The application of alfalfa MsCEPR1 gene and the protein coded by the gene in alfalfa low-phosphorus stress tolerance

By cloning and overexpressing the MsCEPR1 gene of alfalfa, an overexpression vector was constructed and transferred into alfalfa, which solved the problems of growth and phosphorus absorption efficiency of alfalfa under low phosphorus stress and achieved stronger phosphorus absorption and transport capabilities.

CN120485231BActive Publication Date: 2025-11-18INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510623093.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-15
Publication Date
2025-11-18
Estimated Expiration
2045-05-15

AI Technical Summary

Technical Problem

Existing research has failed to systematically elucidate the molecular regulatory mechanisms of alfalfa root morphogenesis, especially the function of CEPR1 in phosphorus uptake, which affects its growth and phosphorus uptake efficiency under low phosphorus stress.

Method used

The MsCEPR1 gene of alfalfa was cloned and expressed. The overexpression vector pCAMBIA3301-MsCEPR1 was constructed and transformed into alfalfa by Agrobacterium-mediated infection to overexpress the MsCEPR1 protein, thereby promoting phosphorus absorption and root growth.

Benefits of technology

It improved the growth performance of alfalfa under low phosphorus stress, enhanced phosphorus absorption and translocation efficiency, alleviated aboveground growth inhibition, and maintained the stability of the photosynthetic system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485231B_ABST
    Figure CN120485231B_ABST
Patent Text Reader

Abstract

The application discloses an application of Medicago sativa MsCEPR1 gene and protein coded by the same in low-phosphorus stress tolerance of Medicago sativa and belongs to the technical field of plant genetic engineering. The Medicago sativa MsCEPR1 gene provided in the application has a nucleotide sequence as shown in SEQ ID NO. 1. The application preliminarily reveals the regulation of CEPR1 on phosphorus absorption related genes by exploring the function of CEPR1 in phosphorus absorption, provides a basis for constructing a molecular network of CEPR1 regulating phosphorus absorption, and provides a direction for cultivating Medicago sativa varieties with high phosphorus absorption, which has important significance for reducing the dependence on phosphorus fertilizer and sustainable agricultural development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of plant genetic engineering technology, and in particular relates to the application of an alfalfa MsCEPR1 gene and its encoded protein in alfalfa tolerance to low phosphorus stress. Background Technology

[0002] Phosphorus, as a core structural element constituting key biomolecules in soil, plays a crucial role in plant growth and development. Previous studies have found a close link between phosphorus uptake and root morphology, and that phosphorus deficiency can also drive root morphological remodeling. However, current research largely focuses on comparing and screening root configurations with high phosphorus uptake efficiency; the core regulatory elements influencing phosphorus uptake remain unclear.

[0003] Plant C-terminally encoded peptides (CEPs) are mature polypeptides with specific biological activities formed by the hydrolysis of precursor peptides. They are a novel class of plant polypeptide hormones with functions similar to traditional plant hormones. C-terminally encoded peptide receptor kinases (CEPRs) were first identified in Arabidopsis thaliana and have functions in regulating root growth and development, modulating nitrogen uptake, and responding to abiotic stresses. While the functions of CEPs and CEPRs in nitrogen uptake are largely understood, their functions in phosphorus uptake are still in their early stages.

[0004] Alfalfa, an excellent legume forage, has root types classified into rhizomatous, taproot (or axial root), tiller, and lateral root types. Phosphorus uptake in alfalfa is closely related to its root morphology. Previous studies have shown that alfalfa with different root morphologies exhibits varying tolerance to low phosphorus stress, with tiller-type alfalfa showing stronger tolerance than taproot and rhizomatous types. Current research largely focuses on screening root phenotypes for efficient phosphorus absorption, lacking a systematic analysis of the molecular regulatory mechanisms controlling alfalfa root morphogenesis. Although genes such as WOX and LBD have been confirmed to regulate lateral root development in Arabidopsis, the functional conservation and species specificity of these key genes in alfalfa still require further verification. Furthermore, the complex root architecture of alfalfa (such as multi-level branching and tiller structure) significantly increases the difficulty of studying its morphogenesis molecular network. Meanwhile, research on the molecular mechanisms of phosphorus absorption in alfalfa remains limited. For example, the functional differentiation of core regulatory elements of phosphorus signaling has not been systematically elucidated, and the relationship between root morphology characteristics and phosphorus absorption-related genes is still unclear. Summary of the Invention

[0005] To overcome the aforementioned deficiencies in the existing technology, this application provides an application of the alfalfa MsCEPR1 gene and its encoded protein in alfalfa tolerance to low phosphorus stress. By exploring the function of CEPR1 in phosphorus absorption, its regulatory role on phosphorus absorption-related genes is preliminarily revealed, providing a basis for constructing a molecular network for CEPR1 to regulate phosphorus absorption.

[0006] To achieve the above-mentioned objectives, this application provides the following technical solution:

[0007] On the one hand, this application provides an alfalfa MsCEPR1 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] Secondly, this application provides an alfalfa MsCEPR1 protein, which is encoded by the aforementioned alfalfa MsCEPR1 gene, and the amino acid sequence of the alfalfa MsCEPR1 protein is shown in SEQ ID NO.2.

[0009] Thirdly, this application provides an expression vector, genetically engineered bacteria, or transgenic cell line containing the aforementioned alfalfa MsCEPR1 gene.

[0010] Fourthly, this application provides the application of the aforementioned alfalfa MsCEPR1 gene or alfalfa MsCEPR1 protein in improving the plant's resistance to phosphorus stress.

[0011] Optionally, improving the plant's resistance to phosphorus stress includes promoting the growth of the aboveground parts and roots of the plant under low phosphorus stress, and promoting the absorption and transport of phosphorus in the plant under low phosphorus stress.

[0012] Optionally, the plant includes alfalfa.

[0013] Optionally, the low phosphorus stress growth conditions are: using 50 μmol·L⁻¹ -1 KH2PO4 is treated to reduce phosphorus content.

[0014] Optionally, the promotion of phosphorus uptake and transport in plants under low phosphorus stress is achieved by upregulating the expression of the PHO1, PHR2 and PHT1 genes.

[0015] Fifthly, this application provides a method for improving the phosphorus stress resistance of plants, comprising the following steps:

[0016] (1) The above-mentioned alfalfa MsCEPR1 gene was amplified by PCR and the target fragment was recovered by gel extraction;

[0017] (2) Construct the recombinant plasmid pTOPO-TA-MsCEPR1;

[0018] (3) Construct the overexpression vector pCAMBIA3301-MsCEPR1;

[0019] (4) The overexpression vector pCAMBIA3301-MsCEPR1 was transferred into the target plant to obtain transgenic plants;

[0020] The plants include alfalfa.

[0021] Optionally, in step (1), the upstream and downstream primer sequences for PCR amplification are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0022] Optionally, in step (2), the method for constructing the recombinant plasmid pTOPO-TA-MsCEPR1 includes:

[0023] The target fragment of the alfalfa MsCEPR1 gene obtained in step (1) was ligated into the pTOPO-TA vector, transformed into Escherichia coli, positive clones were screened and sequenced to verify, and the recombinant plasmid pTOPO-TA-MsCEPR1 was obtained.

[0024] Optionally, the reaction system for the ligation is: ddH2O 1.8–2.2 μL, MsCEPR1 gene fragment 1.8–2.2 μL, 10×Enhancer 0.4–0.6 μL, pTOPO-TA vector 0.4–0.6 μL;

[0025] The reaction conditions for the connection are: 35-37°C, 10-15 min.

[0026] Preferably, the reaction system for the ligation is: 2 μL ddH2O, 2 μL MsCEPR1 gene fragment, 0.5 μL 10×Enhancer, and 0.5 μL pTOPO-TA vector;

[0027] The reaction conditions for the connection are: 37°C for 15 minutes.

[0028] Optionally, in step (3), the method for constructing the overexpression vector pCAMBIA3301-MsCEPR1 includes:

[0029] S1. Using the recombinant plasmid pTOPO-TA-MsCEPR1 obtained in step (2) as a template, design upstream and downstream primers to amplify the MsCEPR1 fragment containing the NcoⅠ restriction site, namely p3301-MsCEPR1.

[0030] S2. The pCAMBIA3301 vector was digested with NcoI enzyme;

[0031] S3. The enzyme-digested pCAMBIA3301 vector and the p3301-MsCEPR1 were seamlessly cloned and ligated, transformed into E. coli, positive clones were screened and sequenced for verification, and the overexpression vector pCAMBIA3301-MsCEPR1 was obtained.

[0032] Optionally, in step S1, the sequences of the upstream and downstream primers are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0033] Optionally, in step S2, the enzymatic digestion reaction system is: ddH2O 35-35.2 μL, pCAMBIA330 18-9 μL, 10×Buffer 4-6 μL, NcoⅠ enzyme 0.8-1.2 μL;

[0034] The enzyme digestion reaction conditions are: 35–37°C, 1.5–2.5 h.

[0035] Preferably, in step S2, the enzymatic digestion reaction system is: ddH2O 35.1 μL, pCAMBIA330 18.9 μL, 10×Buffer 5 μL, NcoⅠ enzyme 1 μL;

[0036] The enzyme digestion reaction conditions were: 37℃, 2h.

[0037] Optionally, in step S3, the reaction system for the seamless cloning ligation consists of 3–5 μL of ddH2O, 1.8–2.2 μL of enzyme-digested pCAMBIA3301, 2.8–3.2 μL of 2×Seamless Master Mix, and 0.8–1.2 μL of p3301-MsCEPR1.

[0038] The reaction conditions for the seamless cloning connection are: 48–52 °C, 28–32 min.

[0039] Preferably, in step S3, the reaction system for the seamless cloning ligation consists of 4 μL of ddH2O, 2 μL of enzyme-digested pCAMBIA3301, 3 μL of 2×Seamless Master Mix, and 11 μL of p3301-MsCEPR1.

[0040] The reaction conditions for the seamless cloning were: 50°C for 30 minutes.

[0041] Optionally, in step (4), the method of transformation includes Agrobacterium-mediated leaf disc transformation.

[0042] Compared with the prior art, this application has the following advantages:

[0043] (1) This application successfully cloned the MsCEPR1 gene and its encoded protein full-length sequence from alfalfa 'Zhongmu 4'. Bioinformatics analysis revealed the basic characteristics of MsCEPR1, which exhibits typical extracellular LRR domains, transmembrane helices, and intracellular serine / threonine kinase domains, consistent with the molecular characteristics of leucine-rich receptor kinases (LRR-RLKs). Promoter cis-acting element prediction showed that the MsCEPR1 gene promoter region is enriched with stress-response elements, suggesting its potential involvement in stress responses. Real-time quantitative PCR analysis showed that the expression of the MsCEPR1 gene varied across different time periods and tissues. These results reveal the molecular characteristics and expression patterns of MsCEPR1, providing a molecular biological basis for further research into its biological functional mechanisms.

[0044] (2) Based on homologous recombination, this application successfully constructed the overexpression vector pCAMBIA3301-MsCEPR1. The overexpression vector was transformed into alfalfa using Agrobacterium-mediated infection. After verification by PCR with specific primers, alfalfa plants overexpressing MsCEPR1 were obtained. This provides a key experimental system for studying the function of the gene in root growth and development and phosphorus uptake, and improves the available germplasm resources for alfalfa molecular breeding.

[0045] (3) This application used wild-type alfalfa (WT) and lines with different fold increases in the MsCEPR1 gene (OE1, OE13) as materials. Two culture conditions were set up: normal phosphorus (NP) and low phosphorus (LP). The changes in growth parameters (plant height, root length, aboveground and root fresh weight), total phosphorus content, and chlorophyll content of different lines were compared. The results showed that low phosphorus stress significantly affected alfalfa growth: aboveground growth was inhibited in all lines, while root biomass showed compensatory growth. The MsCEPR1 overexpressing lines exhibited stronger tolerance to low phosphorus. Compared to WT plants under low phosphorus conditions, the overexpressing lines showed significantly reduced inhibition in plant height and aboveground growth, indicating that MsCEPR1 gene overexpression can effectively alleviate the inhibition of aboveground growth by low phosphorus and promote root growth. Meanwhile, total phosphorus content analysis showed that the overexpressing lines had stronger phosphorus absorption and translocation efficiency. The expression levels of phosphorus absorption and translocation-related genes further demonstrated that MsCEPR1 promotes phosphorus absorption and translocation by increasing the expression of these genes. Furthermore, the chlorophyll content in older leaves of the overexpressing lines was significantly higher than that of the WT lines, suggesting that they better maintain photosynthetic system stability. In summary, MsCEPR1 overexpression alleviates the growth inhibition of aboveground parts under low phosphorus stress, promotes root growth, and regulates phosphorus absorption and translocation in alfalfa by upregulating phosphorus absorption and translocation-related genes. Attached Figure Description

[0046] To more clearly illustrate the technical solutions of the embodiments of this application, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of this application and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0047] Figure 1 This is the transmembrane structure of MsCEPR1 in this application;

[0048] Figure 2 Prediction of phosphorylation sites for MsCEPR1 in this application;

[0049] Figure 3 This application describes the protein secondary structure of MsCEPR1.

[0050] Figure 4 This is the conservative structural domain of MsCEPR1 in this application;

[0051] Figure 5 This is a cytoplasmic map showing the subcellular localization of the MsCEPR1 protein in this application (Note: (a) shows the fluorescence signal distribution of p35S:MsCEPR1-GFP (green fluorescence) in tobacco protoplasts. Chloroplast channels are marked in red. The merged image shows that the GFP signal is localized in the cytoplasm. Scale bar: 10 μm; (b) shows the signal distribution of the negative control: p35S-GFP (green fluorescence) in the same tissue, with no specific localization).

[0052] Figure 6 This paper presents the expression patterns of MsCEPR1 in different tissues of 10-day-old and 4-week-old seedlings (Note: (a) shows the expression patterns of MsCEPR1 in different tissues of 10-day-old seedlings; (b) shows the expression patterns of MsCEPR1 in different tissues of 4-week-old seedlings. Different letters indicate significant differences at the P < 0.05 level).

[0053] Figure 7 Genetic transformation and identification of alfalfa overexpressing the MsCEPR1 gene for this application (Note: (a) shows the map of the MsCEPR1 gene overexpression vector; (b)-(i) show the tissue culture process of alfalfa transformed by the MsCEPR1 gene overexpression vector; (j) shows the PCR identification of plants overexpressing the MsCEPR1 gene: "-" negative control (WT), "+" positive control (pCAMBIA3301-MsCEPR1); (k) shows the relative expression level of positive alfalfa plants overexpressing the MsCEPR1 gene, OE1-OE13 represent alfalfa lines with different fold increases in MsCEPR1 expression level, and different letters indicate significant differences between different lines at the P<0.05 level).

[0054] Figure 8 Phenotypic analysis of alfalfa under low phosphorus treatment in this application (Note: (a) represents the phenotype of alfalfa (WT, OE1, OE13) under normal phosphorus (NP) growth conditions; (b) represents the phenotype of alfalfa (WT, OE1, OE13) under low phosphorus (LP) growth conditions; (c)-(f) represent the plant height (cm), root length (cm), aboveground fresh weight (g), and root fresh weight (g) of alfalfa (WT, OE1, OE13) under NP and LP conditions; different letters indicate significant differences between different treatments at the P < 0.05 level).

[0055] Figure 9 For the analysis of total phosphorus content in alfalfa under low phosphorus treatment in this application (Note: different letters indicate significant differences between different treatments at the P < 0.05 level);

[0056] Figure 10 This study analyzed the chlorophyll content of older leaves of alfalfa under low phosphorus treatment (Note: (a) represents the phenotype of older leaves (3rd-4th leaves from the base) under normal phosphorus (NP) and low phosphorus (LP) growth conditions of alfalfa (WT, OE1, OE13); (b) represents the analysis of total chlorophyll content of older leaves of alfalfa (WT, OE1, OE13) under NP and LP conditions; different letters in the figure indicate significant differences between different treatments at the P < 0.05 level).

[0057] Figure 11 This paper presents the expression analysis of phosphorus absorption and transport-related genes in alfalfa (Note: (a) represents the relative expression level of the phosphorus absorption and transport-related gene PHO1 in leaves of different plant materials under normal phosphorus (NP) and low phosphorus (LP) conditions; (b) represents the relative expression level of the phosphorus absorption and transport-related gene PHR2 in leaves of different plant materials under normal phosphorus (NP) and low phosphorus (LP) conditions; (c) represents the relative expression level of the phosphorus absorption and transport-related gene PHT1 in leaves of different plant materials under normal phosphorus (NP) and low phosphorus (LP) conditions; different letters in the figure indicate significant differences between different treatments at the P < 0.05 level). Detailed Implementation

[0058] The present application is further illustrated below with reference to specific embodiments. The following descriptions are merely a few embodiments of the present application and are not intended to limit the present application in any way. Although the present application discloses preferred embodiments as follows, they are not intended to limit the present application. Any modifications or variations made by those skilled in the art without departing from the scope of the technical solution of the present application using the disclosed technical content are equivalent to equivalent implementation cases and all fall within the scope of the technical solution.

[0059] Unless otherwise specified, the raw materials used in the embodiments of this application are all purchased commercially and used directly without any special treatment.

[0060] Unless otherwise specified, the analytical methods in the embodiments all adopt conventional instrument or equipment settings and conventional analytical methods.

[0061] Example 1

[0062] I. Analysis of the molecular characteristics and expression pattern of MsCEPR1

[0063] (I) Materials and Methods

[0064] 1. Test materials

[0065] The plant materials used were alfalfa 'Zhongmu 4' and Nicotiana benthamiana. The alfalfa 'Zhongmu 4' was propagated and preserved by our laboratory and provided by us. The seed material of Nicotiana benthamiana was purchased from Beijing Coolbo Technology Co., Ltd.

[0066] 2. The experimental instruments, reagents, and culture medium formulations are shown in Tables 1, 2, and 3, respectively.

[0067] Table 1 Test Instruments

[0068]

[0069]

[0070] Table 2 Test Reagents

[0071]

[0072]

[0073] Table 3 LB Culture Medium Formulation

[0074] Reagent Amount Yeast Extract 5g Tryptone 10g NaCl 10g Agar powder 15g ddH2O To 1 L

[0075] 3. Cloning of the MsCEPR1 gene

[0076] (1) MsCEPR1 gene amplification

[0077] Total RNA was extracted from mature leaves of four-week-old alfalfa 'Zhongmu 4' and reverse-engineered into cDNA. Using the CDS sequence of the MsCEPR1 gene (Msa.H.0177440) in the genome as a reference sequence, Primer 5 was used to design and amplify MsCEPR1-F / R (where the sequence of MsCEPR1-F is shown in SEQ ID NO.3: CAACACTTCAAATTCTTCTCTC; the sequence of MsCEPR1-R is shown in SEQ ID NO.4: GAGACTGCTTATGTTCTTAGTTG). Using the reverse-engineered cDNA as a template, the MsCEPR1 gene was amplified using the Extaq enzyme, and the reaction system is shown in Table 4.

[0078] Table 4. PCR amplification system of MsCEPR1 gene

[0079] Reagent Amount Ex Taq 0.3 μL dNTP Mix 4 μL 10 x Ex Taq Buffer 5 μL MsCEPR1-F 2 μL MsCEPR1-R 2 μL cDNA 2 μL ddH2O 34.7 μL

[0080] PCR amplification program: 95℃ for 5 min; 95℃ for 30 s; 52℃ for 30 s; 72℃ for 3 min 15 s; 29 cycles; 72℃ for 5 min. PCR products were subjected to 1% agarose gel electrophoresis for 10 min to obtain the MsCEPR1 band.

[0081] (2) Gel extraction and recovery of PCR products

[0082] Cut the target band and place it into a clean centrifuge tube. Weigh the tube and add 3 times the volume of GSB dissolution buffer (as provided with the kit). Transfer all the liquid to the nucleic acid adsorption column. After standing at room temperature for 60 seconds, centrifuge at 10,000×g for 60 seconds to completely remove the filtrate.

[0083] Add 650 μL of WB washing buffer (as provided with the kit) to the adsorption column and centrifuge at the same parameters (10,000 × g / 1 min). Repeat this step once, for a total of two washing processes.

[0084] Centrifuge the column for 2 minutes (10,000 × g) to ensure complete evaporation of residual ethanol. Transfer the adsorption column to a new collection tube and allow it to air dry at room temperature for 5 minutes with the cap off.

[0085] Precisely add 30 μL of preheated (65℃ constant temperature) sterile ultrapure water to the center of the adsorption membrane. After standing for 60 seconds to allow permeation, collect the purified product by high-speed centrifugation (10,000×g / 1min). Measure the concentration using a spectrophotometer and store at -20℃ for subsequent experiments.

[0086] (3) Ligation and transformation of cloning vector pTOPO-TA-MsCEPR1

[0087] Cloning vector ligation: 37℃, 15 min. The ligation system is shown in Table 5.

[0088] Table 5 pTOPO-TA-MsCEPR1 Connection System

[0089] Reagent Reaction system ddH2O 2 μL MsCEPR1 2 μL 10 x Enhancer 0.5 μL pTOPO-TA 0.5 μL Total 5 μL

[0090] After ligation, the ligation product was transformed into competent colon cells, as follows:

[0091] Add 5 μL of the ligation product to a 1.5 mL centrifuge tube containing 50 μL of freshly thawed E. coli competent cells, and gently tap the tube wall to mix. Incubate on ice for 30 minutes, then heat shock at 42°C for 60 seconds, and immediately transfer to an ice bath for 3 minutes.

[0092] Add 500 μL of LB liquid to a clean bench and place it in a constant temperature shaker at 37°C and 200 rpm for 1 h to restore cell viability;

[0093] Centrifuge at 4000 rpm for 1 min, remove part of the supernatant and resuspend in 200 μL. Spread evenly on the surface of LB solid medium containing 100 mg / L ampicillin (Amp) and incubate upside down at 37°C for 12-16 hours until single colonies form.

[0094] (4) Bacterial culture identification and sequencing

[0095] Single colony resuspensions were used as PCR templates, and PCR identification was performed using universal primers M13F (sequence shown in SEQ ID NO. 7: TGTAAAACGACGGCCAGT) and M13R (sequence shown in SEQ ID NO. 8: CAGGAAACAGCTATGACC) from the vector. The reaction system is shown in Table 6.

[0096] Table 6. PCR reaction system of pTOPO-TA-MsCEPR1 bacterial culture

[0097] Reagent Reaction system ddH2O 3 μL pTOPO-TA-MsCEPR1 bacteria liquid 1 μL 2 x PCR Mix 5 μL M13F 0.5 μL M13R 0.5 μL Total 10 μL

[0098] PCR amplification program: 95℃ for 5 min; 95℃ for 30 s; 52℃ for 30 s; 72℃ for 3 min 15 s; 34 cycles; 72℃ for 5 min. PCR amplification products were analyzed by 1% high-resolution agarose gel electrophoresis at 120V constant voltage for 10 min. Positive clones with band sizes consistent with the expected insert were sent to Qingke Biotechnology for bidirectional sequencing, and the reference sequence of MsCEPR1 was obtained by alignment.

[0099] 4. Bioinformatics analysis of the MsCEPR1 gene

[0100] Protein characterization was performed using EXPASY software (https: / / www.expasy.org / ) (DUVAUD et al., 2021), including amino acid number, isoelectric point, molecular weight, instability coefficient, lipid coefficient, and protein hydrophilicity / hydrophobicity. Transmembrane topology prediction was performed using TMHMM Server v2.0 (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ) based on a Hidden Markov Model algorithm. Transmembrane domain prediction was performed using the online website TMHMM-2.0 (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ), phosphorylation site analysis was performed using the online analysis website (https: / / npsa.lyon.inserm.fr / ) (COMBET et al., 2000), and secondary structure prediction was performed using the online website (https: / / web.expasy.org / protscale / ) (GASTEIGER et al., 2003). Promoter cis-acting elements were predicted using PlantCARE (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) (ROMBAUTS et al., 1999). The results were then organized and simplified according to different promoter categories (light-responsive elements, hormone and stress-related elements, and growth and development-related elements) before statistical analysis. Conserved domain predictions were performed using the online analysis software SMART (https: / / smart.embl.de / ) (LETUNIC et al., 2021).

[0101] 5. Subcellular localization of MsCEPR1 protein

[0102] (1) Construction of expression vector

[0103] S1, vector digestion

[0104] The enzyme digestion system is shown in Table 7.

[0105] Table 7 p35S: GFP vector digestion system

[0106] Reagent Reaction system Nuclease-free Water 13 μL 10 x Buffer 2 μL BsaI / Eco31I 1 μL p35S:GFP 4 μL Total 20 μL

[0107] After reacting at 37°C for 1 hour, the vector digestion product was purified using a PCR purification kit. The purified product was labeled as p35S:GFP-Cut and used for the next recombination reaction.

[0108] The specific steps for PCR product purification are as follows:

[0109] Add 3 times the volume of GSB dissolution buffer (as per the kit) based on the measured mass;

[0110] Transfer all liquid to the nucleic acid adsorption column, let stand at room temperature for 60 seconds, and then centrifuge at 10,000×g for 60 seconds to completely remove the filtrate.

[0111] Inject 650 μL of WB washing buffer (kit-specific) into the adsorption column and centrifuge to wash with the same parameters (10,000×g). Repeat this step once, for a total of two washing processes.

[0112] Centrifuge the column for 2 minutes (10,000×g) to ensure that the residual ethanol has completely evaporated. Transfer the adsorption column to a new collection tube and allow it to air dry at room temperature for 5 minutes with the cap off.

[0113] 30 μL of preheated (65℃ constant temperature) sterile ultrapure water was precisely added to the center of the adsorption membrane. After standing for 60 seconds for permeation, the purified product was collected by high-speed centrifugation (10,000×g). The concentration was measured using a spectrophotometer and then stored at -20℃ for subsequent experiments.

[0114] S2, Recombination reaction

[0115] The reaction system is shown in Table 8.

[0116] Table 8 p35S: MsCEPR1-GFP ligation system

[0117] Reagent Reaction system Nuclease-free Water 0 μL Biorun 2 x EasyClone Mix 10 μL MsCEPR1 5 μL p35S:GFP-Cut 5 μL Total 20 μL

[0118] After reacting at 37°C for 30 minutes, the ligation product p35S:MsCEPR1-GFP was transformed into competent colon cells, and the operation method was the same as described above.

[0119] S3, p35S:GFP-MsCEPR1 colony PCR identification

[0120] Ten colonies were selected, re-inoculated into 1.5 mL centrifuge tubes, and then identified by PCR. The primers used were p35S:MsCEPR1-GFP-F / R (wherein, the sequence of p35S:MsCEPR1-GFP-F is as shown in SEQ ID NO.9: TTCATTTGGAGAGAACACGGGGGAC; p35S:MsCEPR1-GFP-R is as shown in SEQ ID NO.10: GGATGGTGGAATTTGACCATG). The reaction system is shown in Table 9.

[0121] Table 9 p35S: PCR identification reaction system for MsCEPR1-GFP bacterial culture

[0122] Reagent Reaction system Nuclease-free Water 9.5 μL Biorun Magic PCR Mix 12.5 μL p35S:MsCEPR1-GFP-F 1 μL p35S:MsCEPR1-GFP-R 1 μL Template 1 μL Total volume 25 μL

[0123] PCR amplification program: 94℃ for 5 min; 94℃ for 30 s; 50℃ for 45 s; 72℃ for 174 s; 34 cycles; 72℃ for 10 min; 16℃ for 30 min. After PCR, the target band was confirmed to be approximately 662 bp by 1% agarose gel electrophoresis. 200 μL of the bacterial culture corresponding to the positive band was sent to the company for sequencing, and the remaining bacterial culture was temporarily stored at 4℃. After confirming the sequence was correct, the corresponding bacterial culture was stored in 40% glycerol, and the corresponding bacterial culture was re-inoculated into 50 mL of LB globulin containing 50 mg / L Kan antibiotics. After incubation at 37℃ for approximately 8 h, the plasmid was extracted and named p35S:MsCEPR1-GFP.

[0124] The plasmid extraction method is as follows:

[0125] S1. Transfer the bacterial culture to a 50mL centrifuge tube, centrifuge at the maximum speed for 10 minutes, and discard the supernatant.

[0126] S2. Add 250 μL of pre-cooled Solution I (stored at 4°C) to the bacterial pellet and vortex vigorously for 20 seconds to ensure complete resuspension of the bacterial cells.

[0127] S3. Slowly add 250 μL Solution II and gently mix 5 times (avoid violent shaking). Stop when the solution becomes transparent and viscous. The whole process should be completed within 5 minutes.

[0128] S4. Immediately inject 350μL SolutionⅢ and quickly invert and mix 7 times until flocculent precipitate appears.

[0129] S5. Place the reaction system at room temperature and centrifuge at 10,000×g for 10 minutes.

[0130] S6. Carefully pipette the supernatant into the adsorption column (with a matching 2mL collection tube) and centrifuge at 10,000×g for 1 minute.

[0131] S7. After resetting the adsorption column, add 500 μL of HB Buffer and centrifuge at 10,000 × g for 1 minute to remove impurities.

[0132] S8. Inject 700 μL of WB washing buffer, centrifuge at 10,000 × g for 1 minute, and repeat twice.

[0133] S9. Centrifuge the adsorption column at 13,000×g for 2 minutes to ensure that any residual ethanol on the membrane surface is completely evaporated.

[0134] S10. Transfer the purification column to a sterile 1.5 mL centrifuge tube, add 40 μL of preheated (65 °C) sterile water, let it stand for 2 minutes, and then centrifuge at 10,000 × g for 1 minute to elute.

[0135] S11. The collected plasmid deoxyribonucleic acid (DNA) solution was immediately subjected to concentration determination, aliquoted, and stored at -20℃ for long-term cryogenic storage.

[0136] (2) Transient transfection of tobacco protoplasts

[0137] S1, Plant Material Culture

[0138] Take healthy, unfolded leaves from tobacco seedlings that have grown for 20 days in a 25℃ constant temperature incubator.

[0139] S2, Protoplast Release

[0140] Leaf tissue was placed in 10 mL of enzymatic hydrolysis solution (1.5% Cellulase R10, 0.4% Macerozyme R10, 0.4 M Mannitol, 20 mM KCl, 10 mM MES, pH adjusted to 5.8, heated at 55 °C for 10 min, mixed by inverting three times, cooled to room temperature, and then 10 mM CaCl2, 0.1% BSA, and ddH2O were added to a final volume of 10 mL. The solution was then filtered through a 0.22 μm filter membrane for sterilization, ensuring complete immersion of the tissue. The tissue was incubated at 24 °C in the dark for 4 hours for enzymatic hydrolysis.

[0141] S3, Protoplast Purification

[0142] After enzymatic hydrolysis, the mixture was filtered through a 40μm sterile cell sieve, transferred to a 15mL centrifuge tube, and centrifuged at 300rpm for 3min, retaining the precipitated protoplasts.

[0143] S4. Washing and Resuspension

[0144] Add 10 mL of pre-cooled W5 solution (154 mM NaCl, 125 mM CaCl2, 2 mM KH2PO4, 2 mM MES, 5 mM Glucose, adjust pH to 5.8, add ddH2O to 100 mL, sterilize at 110 °C, and store at 4 °C) to the precipitate, resuspend, and centrifuge at 300 rpm for 3 minutes (centrifugation temperature 4-25 °C). Repeat the washing twice. Add 2 mL of MMG solution (0.4 M Nitol, 15 mM MgCl2·6H2O, 4 mM MES, adjust pH to 5.8, add ddH2O to 10 mL) to resuspend the protoplasts according to experimental requirements, and adjust the final concentration to 2 × 10⁻⁶. 5 Protoplasts were observed to be intact (round and plump, with a rupture rate of <5%).

[0145] S5, Preparation of DNA-Protoplast Complex

[0146] Mix 100 μL of protoplast suspension with 10 μL of plasmid DNA (p35S: MsCEPR1-GFP / p35S-GFP). Add an equal volume of 40% PEG4000 solution (0.2 M Mannitol, 100 mM CaCl2, 40% PEG4000, pH adjusted to 5.8, ddH2O added to 10 ml), gently vortex to mix, and incubate at room temperature for 10-15 minutes.

[0147] S6. Termination of transformation and cultivation

[0148] The reaction was terminated by adding 1 mL of pre-cooled W5 solution. The protoplasts were collected by centrifugation at 300 rpm for 3 minutes, and the supernatant was discarded. The protoplasts were washed twice with 1 mL of W5 solution and finally resuspended in 1 mL of W5 solution. The protoplasts were then incubated in the dark at 25 °C for 24 hours.

[0149] S7, Fluorescence Detection

[0150] After culture, centrifuge to remove the supernatant, retain about 100 μL of protoplast suspension, add it to a glass slide, and immediately observe the green fluorescent protein (GFP) signal (GFP excitation wavelength 488 nm, emission wavelength 510 nm; chloroplast excitation light 640 nm, emission light 675 nm) using a fluorescence microscope or laser confocal microscope.

[0151] (3) Analysis of the expression pattern of the MsCEPR1 gene

[0152] Heatmaps of gene expression patterns were created using a heatmap program. RNA was extracted using the Eastep Super Total RNA Extraction Kit (Promega Biotechnology, Shanghai) and reverse transcribed into complementary deoxyribonucleic acid (cDNA) using HiScript III All-in-one RT SuperMixPerfect for qPCR (Novozymes, Nanjing). The relative expression level of MsCEPR1 was detected using real-time quantitative PCR with qMsCEPR1-F / R as primers (where the sequence of qMsCEPR1-F is shown in SEQ ID NO.11: GTTTGCAAGCAAGAGGTGGA; the sequence of qMsCEPR1-R is shown in SEQ ID NO.12: TCAATTGGCTTCCTCCCAGT). The experiments were performed using a Bio-Rad CFX96 real-time PCR instrument. The reaction mixture consisted of 10 μL Taq Pro Universal SYBRqPCR Master Mix, 0.4 μL forward primer, 0.4 μL reverse primer, 2 μL cDNA, and 7.2 μL sterile water. The reaction program was 95℃ for 2 min, 95℃ for 5 s, and 60℃ for 30 s, for 40 cycles. Melting curves were set at the end of the reaction to confirm product specificity. Each treatment group included three independent biological replicates. Based on the raw Ct values ​​from real-time quantitative PCR, a 23... -ΔΔCt The method calculates the relative expression level of genes.

[0153] (II) Results and Analysis

[0154] 1. MsCEPR1 gene sequence

[0155]

[0156] 2. Molecular characteristics of MsCEPR1 protein

[0157] To understand the basic characteristics of the MsCEPR1 protein, its molecular properties were predicted. The prediction results show that the molecular formula of the MsCEPR1 protein is C1. 4849 H 7654 N 1254 O 1410 S 40 The molecular weight is 107362.07 Da, and the isoelectric point is 8.33. Leucine (Leu) has the highest proportion in the amino acid composition (13.6%), followed by serine (Ser) (11.5%). The total number of negatively charged amino acid residues is 88, and the total number of negatively charged amino acid residues is 94. The instability coefficient is 36.70, and the lipid index is 99.64, predicting that the MsCEPR1 protein is unstable. Hydrophilicity-hydrophobicity mapping shows that the MsCEPR1 protein exhibits typical hydrophilic characteristics, with an average hydrophobicity index of -0.015. Transmembrane structure prediction indicates that the MsCEPR1 protein has two transmembrane helices, suggesting that MsCEPR1 is a membrane-bound protein kinase. Figure 1 Phosphorylation site prediction identified 93 potential phosphorylation sites, including 65 serine phosphorylation sites, 19 threonine phosphorylation sites, and 9 tyrosine phosphorylation sites. Figure 2 Secondary structure analysis of the MsCEPR1 protein revealed that it is mainly composed of three parts: 33.26% (321 amino acids) of alpha helix, 55.23% (533 amino acids) of random coil, and 11.50% (111 amino acids) of extended strand. Figure 3 ).

[0158] 3. Analysis of conserved domains of MsCEPR1 protein

[0159] To further predict the function of the MsCEPR1 protein, its conserved domains were analyzed. The results showed that ( Figure 4This protein has seven leucine-rich repeats (LRRs) located at positions 94aa–117aa, 164aa–190aa, 238aa–263aa, 287aa–311aa, 335aa–359aa, 479aa–502aa, and 503aa–527aa, one protein kinase domain (S-TKc) (592aa–611aa), and two transmembrane domains (654aa–934aa), which basically conform to the structural characteristics of leucine-rich receptor protein kinases.

[0160] 4. Subcellular localization of MsCEPR1 protein

[0161] To obtain the localization information of MsCEPR1 protein in cells, the p35S:MsCEPR1-GFP vector was transiently expressed in tobacco protoplasts to observe the protein's localization. Microscopic observation revealed that the GFP fluorescent signal was mainly distributed in the cytoplasm, exhibiting obvious granular aggregation. Figure 5 (a)). Compared with the fluorescence distribution of the empty GFP control group ( Figure 5 The specific localization pattern of p35S:MsCEPR1-GFP in (b) suggests that it may be involved in extracellular signal reception and transmission.

[0162] 5. Cis-acting elements of the MsCEPR1 gene promoter

[0163] To further analyze the possible biological functions of the MsCEPR1 gene, the cis-acting elements in the promoter region of the gene were analyzed. It was found that the promoter region is enriched with a variety of hormone response and stress-related regulatory modules, including (1) stress response elements—defense and stress response elements (TC-rich repeats), drought response elements (MBS); (2) plant hormone response elements—abscisic acid response elements (ABRE), gibberellin response elements (P-box, TATC-box), methyl jasmonate response elements (CGTCA-motif, TGACG-motif); (3) light response elements (Box 4, G-Box, 3-AF1 binding site), etc. (see Table 10), indicating that the gene may be involved in some abiotic stress responses.

[0164] Table 10 Analysis of Cis-Action Elements of the MsCEPR1 Promoter

[0165]

[0166] 6. MsCEPR1 gene expression pattern

[0167] To investigate the expression pattern of MsCEPR1 gene in different tissues of alfalfa at different growth stages, the relative expression levels of MsCEPR1 gene in different tissues of 10-day-old seedlings and 4-day-old seedlings were specifically analyzed. The specific results are as follows: (1) In 10-day-old seedlings, the expression level of MsCEPR1 gene was lowest in true leaves and highest in epicotyl, which was 4.12 times that of true leaves. The expression levels were followed by hypocotyl, root tip and cotyledon, which were 3.61 times, 2.92 times and 2.41 times that of true leaves, respectively. Figure 6 (a) suggests that it may play an important role in hypocotyl elongation and primary vascular tissue development; (2) by the four-week seedling stage, the expression pattern of MsCEPR1 gene changes, with the highest expression level in mature leaves, which is 2.38 times that in young leaves, stems and lateral roots, followed by the main root (1.89 times). Figure 6 (b) in the text suggests that this expression pattern may be related to its involvement in root symbiotic signal transduction.

[0168] II. Obtaining MsCEPR1 overexpression genetic material

[0169] (I) Materials and Methods

[0170] 1. Experimental Materials and Treatment

[0171] Alfalfa 'Zhongmu 4' was used as the plant material, provided and preserved in the laboratory. Alfalfa sterilization and culture: Alfalfa seeds were placed in 50mL centrifuge tubes, 40mL of ddH2O was added, and the tubes were vortexed for 2min × 3 times. Then, the seeds were sterilized with 75% ethanol for 5min, washed three times again with ddH2O, and then transferred to 30% sodium hypochlorite for 10min. Finally, the seeds were washed three times with ddH2O. After sterilization, the seeds were spread evenly on sterilized filter paper to remove surface moisture, and then transferred to MSO solid medium for dark culture (wrapped in aluminum foil and placed in a 4℃ refrigerator for 3 days). After dark culture, the seeds were transferred to a light incubator for 3 days. At this time, the hypocotyl of the seedlings was about 2cm long. Infection was initiated when two cotyledons had emerged but the seed coat had not completely detached.

[0172] 2. The formulations of the reagents and culture media used in the experiment are shown in Tables 11-15.

[0173] Table 11 Test Reagents

[0174]

[0175]

[0176] Table 12 YEB Formulation

[0177] Reagent Amount / L Yeast Extract 1g MgSO4.7H2O 1g Sucrose 5g Tryptone 10g ddH2O To 1 L

[0178] Table 13 SH3a Formulation

[0179]

[0180]

[0181] Table 14 MSBK Formulation

[0182] Reagent Amount / L MS basal medium 4.43g Sucrose 30g Kinetin 1 mL (1 mg / mL) 6-BA 500 μL (1 mg / mL) ddH2O To 1 L

[0183] Table 15 SH9a Formulation

[0184] Reagent Amount / L S & H Modified basal medium 13.2g Sucrose 10g Iron salt 1 mL (1000 x) Vitamin 1 mL (1000 x) Myo-inositol 2 mL (50 mg / mL) ddH2O To 1 L

[0185] 3. Construction of expression vector for overexpressing the MsCEPR1 gene

[0186] (1) Gene cloning

[0187] Using the previously constructed pTOPO-TA-MsCEPR1 recombinant plasmid as a template, and p3301-MsCEPR1-F / R as primers (wherein, the sequence of p3301-MsCEPR1-F is shown in SEQ ID NO.5: GAACACGGGGGACTCTTGACCATGAACCATCATCAACCATT; the sequence of p3301-MsCEPR1-R is shown in SEQ ID NO.6: AGAAATTTACCCTCAGATCTACCATTAACTCAAATGGTTTCT), the MsCEPR1 gene fragment containing the NcoⅠ restriction site was amplified and named p3301-MsCEPR1. The PCR product was then recovered and purified.

[0188] (2) pCAMBIA3301 vector digestion

[0189] The enzyme digestion system is shown in Table 16.

[0190] Table 16 pCAMBIA3301 vector digestion system

[0191]

[0192]

[0193] Enzyme digestion reaction conditions: 37℃, 2h.

[0194] (3) Recombination reaction

[0195] The recombination reaction system is shown in Table 17.

[0196] Table 17 p3301-MsCEPR1 Recombinant Reactions

[0197] Reagent name Reaction system ddH2O 4 μL pCAMBIA3301 2 μL 2 x Seamless Master Mix 3 μL p3301-MsCEPR1 1 μL Total 10 μL

[0198] Ligation reaction conditions: 50℃, 30 min. After ligation, transform competent E. coli cells and plate them on LB medium resistant to 50 mg / L Kan, following the same procedure as described above.

[0199] (4) Bacterial culture PCR identification and sequencing

[0200] Single clones were selected and identified by PCR using p3301-MsCEPR1-F (sequence shown in SEQ ID NO.5: GAACACGGGGGACTCTTGACCATGAACCATCATCAACCATT) and GUS-R primers (sequence shown in SEQ ID NO.29: AGTTTTTTGATTTCACGGGTTGGGG). Positive single clones were sent to Qingke Biotechnology Co., Ltd. for sequencing. The clones with correct sequencing results were named pCAMBIA3301-MsCEPR1. The bacterial culture was stored in a 1:1 ratio (bacterial culture: glycerol) using 40% glycerol and placed in a -80°C freezer.

[0201] 4. Expression vector transformed into Agrobacterium

[0202] The pCAMBIA3301-MsCEPR1 plasmid was extracted and transformed into Agrobacterium EHA105. The specific operation method is as follows:

[0203] (1) Place 50 μL of LEHA105 competent cells on the surface of an ice box and thaw at low temperature.

[0204] (2) Use a micropipette to introduce the target plasmid DNA (1-5 μL) into the thawed competent cell suspension and gently pipette to mix.

[0205] (3) Ice bath for 10 minutes, liquid nitrogen quick freeze for 5 minutes, 37℃ water bath for 5 minutes, ice bath for 5 minutes.

[0206] (4) Inject 700 μL of antibiotic-free YEB liquid and incubate at 28°C on a constant temperature shaker at 200 rpm for 2 hours.

[0207] (5) Centrifuge at 4000 rpm for 1 min, remove part of the supernatant, and spread the remaining 200 μL onto double-antibiotic YEB solid medium (50 mg / L LRif + 50 mg / L Kan), and incubate in an inverted incubator at 28 ℃ for 48 hours.

[0208] (6) Pick single clones with a diameter of 2-3 mm and inoculate them into 1 m LYEB liquid medium (50 mg / L LRif + 50 mg / L Kan), and culture at 28°C with shaking for 12 hours.

[0209] (7) Use p3301-MsCEPR1-F and GUS-R primers for PCR identification. After confirming that the bacterial solution is positive, preserve the bacteria and store it in a -80℃ refrigerator for later use.

[0210] 5. Genetic transformation and tissue culture methods

[0211] Agrobacterium tumefaciens-mediated leaf disc transformation:

[0212] Preparation of bacterial culture:

[0213] (1) Take the frozen pCAMBIA3301-MsCEPR1 EHA105 engineered strain, inoculate it into YEB liquid medium containing 20 mL of double antibiotics (50 mg / L Lif + 50 mg / L Kan), and culture at 28°C with shaking (200 rpm) until OD. 600 ≈0.8.

[0214] (2) Take the bacterial culture from the previous step and perform a second activation in 50ml LYEB selective culture medium (containing Rif 50 mg / L + Kan 50 mg / L), and incubate at 28℃ with shaking (200 rpm) until OD. 600 ≈0.8.

[0215] Explant preparation:

[0216] (1) Select young leaves of alfalfa “Zhongmu No. 4”, treat with 10% NaClO solution for 10 min by shaking, and rinse with sterile ddH2O 5 times (1 min each time).

[0217] (2) Immerse the sterilized leaves in SH3a medium and sonicate until the leaf margins turn dark green.

[0218] Vacuum co-cultivation:

[0219] (1) Incubate the bacterial suspension with the pretreated leaves and then treat them in a vacuum permeation system for 10 min.

[0220] (2) Incubate at room temperature in the dark with low-speed shaking (70 rpm) for 15 min.

[0221] (3) Use sterile filter paper to absorb the surface moisture and apply SH3a solid culture medium to the back of the leaf.

[0222] (4) Pre-culture in the dark for 24 hours.

[0223] Selective regeneration culture:

[0224] (1) Wash the leaves from the previous step 3-5 times with water containing 2 mg / L cefotaxime (Cef), then place them on SH3a solid medium containing resistance (2 mg / L Cef + 2 mg / L LPPT or 5 mg / L HygB), and subculture every 14 days.

[0225] (2) After callus grows, the callus tissue is transferred to MSBK differentiation medium (2 mg / L Cef + 2 mg / L LPPT or 5 mg / L HygB) and cultured under light.

[0226] (3) When the callus differentiates and develops to the point of having green buds, transfer it to SH9a rooting medium (2 mg / L Cef + 2 mg / L PPT or 5 mg / L HygB).

[0227] (4) Once the callus tissue has completed rooting and seedlings have initially formed, the seedlings are transferred to vermiculite to harden them off. When the seedlings are in good condition, leaves are taken for positive seedling identification.

[0228] 6. Identification of alfalfa plants overexpressing the MsCEPR1 gene

[0229] DNA and RNA levels were identified using alfalfa leaves. DNA identification was performed using 35S-F primers (sequence shown in SEQ ID NO.30: GCACAATCCCACTATCCTTCG) and MsCEPR1-MR primers (sequence shown in SEQ ID NO.31: AAAATATAAAAGTTTACCTCCTTGACAGACATGTTCTGGCAAAG). RNA identification used MsActin-F / R primers (where MsActin-F sequence is shown in SEQ ID NO.32: CAAAAGATGGCAGATGCTGAGGAT; MsActin-R sequence is shown in SEQ ID NO.33: CATGCACCAGTATGACGAGGTCG). The MsCEPR1 quantification primer was qMsCEPR1-F / R, and the specific methods were the same as described above.

[0230] (II) Results and Analysis

[0231] Obtaining alfalfa materials overexpressing the MsCEPR1 gene:

[0232] To analyze gene function, an expression vector pCAMBIA3301-MsCEPR1 was constructed to overexpress the MsCEPR1 gene. Figure 7(a)). Using Agrobacterium-mediated leaf disc transformation, a vector overexpressing the MsCEPR1 gene was transferred into alfalfa, and transgenic alfalfa plants were obtained through tissue culture. Figure 7 (b)-(i)). The transformed lines were detected using specific primers for the vector pCAMBIA3301-MsCEPR1, confirming the amplification of the target band. The positive rate was approximately 92.8%. Figure 7 (j)). Real-time quantitative PCR was performed on selected lines, and the results showed that the expression level of the MsCEPR1 gene in transgenic alfalfa lines was upregulated to varying degrees. Figure 7 (k) In the transgenic lines, the expression level of MsCEPR1 was upregulated to varying degrees (1.93-13.02 times) compared with the wild type, indicating that the MsCEPR1 gene was successfully overexpressed.

[0233] III. MsCEPR1 regulates phosphorus absorption

[0234] (I) Materials and Methods

[0235] 1. Plant materials and treatment

[0236] Alfalfa 'Zhongmu 4' and the aforementioned alfalfa lines overexpressing MsCEPR1 (OE1 and OE13) were used as plant materials, and propagated by cuttings and cultured in the laboratory. Alfalfa with consistent growth status grown hydroponically in Hogrange nutrient solution for three weeks under low phosphorus treatment were then subjected to normal phosphorus growth conditions (NP, 1000 μmol·L⁻¹). -1 KH2PO4) and low phosphorus growth conditions (LP, 50 μmol·L) - 1 Two groups (KH2PO4) were observed and their phenotypes were measured after 14 days of growth.

[0237] 2. The reagents used are shown in Table 18.

[0238] Table 18 Test Reagents Used

[0239] Test reagent Brand Supplier 500 x low phosphorus modified Hoagland nutrient solution Chinook Wuhan Libo Rui Biological Technology Co., Ltd. Sulfuric acid Nantian Nanjing Chemical Reagent Co., Ltd. Hydrogen peroxide Nantian Nanjing Chemical Reagent Co., Ltd. Potassium antimony tartrate Nantian Nanjing Chemical Reagent Co., Ltd. Ammonium molybdate Nantian Nanjing Chemical Reagent Co., Ltd. Ascorbic acid Mcclin Shanghai Mcclin Biochemical Technology Co., Ltd. Dinitrophenol indicator Nantian Nanjing Chemical Reagent Co., Ltd. Sodium carbonate Nantian Nanjing Chemical Reagent Co., Ltd.

[0240] 3. Chlorophyll content determination

[0241] Weigh 0.15g of alfalfa leaves (the 3rd to 5th leaves from the root), cut them into small pieces, and place them in 10mL of 95% ethanol. Cover with aluminum foil and let stand in the dark for 48 hours until the leaves are completely decolorized. After decolorization, shake well. Measure the OD values ​​at 665nm and 649nm using a spectrophotometer, and record A665 and A649, respectively. Use 95% ethanol as a blank control. After the measurements, calculate the chlorophyll a concentration, chlorophyll b concentration, and total chlorophyll concentration using formulas (1), (2), and (3), respectively. Finally, calculate the chlorophyll content (mg / g) using formula (4). The calculation formula is as follows:

[0242] Chlorophyll a concentration (Chl a):

[0243] C Chl a (mg / L)=12.21×A 665 -2.81×A 649 Equation (1)

[0244] Chlorophyll b concentration (Chl b):

[0245] C Chl b (mg / L)=24.96×A 649 -7.32×A 665 Equation (2)

[0246] Total Chlorophyll Concentration (Total Chl):

[0247] C Total Chl (mg / L)=C Chl a +C Chl b Equation (3)

[0248] Chlorophyll content (mg / g):

[0249] Chlorophyll content (mg / g) = C Total Chl (mg / L)×0.01L / 0.15g Equation (4)

[0250] 4. Determination of total phosphorus content

[0251] Referring to NY / T 2017-2011, the total phosphorus content was determined using sulfuric acid digestion-molybdenum antimony colorimetric assay. The specific operating procedure is as follows:

[0252] (1) Sample pretreatment and digestion

[0253] Take a dried alfalfa sample (crushed through a 40-mesh sieve), accurately weigh 0.2000 g into a 100 mL digestion tube, and add 1 mL of deionized water to moisten the sample. Add 5 mL of concentrated sulfuric acid (analytical grade), shake to mix, and then slowly inject 2 mL of 30% hydrogen peroxide solution in two portions. After each addition, allow the mixture to stand until the vigorous reaction stops.

[0254] Cover the glass funnel and place it in a temperature-controlled digestion apparatus. Gradually raise the temperature to 380°C for digestion. Observe the state of the digestion solution: when the solid is completely dissolved, the solution turns brownish-red, and white sulfuric acid fumes are obvious, stop heating. After the digestion tube cools to room temperature, add hydrogen peroxide solution dropwise (total amount controlled at 6-10 mL), repeat digestion until the solution is clear and transparent, and continue heating for 5 minutes to decompose the residual oxidant.

[0255] After cooling, the digestion solution was transferred to a 100 mL volumetric flask, diluted to volume, and filtered through medium-speed quantitative filter paper to obtain test solution A (a blank control solution was prepared simultaneously).

[0256] (2) Standard curve configuration

[0257] Transfer 0, 2, 4, 6, 8, and 10 mL of 5 mg / L phosphorus standard stock solution into six 50 mL volumetric flasks. Add an equal volume of blank digestion solution to each flask as the sample. Add 1–2 drops of 0.2% dinitrophenol indicator, and adjust the pH to a slightly yellow color by adding 240 g / L sodium carbonate solution dropwise. Then, titrate with 2 mol / L sulfuric acid in the reverse direction until colorless.

[0258] Add 5 mL of molybdenum-antimony anti-mixing colorimetric reagent quantitatively, and after making up to volume, let stand in the dark for 30 min (ambient temperature ≥15℃). Use a UV-Vis spectrophotometer to measure the absorbance at a wavelength of 700 nm, and zero the instrument with a blank solution to establish a standard curve of phosphorus concentration (0~1.0 mg / L)-absorbance.

[0259] (3) Sample color development and determination

[0260] Transfer an appropriate amount of test solution A to a 50 mL volumetric flask, dilute to 30 mL, and add 2–3 drops of dinitrophenol indicator. Adjust the solution using a two-way adjustment of 10% sodium carbonate and 5% sulfuric acid until the indicator reaches its critical color change point (slightly yellow → colorless). Accurately add 5 mL of molybdenum antimony colorimetric reagent, dilute to volume, and develop the color at room temperature in the dark for 30 min.

[0261] The absorbance of the sample was measured at a wavelength of 700 nm using a quartz cuvette with a 1 cm optical path, and the phosphorus content was calculated based on the standard curve.

[0262] (4) Data correction and calculation, using formula (5) for calculation.

[0263] Phosphorus content calculation:

[0264] P(%)=(C×V×D) / (m×10^6)×100 Equation (5)

[0265] Where C represents the concentration corresponding to the standard curve (mg / L), V represents the volume of the colorimetric solution (mL), D represents the aliquot factor (total volume to be adjusted / volume of colorimetric solution taken), and m represents the sample mass (g).

[0266] 5. Determination of expression levels of genes related to phosphorus transport and absorption

[0267] RNA was extracted from leaves of wild-type (WT) and MsCEPR1 (OE1, OE13) plants treated with low phosphorus for 14 days. The expression levels of phosphorus transport and uptake-related genes (PHO1, PHR2, PHT1) were determined using real-time quantitative PCR. The primers used are as follows:

[0268] qMsPHO1-F: GGTTGGGTCAATGGGTTGTGC (SEQ ID NO. 34);

[0269] qMsPHO1-R: GCACAACCATTGACCCAACC (SEQ ID NO. 35);

[0270] qMsPHR2-F: AGACCCAGGTTTCACAGCAG (SEQ ID NO. 36);

[0271] qMsPHR2-R: AAGTTCTGGAGTCCAACGCA (SEQ ID NO. 37);

[0272] qMsPHT1-F: CATGCTTTTAAGGCTCCGCC (SEQ ID NO. 38);

[0273] qMsPHT1-R: GCGCTGCTTGTTTTTGCATTC (SEQ ID NO. 39).

[0274] 6. Data Statistics and Analysis

[0275] One-way analysis of variance (ANOVA) was performed using SPSS 23 software. The least significant difference method (LSD, P < 0.05) was used to analyze the significance of differences, and bar charts were generated using Graphpad Prism 9.

[0276] (II) Results and Analysis

[0277] 1. MsCEPR1 overexpression alleviates the inhibition of alfalfa growth caused by low phosphorus stress.

[0278] To investigate the effect of MsCEPR1 overexpression on phosphorus uptake in alfalfa, this application compared the changes in growth parameters (plant height, root length, and aboveground and root fresh weight) of different strains under two culture conditions: normal phosphorus (NP) and low phosphorus (LP). Figure 8(a) and (b) in the figures). Under NP conditions, there were no significant differences in plant height, root length, aboveground fresh weight, and root fresh weight between wild-type (WT) alfalfa and overexpression lines (OE1, OE13), indicating that MsCEPR1 overexpression did not affect basal growth. After 14 days of low phosphorus treatment, all lines exhibited a phosphorus stress response pattern, with inhibited aboveground growth and development, significantly decreased plant height and aboveground fresh weight, and increased root fresh weight.

[0279] Low phosphorus stress inhibited the growth of all lines, but the overexpressing lines OE1 and OE13 showed stronger tolerance. Regarding plant height, the plant height of WT under low phosphorus treatment was 29.33 cm, a decrease of 20.21% compared to NP, while OE1 and OE13 were 32.58 cm and 31.30 cm, respectively, a decrease of 13.13% and 16.87% compared to normal conditions. Figure 8 (c)). Furthermore, the fresh weight change trend of the aboveground parts was more significant. The WT aboveground fresh weight was 1.242 g, a decrease of 20.84% ​​compared to NP, while OE1 and OE13 were 1.41 g and 1.40 g, respectively, a decrease of 12.67% and 11.24% compared to normal conditions. This indicates that the growth and development of the overexpressed lines OE1 and OE13 were less inhibited under low phosphorus conditions. Figure 8 (e)). Under low phosphorus stress, the root lengths of WT, OE1, and OE13 did not show significant differences compared to normal conditions. Figure 8 (d)), but the fresh weight of the roots increased significantly, with OE1 and OE13 showing greater increases than the wild type. WT root fresh weight increased by 17.93% (0.36g), while OE1 and OE13 increased by 27.05% (0.41g) and 29.29% (0.42g), respectively. Figure 8 (f)). The above results suggest that MsCEPR1 overexpression may improve the plant's phosphorus stress adaptation by affecting root morphology.

[0280] 2. MsCEPR1 overexpression enhances phosphorus accumulation in the aboveground parts of alfalfa.

[0281] Fourteen days after low phosphorus stress, leaves turned yellow. To investigate the changes in aboveground phosphorus in different alfalfa lines under low phosphorus stress, total phosphorus content was measured. Under normal phosphorus supply conditions, there was no significant difference in aboveground phosphorus content between WT and OE1 / OE13 (WT: 0.150 mg / g; OE1: 0.146 mg / g; OE13: 0.152 mg / g), indicating that MsCEPR1 overexpression did not affect phosphorus uptake in alfalfa under normal growth conditions. However, low phosphorus stress significantly affected aboveground phosphorus accumulation in alfalfa (a decrease of 60.73%), but the phosphorus reduction was smaller in the MsCEPR1 overexpressing lines (OE1 and OE13) (a decrease of 23.97%-26.97%) (see...).Figure 9 ).

[0282] 3. MsCEPR1 overexpression alleviates chloroplast damage under low phosphorus stress.

[0283] After 14 days of low phosphorus stress treatment, the older leaves of WT showed obvious yellowing, while the older leaves of OE1 and OE13 did not show obvious yellowing. Figure 10 (a)). To investigate the changes in chlorophyll content in leaves, the chlorophyll content in older leaves was measured. The chlorophyll measurement results showed that under normal conditions, there was no significant difference in chlorophyll content in older leaves of different alfalfa lines (WT, OE1, OE13). After low phosphorus treatment, the chlorophyll content in older leaves of WT, OE1, and OE13 showed significant differences. Figure 10 (b) In the low phosphorus treatment, the total chlorophyll content (Total Chl) of older leaves in the WT was 0.32 mg / g, a decrease of 90.14% compared with the normal phosphorus supply conditions. The total chlorophyll content of older leaves in OE1 and OE13 was 2.67 mg / g and 2.19 mg / g, respectively, a decrease of 20.67% and 36.86%, respectively, which was significantly lower than the decrease in WT. This indicates that MsCEPR1 overexpression alleviates chloroplast damage under low phosphorus stress.

[0284] 4. MsCEPR1 promotes the expression of phosphorus absorption and transport genes.

[0285] To further investigate the mechanism by which MsCEPR1 regulates phosphorus uptake in the aboveground parts, this application used qRT-PCR to detect the expression patterns of phosphorus uptake and transport-related genes (PHO1, PHR2, PHT1) in the leaves of WT, OE1, and OE13 lines under normal phosphorus (NP) and low phosphorus (LP) conditions (NP-WT as the baseline). Under NP conditions, the expression levels of PHO1, PHR2, and PHT1 in OE1 and OE13 lines were upregulated by 1.04-3.01 times compared to WT (PHO1: 3.13-2.00 times; PHR2: 1.67-1.04 times; PHT1: 3.01-1.16 times) (see [reference needed]). Figure 11 This indicates that MsCEPR1 overexpression affects the basal expression levels of phosphorus uptake and transport genes. Furthermore, LP treatment induced the expression of phosphorus uptake and transport-related genes in all lines (upregulated by 1.41-7.91 times compared to NP-WT). Simultaneously, under LP conditions, the expression levels of these genes in OE1 and OE13 were significantly higher than in WT. Combined with the fact that the aboveground phosphorus content in OE1 and OE13 was higher than in WT, this suggests that MsCEPR1 may promote the expression of phosphorus uptake and transport-related genes, thereby promoting phosphorus uptake in the aboveground parts.

[0286] In summary, this application used wild-type alfalfa (WT) and MsCEPR1 overexpressing lines (OE1, OE13) as materials, and compared the changes in growth parameters (plant height, root length, aboveground and root fresh weight), total phosphorus content, and chlorophyll content of different lines under two culture conditions: normal phosphorus (NP) and low phosphorus (LP). The results showed that low phosphorus stress significantly affected alfalfa growth: aboveground growth was inhibited in all lines, while root biomass showed compensatory growth. The MsCEPR1 overexpressing lines exhibited stronger tolerance to low phosphorus; compared to WT plants under low phosphorus conditions, the inhibition of plant height and aboveground growth in the overexpressing lines was significantly reduced, indicating that MsCEPR1 gene overexpression can effectively alleviate the inhibition of aboveground growth by low phosphorus and promote root growth. Meanwhile, total phosphorus content analysis showed that the overexpressing lines had stronger phosphorus absorption and translocation efficiency. The expression levels of phosphorus absorption and translocation-related genes further demonstrated that MsCEPR1 promotes phosphorus absorption and translocation by increasing the expression of these genes. Furthermore, the chlorophyll content in older leaves of the overexpressing lines was significantly higher than that of the WT lines, suggesting that they better maintain photosynthetic system stability. In summary, MsCEPR1 overexpression alleviates the growth inhibition of aboveground parts under low phosphorus stress, promotes root growth, and regulates phosphorus absorption and translocation in alfalfa by upregulating phosphorus absorption and translocation-related genes.

[0287] The above description is merely a few embodiments of this application and is not intended to limit this application in any way. Although this application discloses preferred embodiments as described above, it is not intended to limit this application. Any changes or modifications made by those skilled in the art without departing from the scope of the technical solution of this application using the disclosed technical content are equivalent to equivalent implementation cases and fall within the scope of the technical solution.

Claims

1. Application of alfalfa MsCEPR1 gene or alfalfa MsCEPR1 protein in improving plant tolerance to low phosphorus stress; The nucleotide sequence of the alfalfa MsCEPR1 gene is shown in SEQ ID NO.1; The alfalfa MsCEPR1 protein is encoded by the alfalfa MsCEPR1 gene, and the amino acid sequence of the alfalfa MsCEPR1 protein is shown in SEQ ID NO.

2. The plant in question is alfalfa.

2. The application according to claim 1, characterized in that, The improvement of plant tolerance to low phosphorus stress includes promoting the growth of the aboveground parts and roots of plants under low phosphorus stress, and promoting phosphorus absorption and transport in plants under low phosphorus stress.

3. The application according to claim 2, characterized in that, The growth conditions under low phosphorus stress were: 50 μmol·L⁻¹ -1 KH2PO4 is treated to reduce phosphorus content.

4. The application according to claim 2, characterized in that, The promotion of phosphorus uptake and transport in plants under low phosphorus stress is achieved by upregulating the expression of PHO1, PHR2 and PHT1 genes.

5. A method for improving the tolerance of plants to low phosphorus stress, characterized in that, Includes the following steps: (1) PCR amplification of the MsCEPR1 gene of alfalfa as described in claim 1 and gel extraction and recovery of the target fragment; (2) Construct the recombinant plasmid pTOPO-TA-MsCEPR1; (3) Construct the overexpression vector pCAMBIA3301-MsCEPR1; (4) The overexpression vector pCAMBIA3301-MsCEPR1 was transferred into the target plant to obtain transgenic plants; The plant in question is alfalfa.

6. The method according to claim 5, characterized in that, In step (1), the upstream and downstream primer sequences for PCR amplification are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

7. The method according to claim 5, characterized in that, In step (2), the method for constructing the recombinant plasmid pTOPO-TA-MsCEPR1 includes: The target fragment of the alfalfa MsCEPR1 gene obtained in step (1) was ligated into the pTOPO-TA vector, transformed into Escherichia coli, positive clones were screened and sequenced to verify, and the recombinant plasmid pTOPO-TA-MsCEPR1 was obtained.

8. The method according to claim 7, characterized in that, The reaction system for the ligation is as follows: ddH2O 1.8–2.2 μL, MsCEPR1 gene fragment 1.8–2.2 μL, 10×Enhancer 0.4–0.6 μL, pTOPO-TA vector 0.4–0.6 μL; The reaction conditions for the connection are: 35-37°C, 10-15 min.

9. The method according to claim 5, characterized in that, In step (3), the method for constructing the overexpression vector pCAMBIA3301-MsCEPR1 includes: S1. Using the recombinant plasmid pTOPO-TA-MsCEPR1 obtained in step (2) as a template, design upstream and downstream primers to amplify the MsCEPR1 fragment containing the NcoⅠ restriction site, namely p3301-MsCEPR1. S2. The pCAMBIA3301 vector was digested with NcoI enzyme; S3. The enzyme-digested pCAMBIA3301 vector and the p3301-MsCEPR1 were seamlessly cloned and ligated, transformed into E. coli, positive clones were screened and sequenced for verification, and the overexpression vector pCAMBIA3301-MsCEPR1 was obtained.

10. The method according to claim 9, characterized in that, In step S1, the sequences of the upstream and downstream primers are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

11. The method according to claim 9, characterized in that, In step S2, the enzymatic digestion reaction system is as follows: ddH2O 35-35.2 μL, pCAMBIA330 18-9 μL, 10×Buffer 4-6 μL, NcoⅠ enzyme 0.8-1.2 μL; The enzyme digestion reaction conditions are: 35–37°C, 1.5–2.5 h.

12. The method according to claim 9, characterized in that, In step S3, the reaction system for the seamless cloning ligation consists of 3–5 μL of ddH2O, 1.8–2.2 μL of enzyme-digested pCAMBIA3301, 2.8–3.2 μL of 2×Seamless MasterMix, and 0.8–1.2 μL of p3301-MsCEPR. The reaction conditions for the seamless cloning connection are: 48–52 °C, 28–32 min.

13. The method according to claim 5, characterized in that, In step (4), the method of transformation includes Agrobacterium-mediated leaf disc transformation.