Preparation method of biomimetic material for simulating oral cavity chewing mucosa as well as product and application of biomimetic material

Abstract

The invention relates to a preparation method of a biomimetic material for simulating oral masticatory mucosa and a product and application thereof, the preparation method comprises the following steps: cloning a coding gene of a protein containing a VPGXG repetitive unit into an expression vector to obtain a first expression vector; cloning the coding gene of the protein containing the VPGXG repetitive unit into the expression vector, and adding cysteine to each of the two ends of the protein to obtain a second expression vector; respectively transferring the first expression vector and the second expression vector into competent cells for expression, separation and purification of proteins to obtain a first expression vector protein and a second expression vector protein; and mixing the first expression vector protein, the second expression vector protein and the multi-arm PEG-MAL solution to obtain the multi-arm PEG-MAL. The hydrogel prepared by the invention accurately simulates the characteristics of oral chewing mucosa in mechanical properties, has no cytotoxicity, can replace real oral mucosa for experiments, and can be widely applied to the experimental fields of drug release, cell culture, gas component monitoring and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioengineering, and relates to a preparation method of a bionic material simulating oral masticatory mucosa, and a product and application thereof. Background Art

[0002] Hydrogels are a type of three-dimensional network material containing a large amount of water. They are generally formed by chemically or physically crosslinking hydrophilic polymers. Because their physical and chemical properties are similar to those of the human extracellular matrix, they exhibit good biocompatibility with human tissue. Consequently, they are widely used in biomedical fields such as biomimetic materials, tissue engineering, cell culture platforms, and wound dressings.

[0003] In recent years, increasing research has focused on using hydrogels as a substitute for real biological tissue in biological experiments. However, the simple network structure of conventional hydrogels cannot accurately simulate the structural and mechanical properties of biological materials. Therefore, there is still a lack of biomimetic hydrogel materials with properties similar to those of biological materials that can be used as a substitute in experiments. Summary of the Invention

[0004] In view of the deficiencies of the prior art, the present invention aims to provide a method for preparing a bionic material that simulates oral masticatory mucosa, as well as its product and application.

[0005] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0006] In a first aspect, the present invention provides a method for preparing a biomimetic material that simulates oral masticatory mucosa, the preparation method comprising:

[0007] (1) cloning a gene encoding a protein containing VPGXG repeating units into an expression vector to obtain a first expression vector;

[0008] The gene encoding the protein containing the VPGXG repeating unit is cloned into an expression vector, and a cysteine ​​is added to each end of the protein to obtain a second expression vector;

[0009] (2) respectively transferring the first expression vector and the second expression vector into competent cells for protein expression, separation, and purification to obtain the first expression vector protein and the second expression vector protein;

[0010] (3) Mix the first expression vector protein, the second expression vector protein and the multi-arm PEG-MAL solution to obtain.

[0011] The present invention constructs fibrin of varying lengths composed of ELP protein sequences and uses them to create fibrin-containing hydrogel materials. The hydrogel materials have mechanical properties and network structures similar to those of animal oral mucosa, and can be used as extracellular matrices for biomimetic oral mucosa in cell culture experiments. Simultaneous addition of a first carrier protein and a second carrier protein can produce a double-network hydrogel that can better mimic the properties of biological tissue. Cysteine ​​does not necessarily need to be added to the terminal amino acid position of the protein, as long as it can react smoothly to form a gel.

[0012] X in VPGXG refers to any amino acid.

[0013] Preferably, the expression vector contains a His tag.

[0014] Preferably, the number of repetitions of the repeating units is independently 10-100, for example, 10, 12, 15, 18, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, etc. Other specific values ​​within the above numerical range can be selected and will not be described here one by one.

[0015] Preferably, the number of arms in the multi-arm PEG-MAL solution is 4-10, such as 4, 5, 6, 7, 8, 9, 10, etc.

[0016] Preferably, the final concentration of the protein in step (3) is 10-500 mg / mL.

[0017] The final concentration of protein here refers to the sum of the final concentrations of the first carrier protein and the second carrier protein.

[0018] The final concentration of the protein can be selected as 10 mg / mL, 20 mg / mL, 30 mg / mL, 40 mg / mL, 50 mg / mL, 60 mg / mL, 70 mg / mL, 80 mg / mL, 90 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 350 mg / mL, 400 mg / mL, 450 mg / mL, 500 mg / mL, etc. Other specific point values ​​within the above numerical range can be selected, which will not be repeated here.

[0019] Preferably, in step (3), the mass ratio of the first carrier protein to the second carrier protein is 1:(3.5-5.5).

[0020] The specific point values ​​in (3.5-5.5) can be selected as 3.5, 3.8, 4, 4.2, 4.5, 4.8, 5, 5.2, 5.5, etc. Other specific point values ​​within the above numerical range can be selected, and they will not be listed here one by one.

[0021] Preferably, the final concentration of multi-arm PEG-MAL in step (3) is 10-500 mg / mL.

[0022] The final concentration of multi-arm PEG-MAL can be selected as 10 mg / mL, 20 mg / mL, 30 mg / mL, 40 mg / mL, 50 mg / mL, 60 mg / mL, 70 mg / mL, 80 mg / mL, 90 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 350 mg / mL, 400 mg / mL, 450 mg / mL, 500 mg / mL, etc. Other specific point values ​​within the above numerical range can be selected, which will not be repeated here.

[0023] Preferably, the expression conditions are: temperature of 10-37° C., time of 4-24 h, and induction using 0.1-2 mM IPTG.

[0024] The temperature can be selected as 10℃, 12℃, 15℃, 18℃, 20℃, 22℃, 25℃, 28℃, 30℃, 32℃, 35℃, 37℃, etc. The time can be selected as 4h, 8h, 12h, 16h, 20h, 24h, etc. The molar concentration of IPTG can be selected as 0.1mM, 0.2mM, 0.5mM, 0.8mM, 1mM, 1.2mM, 1.5mM, 1.8mM, 2mM, etc. Other specific point values ​​within the above numerical range can be selected, so they will not be listed here.

[0025] Preferably, the purification comprises using Co 2+ -NTA protein resin purification and dialysis to obtain.

[0026] In a second aspect, the present invention provides a bionic material simulating oral masticatory mucosa prepared according to the method for preparing a bionic material simulating oral masticatory mucosa according to the first aspect.

[0027] In a third aspect, the present invention provides a use of the bionic material simulating oral masticatory mucosa according to the second aspect in gas composition testing or cell culture.

[0028] In a fourth aspect, the present invention provides an application of the bionic material simulating oral masticatory mucosa according to the second aspect in drug release research.

[0029] The hydrogel of the present invention simulates the mechanical properties of real oral mucosa. It also simulates the composition and network structure of real mucosa, is non-cytotoxic, and can replace real oral mucosa in experiments such as drug testing, cell culture, and gas composition detection.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] (1) In terms of structural design, compared with ordinary hydrogels, ELP protein is introduced as the second layer of entanglement network, thereby simulating the real oral chewing mucosa in terms of macroscopic mechanical properties, microscopic network structure and surface undulation.

[0032] (2) PEG protein hydrogel has high water content and good biocompatibility, and can be used as the extracellular matrix of biomimetic oral masticatory mucosa for cell culture experiments.

[0033] (3) The network structure and composition of the hydrogel are close to those of the real oral chewing mucosa, and can replace the real mucosa to test the release and diffusion of drug components, gas components, etc. in the mucosa.

[0034] (4) The hydrogel has good adhesion properties and is transparent in color, making it convenient to set up experiments and test results. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 It is a schematic diagram of the hydrogel network structure design of the present invention.

[0036] Figure 2 Figure 3 is a stress-strain curve comparing the mechanical properties of the hydrogel of the present invention and the chewing mucosa of the animal's oral cavity, wherein Figure A is the result of a uniaxial tensile test, Figure B is the result of a uniaxial single-cycle tensile test, and Figure C is the result of a pre-shear tensile test.

[0037] Figure 3 The network structure of the hydrogel of the present invention is compared with that of the chewing mucosa of the oral cavity of an animal.

[0038] Figure 4 The surface undulations of the hydrogel of the present invention are compared with those of the chewing mucosa of the oral cavity of an animal.

[0039] Figure 5 These are the experimental results of examining the adsorption of particles on the oral mucosa by the hydrogel of the present invention, wherein Figure A is the result of fluorescence microscopy observation, and Figure B is the statistical result. DETAILED DESCRIPTION

[0040] The technical solution of the present invention is further described below by way of specific embodiments. It should be understood by those skilled in the art that the embodiments are merely to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0041] The sources of the functional ingredients contained in the products involved in the following examples and comparative examples are as follows (only the functional ingredients are reflected, and the necessary auxiliary ingredients contained in other commercially available raw materials are not repeated):

[0042] 4-arm PEG-MAL was purchased from Sinopharm 4-arm-PEG-MAL-20K, catalog number 06020701912.

[0043] Example 1

[0044] This embodiment provides a method for preparing a biomimetic material that simulates oral masticatory mucosa, the preparation method comprising:

[0045] (1) The nucleotide sequence shown in SEQ ID No. 1 was cloned into an expression vector to obtain a first expression vector, wherein the expression vector is pQE80L and the restriction enzyme cleavage site is BamhI-KpnI;

[0046] The nucleotide sequence shown in SEQ ID No. 2 was cloned into an expression vector to obtain a second expression vector, the expression vector being pQE80L with a restriction enzyme cleavage site of BamhI-KpnI;

[0047] (2) The first expression vector and the second expression vector were transferred into competent cells for protein expression. The expression conditions were as follows: temperature 20°C, time 16 h, IPTG addition amount 0.2 mM, and protein separation and purification, dialyzed into PBS buffer, and the purification was carried out using Co 2+ -NTA protein resin to obtain the first carrier protein and the second carrier protein;

[0048] (3) The first carrier protein, the second carrier protein and the 4-arm PEG-MAL solution were mixed to a final concentration of 20 mg / mL for the first carrier protein, 80 mg / mL for the second carrier protein and 40 mg / mL for the 4-arm PEG-MAL solution. The mixture was allowed to stand at room temperature for 2 h to form a gel.

[0049] SEQ ID No. 1:

[0050]

[0051] SEQ ID No.2:

[0052] ATGAGAGGATCGCATCACCATCACCATCACTGTGGATCCGTGCCGGGCGTCGGCGTGCCGGGCGTAGGTGTTCCGGGCGAGGGTGTTCCGGGCGTTGGTGTGCCGGGCGTCGGCGTGCCGGGCGTGGGTGTTCCGGGCGTAGGTGTGCCGGGCGAGGGTGTGCCGGGCGGGCTGAGATCCGTGCCGGGCGTCGGCGTGCCGGGCGTAGGTGTTCCGGGCGAGGGTGTTCCGGGCGTTGGTGTGCCGGGCGTCGGCGTGCCGGGCGTGGGTGTTCCGGGCGTAGGTGTGCCGGGCGAGGGTGTGCCGGGCGGGCTGAGATCTGGTACCTGTTAA.

[0053] The amino acid sequence encoded by SEQ ID No.1 is shown in SEQ ID No.3.

[0054] SEQ ID No.3:

[0055] MRGSHHHHHHGSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRS。

[0056] The amino acid sequence encoded by SEQ ID No.2 is shown in SEQ ID No.4.

[0057] SEQ ID No.4:

[0058] MRGSHHHHHHCGSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVP GGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSGTC. <(

[0059] Test Example 1

[0060] Mechanical effect test method:

[0061] At room temperature, uniaxial single tensile, pre-shear uniaxial tensile, and uniaxial single cycle tensile tests were performed using an Instron-5944 tensile testing machine equipped with a 10N static load cell. All mechanical test specimens maintained a standard size of 10×10×1mm. Each experiment was repeated three times, and the average value was reported. The results are shown in Figure 2. Figure 2 shown.

[0062] Test Example 2

[0063] Test method:

[0064] The hydrogel prepared in Example 1 was observed under a scanning electron microscope and an atomic force microscope with the chewing mucosa of the animal's mouth, and the network structure and surface undulation were compared. Figure 3 As shown, the surface undulation degree is compared with Figure 4 shown.

[0065] Test Example 3

[0066] Particle adsorption effect

[0067] Test method: Fluorescent polystyrene nanoparticles (1 μm, 3 μm, 5 μm, purchased from Regeneron Biotechnology Co., Ltd.) were dispersed in phosphate buffered saline (PBS) at a concentration of 1 mg / mL and sonicated for 10 minutes to form a uniform suspension.

[0068] The hydrogel was fixed to the substrate surface, ensuring that the bottom surface of the sample remained sealed and not in direct contact with the fluorescent particles. A fluorescent particle suspension was sprayed onto the exposed top surface of the sample using an atomizer to simulate particle deposition, ensuring that the amount of fluorescent particle suspension sprayed per unit area remained consistent. The sample was then incubated at 37°C for 8 hours to promote particle diffusion. Imaging was performed using a fluorescence microscope with an excitation wavelength of 488 nm and an emission band of 510-550 nm, and the fluorescence intensity distribution was quantitatively analyzed using ImageJ software.

[0069] The results are as follows Figure 5 shown.

[0070] The applicant states that the present invention uses the above-described embodiments to illustrate the preparation method of a biomimetic material simulating oral masticatory mucosa, its products, and applications. However, the present invention is not limited to the above-described embodiments, nor does it necessarily rely on the above-described embodiments for implementation. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions for raw materials in the present invention's products, addition of auxiliary ingredients, and selection of specific methods, etc., fall within the scope of protection and disclosure of the present invention.

[0071] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0072] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

Claims

1. A method for preparing a bionic material simulating oral masticatory mucosa, characterized in that: The preparation method comprises: (1) cloning a gene encoding a protein containing VPGXG repeating units into an expression vector to obtain a first expression vector; The gene encoding the protein containing the VPGXG repeating unit is cloned into an expression vector, and a cysteine is added to each end of the protein to obtain a second expression vector; (2) respectively transferring the first expression vector and the second expression vector into competent cells for protein expression, separation, and purification to obtain the first expression vector protein and the second expression vector protein; (3) Mix the first expression vector protein, the second expression vector protein and the multi-arm PEG-MAL solution to obtain.

2. The method for preparing a bionic material simulating oral masticatory mucosa according to claim 1, characterized in that: The number of repetitions of the repeating units is independently 10-100.

3. The method for preparing a bionic material simulating oral masticatory mucosa according to claim 1 or 2, characterized in that: The expression vector contains a His tag.

4. The method for preparing a bionic material simulating oral masticatory mucosa according to any one of claims 1 to 3, characterized in that: The number of arms in the multi-arm PEG-MAL solution is 4-10.

5. The method for preparing a bionic material simulating oral masticatory mucosa according to any one of claims 1 to 4, characterized in that: The final concentration of the protein in step (3) is 10-500 mg / mL; Preferably, in step (3), the mass ratio of the first carrier protein to the second carrier protein is 1:(3.5-5.5); Preferably, the final concentration of multi-arm PEG-MAL in step (3) is 10-500 mg / mL.

6. The method for preparing a bionic material simulating oral masticatory mucosa according to any one of claims 1 to 5, characterized in that: The expression conditions are: temperature of 10-37° C., time of 4-24 h, and induction with 0.1-2 mM IPTG.

7. The method for preparing a bionic material simulating oral masticatory mucosa according to any one of claims 1 to 6, characterized in that: The purification includes the use of Co 2+ -NTA protein resin purification and dialysis to obtain.

8. A bionic material simulating oral masticatory mucosa prepared by the method for preparing a bionic material simulating oral masticatory mucosa according to any one of claims 1 to 7.

9. Use of the bionic material simulating oral masticatory mucosa according to claim 8 in gas composition testing or cell culture.

10. Use of the biomimetic material simulating oral masticatory mucosa according to claim 8 in drug release research.

Images