include, but are not limited to, methoxy, ethoxy, propoxy, butoxy, etc., and the alkoxy group may be substituted or unsubstituted, wherein the substituents may be, but are not limited to, deuterium, hydroxyl, amino, halogen, cyano, alkoxy, alkyl, alkenyl, alkynyl, mercapto, nitro, etc.

[0068] The term "haloalkyl" refers to an alkyl group that may be substituted with one or more halogen atoms, examples of which include, but are not limited to, trifluoromethyl,

[0069] The term "haloalkoxy" refers to an alkoxy group in which the alkyl group may be substituted with one or more halogen atoms. Examples include, but are not limited to, difluoromethoxy and the like.

[0070] In addition, it should be noted that, unless otherwise expressly stated, the descriptions used throughout this document, “each…independently is,” “…independently is,” and “…each independently is,” are interchangeable and should be understood in a broad sense. They can mean that in different groups, the specific options expressed by the same symbols do not affect each other, or that in the same group, the specific options expressed by the same symbols do not affect each other.

[0071] The definitions and conventions of stereochemistry used herein are generally those of SP Parker, Ed., McGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, New York; and Eliel, E. and Wilen, S., "Stereochemistry of Organic Compounds", John Wiley & Sons, Inc., New York, 1994. The compounds of the present invention may contain asymmetric centers or chiral centers and therefore exist as different stereoisomers. All stereoisomeric forms of the compounds of the present invention, including but not limited to diastereomers, enantiomers, atropisomers and mixtures thereof, such as racemic mixtures, form part of the present invention. Many organic compounds exist in optically active forms, i.e., they have the ability to rotate the plane of plane-polarized light. When describing an optically active compound, the prefix D, L or R, S is used to indicate the absolute configuration of the molecule about its chiral center. The prefixes d, l, (+), and (-) are used to designate the sign of rotation of plane polarized light in a compound. (-) or l means that the compound is levorotatory, and the prefix (+) or d means that the compound is dextrorotatory. These stereoisomers have the same chemical structure, but their stereostructures are different. Specific stereoisomers can be enantiomers, and a mixture of isomers is often called an enantiomeric mixture. A 50:50 mixture of enantiomers is called a racemic mixture or racemate, which may result in a lack of stereoselectivity or stereospecificity during chemical reactions. The terms "racemic mixture" and "racemate" refer to an equimolar mixture of two enantiomers that lacks optical activity.

[0072] According to an embodiment of the present invention, the alkyl group is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, pentyl, isopentyl, n-hexyl or isohexyl;

[0073] According to an embodiment of the present invention, the alkoxy group is a C1-6 Alkyl;

[0074] According to an embodiment of the present invention, the alkyl-substituted amino group is C 1-6 an alkyl mono- or di-substituted amino group;

[0075] According to an embodiment of the present invention, the haloalkyl group is an alkyl group containing 1-3 fluorine, chlorine or bromine atoms.

[0076] According to an embodiment of the present invention, the counter ion of the compound is a chloride ion, a bromide ion, an iodide ion or an alkylsulfonate ion.

[0077] Preparation of compounds

[0078]

[0079] According to an embodiment of the present invention, R1 is selected from: alkyl, alkoxy; R2 and R3 are each independently selected from: hydrogen, halogen, alkyl, alkoxy, alkoxy, alkyl substituted amino, haloalkyl, haloalkoxy, phenyl, alkyl substituted phenyl, alkoxy substituted phenyl; X is selected from: CH2, NH, oxygen, sulfur, selenium; Y - represents a counter ion, which can be selected from any one of chloride ion, bromide ion, iodide ion or alkylsulfonate ion.

[0080] According to an embodiment of the present invention, compound a and compound b react in an organic solvent, and the organic solvent may be at least one of tetrahydrofuran, 2-methyltetrahydrofuran, acetonitrile, methanol, and ethanol.

[0081] According to an embodiment of the present invention, compound c and compound d are mixed and reacted directly under heating conditions, and the reaction temperature is in the range of 100 to 260°C.

[0082] According to an embodiment of the present invention, the ring-opening reaction of compound e to generate compound f is carried out in the presence of a base, and the base may be an inorganic base, which may be at least one of potassium hydroxide, sodium hydroxide, potassium carbonate, sodium carbonate, cesium carbonate, potassium bicarbonate, and sodium bicarbonate.

[0083] According to an embodiment of the present invention, the reaction of compound f and compound g is carried out in an organic solvent, and the organic solvent is at least one of methanol, ethanol, acetone, dimethyl sulfoxide, N,N-dimethylformamide, triethylamine, and tetrahydrofuran.

[0084] Application of compounds

[0085] According to another aspect of the present invention, the present invention provides the use of the aforementioned compound in nuclear fluorescence imaging. Because the compound has the advantages of good membrane permeability, good biocompatibility, low cytotoxicity, and little damage to biological samples, and has good resistance to photobleaching, the compound is used for nuclear fluorescence imaging, without the need for fixing or permeating the cells, and the cell nucleus is specifically labeled while maintaining cell activity, and effective observation of the cell sample for a long time can be achieved. In addition, it should be noted that the compound has all the technical features and advantages of the aforementioned compounds, which will not be repeated here.

[0086] According to another aspect of the present invention, the present invention provides a method for fluorescence imaging of the nuclei of living cells. According to an embodiment of the present invention, the method comprises: mixing the aforementioned compound with a solvent to obtain a compound solution; contacting and culturing the compound solution with cells to obtain fluorescently labeled cells; and performing fluorescence imaging on the fluorescently labeled cells. Due to the advantages of the compound having good membrane permeability and biocompatibility, low cytotoxicity, and little damage to biological samples, and having good anti-photobleaching properties, the compound is used for fluorescence imaging of cell nuclei. There is no need to fix or permeabilize the cells. The cell nuclei are specifically labeled while maintaining cell activity, and effective observation of cell samples for a long time can be achieved. In addition, it should be noted that the compound has all the technical features and advantages of the aforementioned compounds, which will not be repeated here.

[0087] According to an embodiment of the present invention, the solvent is selected from at least one of physiological saline, tris-hydrochloric acid buffer solution, phosphate buffer solution, methanol solution, ethanol solution, acetonitrile solution, dimethyl sulfoxide solution, and diformamide solution. It should be noted that "methanol solution" can be pure methanol or a solution obtained by mixing methanol and water in any proportion. Similarly, the same applies to "ethanol solution," "acetonitrile solution," "dimethyl sulfoxide solution," and "diformamide solution," which are not described in detail here.

[0088] According to an embodiment of the present invention, the pH value of the Tris-HCl buffer solution and the phosphate buffer solution are both 6.2-8.2, and the concentration is both 0-50 mmol / L. Therefore, the pH value of the buffer solution is close to the pH value inside the cell, and has good biocompatibility with the cell.

[0089] The present invention will be described below with reference to specific examples. It should be noted that these examples are merely illustrative and are not to be construed as limiting the present invention.

[0090] Below with reference to embodiment, the scheme of the present invention will be explained.It will be appreciated by those skilled in the art that the following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the examples, the techniques or conditions described in the literature in this area (e.g., with reference to " Molecular Cloning Experiment Guide ", 3rd edition, Science Press, by Huang Peitang, etc., with reference to J. Sambrook, etc.) or in accordance with product specifications are carried out. Reagents or instruments used are not indicated by manufacturer and are conventional products that can be obtained commercially, such as can be purchased from Thermo Fisher, Sigma.

[0091] In the following examples, the instrument used to observe cell fluorescence was a laser confocal microscope (OLYMPUS FV1000-IX81 (Olympus, Japan)).

[0092] Example 1: Preparation of Compound 2

[0093]

[0094] 1) Synthesis of intermediate c: tert-Butyl nitrite (2.0 eq, purchased from Beijing Inokai) and 120 mL of anhydrous tetrahydrofuran (purchased from Concord) were mixed, and compound a (1.0 eq) was added in batches. The mixture was ultrasonically dissolved and refluxed in a 50°C oil bath under nitrogen for 4 h. The tetrahydrofuran was concentrated on a rotary evaporator and separated by column chromatography to obtain intermediate c, which was then dried.

[0095] 1 H NMR (400MHz, Chloroform-d) δ 8.84 (s, 1H), 7.99 (d, J = 8.3 Hz, 1H), 7.63 (dt, J = 1.7, 0.8 Hz, 1H), 7.25 (dd, J = 8.3, 1.6 Hz, 1H), 2.42 (s, 3H).

[0096] 2) Synthesis of Intermediate e: Intermediate c (0.01 mol, 1.0 eq) and isopropyl iodide d (0.016 mol, 1.6 eq, purchased from Aladdin) were weighed and placed in a pressure tube. The mixture was wrapped in tin foil and placed in an oil bath at 125°C. The reaction was continued for 10 h, followed by cooling to room temperature. The mixture was concentrated on a rotary evaporator, separated into solid and liquid phases, and air-dried to obtain Intermediate e.

[0097] The NMR characterization results are as follows: 1H NMR(400MHz,Chloroform-d)δ11.29(s,1H),8.25~8.15(m,2H),7.74(d,J=8.7Hz ,1H),5.52(hept,J=6.7Hz,1H),2.61(s,3H),2.08(s,1H),1.93(d,J=6.7Hz,6H).

[0098] 3) Synthesis of intermediate f: Add 10 mL of 10 mol·L -1 To a solution of potassium hydroxide (Beijing Yinuokai) and 5mL of ethylene glycol (Tianjin Yongda Chemical Reagent), add the intermediate product e (0.001mol), condense and reflux in an oil bath at 200°C under a nitrogen atmosphere for 14 hours, stop the reaction and cool to room temperature. Add concentrated hydrochloric acid (purchased from Tianjin Kaixin Chemical Industry) to neutralize the reaction. After the reaction is completed, add chloroform (purchased from Concord) to the flask for extraction. Separate the organic layer, dry it with magnesium sulfate, and remove the solvent on a rotary evaporator to obtain intermediate f. ESI[C 20 H 28 N2S2] m / z calculated as 360.17, found as [M+H] + =361.14.

[0099] 4) Synthesis of target product: Weigh the intermediate f (55 μmol·L -1 ) was placed in a three-necked flask and 6 mL of ethanol (Tianjin Yongda Chemical Reagent) was added to dissolve. -1 ) was added to the above solution and heated at 100°C for 5 h. After the reaction was complete, the mixture was cooled to room temperature. The solvent was removed by vacuum rotary evaporation. The product was purified by column chromatography, washed with ether (Tianjin Kaixin Chemical Industry), and dried to obtain a red powdery solid.

[0100] The NMR characterization results are 1 H NMR (400MHz, Methanol-d4) δ8.47(d,J=7.1Hz,1H),8.23(s,1H),8.17(s,1H),7.96(d,J=9.7Hz,2H),7.78( d,J=11.1Hz,1H),7.64(d,J=10.3Hz,1H),7.43(s,1H),7.09(s,1H),3.19(s,6H),2.64(s,3H),1.93(s,6H).

[0101] Example 2

[0102] Compounds (1), (3) and (4) were prepared according to the method of Example 1.

[0103] Compounds (1), (2), (3), and (4) (Y are all I) prepared in the examples - ) were used to conduct cytotoxicity experiments, as follows:

[0104]

[0105] (1) Dissolve compounds (1), (2), (3), and (4) separately in a small amount of DMSO to prepare their stock solutions;

[0106] (2) Add different concentrations of compound solutions to the cultured HeLa cells and continue culturing for 48 hours;

[0107] (3) After aspirating the culture medium, add 10% MTT solution and continue culturing for 4 hours;

[0108] (4) After drying the culture medium, add DMSO to dissolve it and measure the absorbance at 492nm using a microplate reader. Plot the absorbance at 492nm as the ordinate and the concentration of the compound as the abscissa. The results are shown in Figure 2. Figure 1 As shown, there was no significant difference in the absorbance values at 492 nm at different compound concentrations, indicating that compounds (1), (2), (3), and (4) had no significant cytotoxicity.

[0109] Example 3

[0110] This example verifies the photostability of compounds (1), (2), (3) and (4) in potassium ion solutions with different concentrations:

[0111] (1) Dissolve the compound in a small amount of methanol to prepare a 0.2 mM stock solution;

[0112] (2) adding the compound solution of step (1) to Tris-HCl buffer containing different potassium ions to make the final concentration of the compound 2 μM;

[0113] (3) The fluorescence spectrum of the compound was detected using a fluorescence spectrometer with an excitation wavelength of 410 nm. Figure 2 As shown in the figure, when the potassium ion concentration changes from 0 to 300 mM, the fluorescence spectra of the four compounds do not change significantly, indicating that the four compounds are insensitive to changes in metal ion concentration.

[0114] Example 4

[0115] This example verifies the photostability of compounds (1), (2), (3) and (4) in solutions with different pH values:

[0116] (1) Dissolve the compound in a small amount of methanol;

[0117] (2) adding the compound solution of step (1) into PBS buffer of different pH values respectively, so that the final concentration of the compound is 2 μM;

[0118] (3) The fluorescence spectrum of the compound was detected using a fluorescence spectrometer with an excitation wavelength of 410 nm. Figure 3 As shown in the figure, the fluorescence spectra of the four compounds did not change significantly when the solution pH changed from 4 to 8. This indicates that the four compounds are insensitive to changes in pH.

[0119] Example 5

[0120] The present invention verifies the absorption and fluorescence response of compound (2) to DNA as follows:

[0121] (1) Dissolve compound (2) in a small amount of DMSO to prepare a stock solution of compound (2) with a concentration of 200 μM;

[0122] (2) Dissolve different nucleic acid sequences in 150 mM K + The compound solution prepared in step (1) was added to a Tris-HCl buffer to prepare a mixed solution of compound (2) and nucleic acid. The concentrations of compound (2) and nucleic acid were both 10 μM. The nucleic acid sequence and its secondary structure are as follows (5'-3'):

[0123] c-Myc:AGGGTGGGGAGGGTGGGG (G-quadruplex, G4)

[0124] TB1:TTGTGGTGGGTGGGTGGGT (G-quadruplex, G4)

[0125] AB1:TTGAGGTGGGTGGGTGGGT (G-quadruplex, G4)

[0126] TTAGGG:TTAGGG (G-quadruplex, G4)

[0127] Src1:GGGCGGCGGGCTGGGCGGGG (G-quadruplex, G4)

[0128] 9GC-T:GAAAAAAAGTTTTCTTTTTTTCTTTTTCTTTTTTTC (triple chain)

[0129] ds26:CAATCGGATCGAATTCGATCCGATTG (double-stranded)

[0130] (3) The solution prepared in step (2) was detected using an ultraviolet absorption spectrometer and a fluorescence spectrometer, respectively, wherein the excitation wavelength of the fluorescence spectrum experiment was 460 nm and the slit width was 5 nm.

[0131] (4) Figure 4 The absorption and fluorescence spectra of compound (2) and mixtures of compound (2) and different nucleic acids are shown. It can be found that the absorption spectrum of compound (2) is red-shifted and the fluorescence intensity is enhanced after binding to some nucleic acid structures such as G-quadruplex (G4), ds26 duplex, and 9GC-T triplex.

[0132] Example 6

[0133] Compound (2) was used to stain the nuclei of living cells and compared with commercial living cell nuclear dyes, as follows:

[0134] (1) Dissolve compound (2) separately in a small amount of DMSO to prepare a stock solution of compound (2) with a concentration of 1 mM;

[0135] (2) Use a pipette to transfer 2 μL of the stock solution of compound (2) and add it to 1 mL of HeLa cell culture medium to prepare a staining solution containing 2 μM compound (2);

[0136] (3) Immediately place the cell sample prepared in step (2) under a laser scanning confocal microscope for real-time imaging monitoring, wherein the excitation wavelength is 488 nm and the fluorescence collection wavelength range is 550-650 nm.

[0137] (4) Referring to the above steps, the three control groups were tested for imaging of living cell nuclei stained with Hoechst 33342 (5 μM), SYTO Green (2 μM), and SYTO 63 (0.5 μM).

[0138] (5) The results are as follows Figures 5a-5d As shown, compound (2) and three commercial dyes can quickly enter living cells and stain the cell nucleus within 10 minutes. Among them, compound (2) has the least background fluorescence interference and does not produce interfering fluorescence signals in areas outside the cell nucleus even if the cells are not washed.

[0139] Example 7

[0140] Compound (2) was used to stain the nuclei of fixed cells and compared with commercial fixed cell nuclear dyes, as follows:

[0141] (1) Dissolve compound (2) separately in a small amount of methanol to prepare a stock solution of compound (2) with a concentration of 1 mM;

[0142] (2) After the HeLa cells were incubated and adhered, they were fixed with ice-cold methanol, rinsed with PBS, and then stained with a 2 μM PBS solution of compound (2). Images were collected in situ every 1 minute.

[0143] (3) Set up two control groups, refer to step (2), stain the cells with 5 μM DAPI and 5 μM PI, and collect in situ images every 1 minute;

[0144] (4) Confocal images such as Figure 6 As shown, within 5 minutes, all three dyes entered the nuclei of fixed cells. Without washing, DAPI and PI remaining outside the nucleus would have more obvious interference fluorescence, while compound (2) had less background fluorescence interference.

[0145] Example 8

[0146] Compound (2) was used to stain the nuclei of living cells and the photostability test was performed as follows:

[0147] (1) Dissolve compound (2) separately in a small amount of DMSO to prepare a stock solution of compound (2) with a concentration of 1 mM;

[0148] (2) Pipette 2 μL of the stock solution of compound (2) and add it to 1 mL of HeLa cell culture medium to prepare a staining solution containing 2 μM compound (2). Stain the cells for 30 minutes.

[0149] (3) The cell sample prepared in step (2) was placed under a laser scanning confocal microscope, and continuously irradiated with a 488 nm laser, with images collected every 1 minute.

[0150] (4) Referring to the above steps, the fluorescence imaging of three control groups of Hoechst33342 (5 μM), SYTO Green (2 μM), and SYTO63 (0.5 μM) was detected after staining the nuclei of living cells for 30 minutes under continuous laser irradiation.

[0151] (5) The results are as follows Figure 7 As shown, SYTO63 showed obvious fluorescence quenching among the four dyes, while compound (2), Hoechst33342, and SYTO Green all showed good photostability. It can also be observed that compound (2) had the least background fluorescence interference and the best imaging performance.

[0152] Example 9

[0153] Compound (1) was used to stain the nuclei of living cells as follows:

[0154] (1) Dissolve compound (1) in a small amount of DMSO to prepare a stock solution of compound (1) with a concentration of 1 mM;

[0155] (2) Using a pipette, 4 μL of the stock solution of compound (1) was transferred to 1 mL of the culture medium of MCF-7 cells to prepare a staining solution containing 4 μM compound (1);

[0156] (3) Immediately place the cell sample prepared in step (2) under a laser scanning confocal microscope for real-time imaging monitoring, wherein the excitation wavelength is 488 nm and the fluorescence collection band is 500-650 nm.

[0157] (4) The results are as follows Figure 8 As shown, compound (1) can quickly enter living cells and stain the cell nucleus within 10 minutes. Even if the cells are not washed, no interfering fluorescent signals are generated in areas other than the cell nucleus.

[0158] Example 10

[0159] Compound (3) was used to stain the nuclei of living cells as follows:

[0160] (1) Dissolve compound (3) separately in a small amount of DMSO to prepare a stock solution of compound (3) with a concentration of 1 mM;

[0161] (2) Use a pipette to transfer 2 μL of the stock solution of compound (3) and add it to 1 mL of culture medium of A549 cells to prepare a staining solution containing 2 μM compound (3);

[0162] (3) Immediately place the cell sample prepared in step (2) under a laser scanning confocal microscope for real-time imaging monitoring, wherein the excitation wavelength is 488 nm and the fluorescence collection wavelength range is 550-650 nm.

[0163] (4) The results are as follows Figure 9 As shown, compound (3) can quickly enter living cells and stain the cell nucleus within 10 minutes. Even if the cells are not washed, no interfering fluorescent signals are generated in areas outside the cell nucleus.

[0164] Example 11

[0165] Compound (4) was used to stain the nuclei of living cells as follows:

[0166] (1) Dissolve compound (4) separately in a small amount of DMSO to prepare a stock solution of compound (4) with a concentration of 1 mM;

[0167] (2) Pipette 2 μL of compound (4) stock solution and add it to 1 mL of HUVEC cell culture medium to prepare a staining solution containing 2 μM compound (4) and stain for 10 minutes;

[0168] (3) At the same time, Hoechst 33342 (5 μM) was pipetted and stained for 10 minutes on the same cell sample;

[0169] (3) The cell sample prepared in the above step was placed under a laser scanning confocal microscope for imaging. The excitation wavelength of the Hoechst 33342 channel was 405 nm, and the collection wavelength was 420-480 nm; the excitation wavelength of the compound (4) channel was 488 nm, and the fluorescence collection wavelength was 550-650 nm.

[0170] (4) The results are as follows Figure 10 As shown, compound (4) and Hoechst33342 both stained the cell nucleus, and the two showed a high degree of overlap, confirming that compound (4) can be used as a cell nucleus dye.

[0171] Comprehensive examples show that the compounds of the present invention have good membrane permeability, do not require cell fixation or permeabilization treatment, and can quickly and highly specifically stain the cell nucleus while maintaining cell viability. The dye also has the advantages of good photostability and low cytotoxicity, allowing for effective observation of cell samples for a long time. Furthermore, the dye has a simple composition and a simple and rapid detection procedure, making it promising as a universal dye for detecting the nuclei of living cells.

[0172] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. A compound or a stereoisomer thereof, the structural formula of which is shown in formula (I): In formula (I), R1 is selected from: alkyl, alkoxy; R2 and R3 are each independently selected from the group consisting of hydrogen, halogen, alkyl, alkoxy, alkylhydroxy, alkyl-substituted amino, haloalkyl, haloalkoxy, phenyl, alkyl-substituted phenyl, alkoxy-substituted phenyl; X is selected from the group consisting of: CH2, NH, oxygen, sulfur, and selenium; Y - represents a counter ion selected from any one of chloride ion, bromide ion, iodide ion or alkylsulfonate ion.

2. The compound or stereoisomer thereof according to claim 1, characterized in that R1 is C 1-6 Straight chain or branched chain alkyl or C 1-6 Alkyl hydroxyl group; R2 and R3 are each independently selected from: hydrogen, halogen, C 1-6 Straight-chain or branched alkyl, C 1-6 amino substituted with straight or branched alkyl groups, C 1-6 Alkoxy substituted with a straight-chain or branched alkyl group.

3. A method for preparing the compound according to claim 1 or 2, comprising the steps of: in, (1) Compound a reacts with compound b to obtain compound c; (2) Compound c reacts with compound d to produce e; (3) Compound e undergoes a ring-opening reaction to produce compound f; (4) Compound f reacts with compound g to obtain a compound represented by formula (I); R3 and X in compound a and compound c are the same as those in the compound represented by formula (I); Y and R1 in compound d are the same as those in the compound represented by formula (I); R3, X, Y, and R1 in compound e and compound f are the same as those in the compound represented by formula (I); R2 in compound g is the same as defined in the compound represented by formula (I).

4. Use of the compound according to claim 1 or 2 or its stereoisomer in the preparation of a living cell nucleus staining reagent.

5. A method for staining and fluorescent imaging living cell nuclei, comprising the following steps: 1) mixing the compound according to claim 1 or 2 or its stereoisomer with a solvent to obtain a compound mother solution; 2) diluting the compound stock solution and contacting and culturing the solution with cells to obtain fluorescently labeled cells; 3) Performing fluorescence imaging on the fluorescently labeled cells.

6. The method according to claim 5, characterized in that In step 1), the solvent is selected from at least one of physiological saline, tris-hydrochloric acid buffer solution, phosphate buffer solution, methanol solution, ethanol solution, acetonitrile solution, dimethyl sulfoxide solution and diformamide solution.

7. The method according to claim 5, characterized in that The concentration of the compound in the obtained compound mother solution is 0.1-10 mmol / L, and the concentration of the compound in the contact culture system is 0.1-10 μmol / L.

Images