A triple RT-qPCR primer set for detecting group A porcine rotavirus G4, G5 and G9 strains, a kit and application thereof

By designing a triple RT-qPCR technology with specific primers and probes, the problem of the inability to rapidly identify Group A porcine rotavirus strains G4, G5, and G9 in existing technologies has been solved, achieving efficient and low-cost genotyping detection and supporting accurate monitoring and vaccine development for porcine rotavirus.

CN120485435BActive Publication Date: 2026-02-27INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510637992.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-16
Publication Date
2026-02-27
Estimated Expiration
2045-05-16

AI Technical Summary

Technical Problem

Existing technologies cannot quickly and accurately identify Group A porcine rotavirus strains G4, G5, and G9. Traditional methods are time-consuming and lack sensitivity and specificity.

Method used

We designed specific primers and probes, established a triple RT-qPCR detection technology, and simultaneously detected G4, G5 and G9 genotypes in a single PCR tube in a single reaction, optimizing the reaction system and conditions.

Benefits of technology

It enables rapid and accurate detection of three genotypes, improves the efficiency of genotyping, reduces costs, and enhances sensitivity and specificity, supporting precise monitoring of porcine rotavirus and vaccine development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485435B_ABST
    Figure CN120485435B_ABST
Patent Text Reader

Abstract

The application discloses a kind of detection group of triple RT-qPCR primers of group A porcine rotavirus G4, G5 and G9 strain, kit and its application, belong to molecular biology field.Primer group includes primer and probe, nucleotide sequence is as shown in SEQ ID NO.1-SEQ ID NO.8.The application can realize the simultaneous detection of group A porcine rotavirus G4, G5 and G9 genotype strain in one PCR reaction tube, and has good specificity, sensitivity and repeatability, and can be directly applied to the laboratory diagnosis of pig clinical diarrhea sample pathogen, provides a kind of fast, accurate detection method for the epidemiological study and clinical differential diagnosis of group A porcine rotavirus G4, G5 and G9 genotype, especially suitable for scientific research and clinical application, with good commercial application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a triple RT-qPCR primer set, kit, and application for detecting group A porcine rotavirus strains G4, G5, and G9. Background Technology

[0002] Porcine rotavirus (PoRV) is one of the main intestinal pathogens causing diarrhea and gastroenteritis in suckling and weaned piglets. Its widespread prevalence causes huge economic losses to the pig farming industry and seriously hinders its healthy development. Epidemiological surveys of PoRV show that Group A porcine rotavirus (PoRVA) is the main serotype and the most prevalent. Among them, the G4, G5, and G9 genotypes have the highest prevalence, with the G9 strain becoming the latest prevalent strain, and reports of G9 strains being detected every year in recent years.

[0003] Currently, most detection methods for PoRVA differentiate it from other porcine viruses, failing to distinguish strains with different G genotypes. Traditional PoRVA typing and identification methods involve numerous steps, often requiring reverse transcription and PCR amplification (3 hours), nucleic acid electrophoresis (0.5 hours), gel imaging analysis, gel cutting and recovery (1 hour), and sequencing (2-3 days). The sequencing results are then compared with known gene databases using NCBI-blast tools to determine the viral subtype. This time-consuming process makes rapid diagnosis difficult, and the low sensitivity and specificity of conventional PCR contribute to unsatisfactory diagnostic accuracy. Summary of the Invention

[0004] The purpose of this invention is to provide a triple RT-qPCR primer set, kit, and application for detecting Group A porcine rotavirus G4, G5, and G9 strains, in order to solve the problems existing in the prior art. This invention has good repeatability, specificity, and sensitivity, and can simultaneously perform rapid and accurate clinical detection of Group A porcine rotavirus G4, G5, and G9 genotypes.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides a triple RT-qPCR primer set for detecting group A porcine rotavirus strains G4, G5, and G9, the primer set comprising the following primers and probes:

[0007] PoRVA G4F:GCTCCTTTTAATGTATGGTATTG;

[0008] PoRVA G4R:ATTTATTCCATAATTTTGTGCATTAG;

[0009] PoRVA G4P:TTCGTTCTTGTGAGTTAYATTYTGAAAAC;

[0010] PoRVA G5F:GCTCCTTTTAATGTATGGTATTG;

[0011] PoRVA G5R: ATCCAGTTATTGGTAAATTAATTCC;

[0012] PoRVA G5P:ATAAAGTCATTGTTCTAGTHACTGATTT;

[0013] PoRVA G9F: GGCCAACTGGATCAGTYT;

[0014] PoRVAG9R:ACCATTCATTTAGAATCAAATCAGC;

[0015] PoRVA G9P: ATCGCTTCATTCTCAATTGAYCCACA.

[0016] Optionally, the 5′ end of the PoRVA G4P is modified with FAM, and the 3′ end is modified with BHQ1;

[0017] The 5′ end of the PoRVA G5P is modified with CY5, and the 3′ end is modified with BHQ2.

[0018] The 5′ end of the PoRVA G9P is modified with Texas red, and the 3′ end is modified with BHQ2.

[0019] The present invention also provides the application of the primer set described herein in the preparation of a triple RT-qPCR kit for detecting group A porcine rotavirus strains G4, G5 and G9.

[0020] The present invention also provides a triple RT-qPCR kit for detecting group A porcine rotavirus strains G4, G5 and G9, comprising the aforementioned primer set.

[0021] Optionally, the steps for detecting group A porcine rotavirus strains G4, G5, and G9 using the kit are as follows:

[0022] Using the RNA of the sample to be tested as a template, a triple RT-qPCR reaction was performed using the primer set described above. Fluorescence signals were collected to obtain the Ct value of the sample to be tested.

[0023] Optionally, if the sample to be tested has no Ct value, it is considered negative, indicating that the sample does not contain Group A porcine rotavirus strains G4, G5, and G9; if the Ct value of the sample to be tested is >35, it is considered suspicious and needs to be tested again.

[0024] If the Ct value of the sample to be tested is ≤35 and it is green fluorescent, then the sample to be tested is determined to contain Group A porcine rotavirus G4 strain.

[0025] If the Ct value of the sample to be tested is ≤35 and it is red fluorescence, then the sample to be tested is determined to contain Group A porcine rotavirus G5 strain.

[0026] If the Ct value of the sample to be tested is ≤35 and it is orange-red fluorescence, then the sample to be tested is determined to contain Group A porcine rotavirus G9 strain.

[0027] If the Ct value of the sample to be tested is ≤35 and green fluorescence and red fluorescence are present, then the sample to be tested is determined to contain Group A porcine rotavirus G4 strain and G5 strain.

[0028] If the Ct value of the sample to be tested is ≤35 and there is red fluorescence and orange-red fluorescence, then the sample to be tested is determined to contain Group A porcine rotavirus G5 strain and G9 strain.

[0029] If the Ct value of the sample to be tested is ≤35 and green fluorescence, red fluorescence, and orange-red fluorescence are present, then the sample to be tested is determined to contain Group A porcine rotavirus G4 strain, G5 strain, and G9 strain.

[0030] Optionally, the reaction system for the triple RT-qPCR reaction is as follows: 10 μL reaction buffer, 0.4 μL DNA polymerase, 0.4 μL reverse transcriptase mixture, 0.8 μL each of forward and reverse primers, 0.3 μL each of probe, 1.5 μL ribonuclease-free water, and 2 μL template RNA.

[0031] Optionally, the reaction program for the triple RT-qPCR reaction is as follows: 42℃, 5 min, 95℃, 10 s; 95℃, 5 s, 48.2℃, 30 s, 40 cycles; 24℃, 30 s.

[0032] The present invention discloses the following technical effects:

[0033] This invention establishes a triple fluorescent PCR detection technology for PoRVA G4, G5, and G9 genotypes by designing three sets of specific primers and probes for G4, G5, and G9 genotypes and optimizing the reaction system. This technology accurately detects PoRVA and identifies the G4, G5, and G9 genotypes within a single reaction (1-2 hours), significantly improving typing efficiency, effectively reducing detection costs, and rapidly screening for the main genotypes causing diarrhea outbreaks and the genotypes most harmful to pig herds. It provides an efficient detection method for the accurate monitoring of PoRVA G genotype subtypes. Using the diagnostic method established in this invention, a large number of clinical samples were tested to analyze the prevalence and dominance of the G4, G5, and G9 genotypes in pig herds, providing a reference for subsequent PoRV targeted vaccine development.

[0034] This invention enables the simultaneous detection of group A porcine rotavirus G4, G5, and G9 genotypes in a single PCR reaction tube, providing a simple, efficient, and low-cost method for detecting these three genotypes.

[0035] This invention provides more sensitive and convenient technical support for the differential diagnosis of porcine rotavirus G4, G5, and G9 genotypes in group A. Compared with conventional typing methods, it omits the steps of agarose gel electrophoresis, ultraviolet analysis, gel recovery, and sequencing. Compared with single-detection methods, it reduces workload, significantly improves the efficiency of porcine rotavirus typing and detection, and significantly enhances detection sensitivity, effectively reducing the occurrence of false positives.

[0036] This invention exhibits good repeatability, specificity, and sensitivity, enabling rapid and accurate clinical detection of three genotypes of group A porcine rotavirus: G4, G5, and G9. It supports the differential diagnosis of group A porcine rotavirus with G4, G5, and G9 genotypes in clinical practice. Attached Figure Description

[0037] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0038] Figure 1 Map of the p-G4 / 5 / 9-PoRVA recombinant plasmid;

[0039] Figure 2 Map of the p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA recombinant plasmid;

[0040] Figure 3 Triple RT-qPCR amplification curves obtained at different Tm values ​​(48.2-60.1℃); A: G4 type; B: G5 type; C: G9 type;

[0041] Figure 4 Optimize amplification curves for single qPCR reactions of PoRVA G4, G5 and G9 types, including primer concentration (AC), reaction probe concentration (DE) and triple RT-qPCR reaction probe concentration (GI);

[0042] Figure 5 The following are the results of specific detections: 1: G4 detection result of positive recombinant plasmid p-G4 / 5 / 9-PoRVA; 2: G5 detection result of positive recombinant plasmid p-G4 / 5 / 9-PoRVA; 3: G9 detection result of positive recombinant plasmid p-G4 / 5 / 9-PoRVA; 4: Transmissible gastroenteritis virus (TGEV); 5: Porcine epidemic diarrhea virus (PEDV); 6: Porcine pseudorabies virus (PRV); 7: Porcine deltacoronavirus nucleic acid (PDCoV); 8: Porcine gettavirus (GETV); 9: Detection result of porcine reproductive and respiratory syndrome virus (PRRSV); 10: Recombinant plasmid p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA for other genotypes of porcine rotavirus; 11: Negative control;

[0043] Figure 6 The amplification standard curves for triple RT-qPCR are shown below; A: G4 type; B: G5 type; C: G9 type.

[0044] Figure 7 The graph shows the sensitivity detection results of triplet RT-qPCR using p-G4 / 5 / 9-PoRVA as a template; A: G4 type; B: G5 type; C: G9 type;

[0045] Figure 8 This is a graph showing the sensitivity detection results of triple RT-qPCR using G9 PoRVA nucleic acid as a template; 1-8 represent the results obtained using 3.76×4 0 ~3.76×4 -7 ng / μL G9 type PoRVA nucleic acid was used as a template, and 9 was a negative control;

[0046] Figure 9 For each of 2×10 4 2×10 6 2×10 8 Figure 1 shows the repeatability test results using copy-positive recombinant plasmid p-G4 / 5 / 9-PoRVA as a template; A: G4 type; B: G5 type; C: G9 type. Detailed Implementation

[0047] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0048] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0049] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0050] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0051] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0052] Example 1

[0053] I. Materials and Methods

[0054] 1. Test nucleic acid

[0055] The VP7 genes of group A porcine rotavirus G4, G5, and G9 published in NCBI GenBank were compared, and the corresponding three target gene segments were tandemly linked into a large fragment (nucleotide sequence shown in SEQ ID NO. 9). This fragment was then sent to Sangon Biotech (Shanghai) Co., Ltd. to synthesize a triplet positive recombinant plasmid named p-G4 / 5 / 9-PoRVA. The plasmid map is shown below. Figure 1 .

[0056] Other nucleic acid templates: Transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine pseudorabies virus (PRV), and porcine gettavirus (GRTV) were provided by the Swine Disease Research Laboratory of the Animal Health Institute of Guangdong Academy of Agricultural Sciences. Porcine deltacoronavirus (PDCoV) was purchased from a commercially available vaccine. The p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA recombinant plasmid was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA nucleotide sequence is shown in SEQ ID NO.10, and its plasmid map is shown below. Figure 2 .

[0057] SEQ ID NO.9 (p-G4 / 5 / 9-PoRVA nucleotide sequence):

[0058]

[0059] SEQ ID NO.10 (p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA nucleotide sequence):

[0060]

[0061] 2. Main Reagents and Instruments

[0062] One Step PrimeScript TM The RT-PCR Kit (Perfect Real Time) was purchased from TaKaRa, Cat No. RR064A. The reagents used in this invention were analytical grade or biochemical reagents. The experimental water met the Class I water specifications in GB / T6682. All reagents were dispensed into containers free of nuclease contamination. The RT-qPCR instrument was a Tianlong Gentier 96R.

[0063] 3. Primer and probe design and screening

[0064] Based on the VP7 gene sequences of group A porcine rotavirus G4, G5, and G9 genotypes published in GenBank, three pairs of specific primers and three specific probes were designed. The specific sequences of the primers and probes are shown in Table 1. All primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0065] Table 1. Triple RT-qPCR primer and probe sequences

[0066]

[0067] 4. Preparation of positive control

[0068] The positive control plasmid p-G4 / 5 / 9-PoRVA was synthesized by Sangon Biotech (Shanghai) Co., Ltd. After confirming that the sequencing results matched the GenBank sequence, the plasmid was dissolved into 2×10⁻⁶ units according to the conversion formula. 9 Copy / μL.

[0069] 5. Viral nucleic acid extraction

[0070] Following the instructions of the viral nucleic acid extraction kit (Magen, R4410-03), viral genomic nucleic acids of TGEV, PEDV, PRV, PDCoV, GETV, and PRRSV were extracted and used as templates.

[0071] 6. Optimization of triple RT-qPCR reaction conditions

[0072] Optimization of PoRVA G4, G5, and G9 singlet qPCR primer and probe concentrations: Primer concentration gradients of 0.1, 0.2, 0.3, 0.4, and 0.5 μmol / L were used, along with probe concentration gradients of 0.1, 0.15, 0.2, 0.25, and 0.3 μmol / L, resulting in a total of 25 primer and probe combinations. Singlet qPCR amplification of the G4, G5, and G9 genotypes was performed at a concentration of 2 × 10⁻⁶ μmol / L. 5Using p-G4 / 5 / 9-PoRVA recombinant plasmid (copies / μL) as a template and pUC57 empty vector as a negative control, primer and probe concentrations were optimized.

[0073] Triple RT-qPCR probe concentration optimization: Primer concentrations were maintained at the optimal levels after single qPCR optimization. Five probe concentrations (0.1, 0.15, 0.2, 0.25, and 0.3 μmol / L) were used for triple RT-qPCR reactions, with a concentration of 2 × 10⁻⁶ μmol / L. 5 Using p-G4 / 5 / 9-PoRVA recombinant plasmid (copies / μL) as a template and pUC57 empty vector as a negative control, the triplet RT-qPCR probe concentration was optimized.

[0074] Annealing was performed at seven temperature gradients: 48.2℃, 49.9℃, 52℃, 54.2℃, 55.9℃, 58℃, and 60.1℃. The p-G4 / 5 / 9-PoRVA recombinant plasmid was used as the positive template, and the pUC57 empty vector was used as the negative control. Amplification curves were obtained, and the annealing temperature was optimized. The optimized triplet RT-qPCR reaction system and reaction program are shown in Tables 2 and 3.

[0075] Table 2. Optimized triplet RT-qPCR reaction system

[0076]

[0077]

[0078] Table 3. Optimized triplet RT-qPCR reaction procedure

[0079]

[0080] Judgment criteria: If the sample has no Ct value, it is negative, indicating that the sample does not contain Group A porcine rotavirus strains G4, G5, and G9; if the Ct value of the sample is >35, it is considered suspicious and needs to be tested again.

[0081] If the Ct value of the sample to be tested is ≤35 and it is green fluorescent, then the sample to be tested is determined to contain Group A porcine rotavirus G4 strain.

[0082] If the Ct value of the sample to be tested is ≤35 and it is red fluorescence, then the sample to be tested is determined to contain Group A porcine rotavirus G5 strain.

[0083] If the Ct value of the sample to be tested is ≤35 and it is orange-red fluorescence, then the sample to be tested is determined to contain Group A porcine rotavirus G9 strain.

[0084] If the Ct value of the sample to be tested is ≤35 and green fluorescence and red fluorescence are present, then the sample to be tested is determined to contain Group A porcine rotavirus G4 strain and G5 strain.

[0085] If the Ct value of the sample to be tested is ≤35 and there is red fluorescence and orange-red fluorescence, then the sample to be tested is determined to contain Group A porcine rotavirus G5 strain and G9 strain.

[0086] If the Ct value of the sample to be tested is ≤35 and green fluorescence, red fluorescence, and orange-red fluorescence are present, then the sample to be tested is determined to contain Group A porcine rotavirus G4 strain, G5 strain, and G9 strain.

[0087] 7. Specific detection

[0088] With a concentration of 2×10 5 Using recombinant plasmids p-G4 / 5 / 9-PoRVA and p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA, along with nucleic acids from other common swine viruses such as PEDV, TGEV, PRV, PRRSV, PDCoV, and GETV, as templates, an optimized triple qPCR system was employed for detection. The pUC57 empty vector was set as a negative control to evaluate the specificity of the triple RT-qPCR detection method.

[0089] 8. Establishment of the standard curve

[0090] The recombinant plasmid p-G4 / 5 / 9-PoRVA was serially diluted 10-fold to obtain 2 × 10⁻⁶ positive plasmids. 8 ~2.19×10 3 Six dilutions of recombinant plasmid (copies / μL) were used as standard templates, with each template concentration used in triplicate. RT-qPCR amplification was performed according to the reaction systems and procedures in Tables 2 and 3, and fluorescence amplification curves were obtained and a standard curve was plotted. The minimum copy number of the recombinant plasmid detected was determined by observing the amplification curves, and a standard curve was finally constructed with Ct value on the ordinate and the logarithm of the copy number on the abscissa.

[0091] 9. Sensitivity test

[0092] Using p-G4 / 5 / 9-PoRVA recombinant plasmid as a template: The recombinant plasmid p-G4 / 5 / 9-PoRVA was serially diluted 10-fold to obtain 2×10⁻⁶ samples. 8 ~2×10 0 Nine dilutions of recombinant plasmid (copies / μL) were used as standard templates, with three replicates for each template concentration. Based on the sensitivity test results, 1×10⁻⁶ copies / μL were used. 1 5×10 1 1×10 2 2×102 The final detection limit was determined using four concentrations: copies / μL. Ten replicates were prepared for each concentration, and the lowest concentration with 9 or more replicates showing Ct ≤ 35 was determined as the lowest detection limit for triplet RT-qPCR. Triplet RT-qPCR amplification was performed according to the reaction systems and procedures in Tables 2 and 3 to evaluate the sensitivity of the reaction systems.

[0093] Using G9 PoRVA nucleic acid as a template: G9 PoRVA nucleic acid with an initial concentration of 3.76 ng / μL was serially diluted 4-fold to obtain concentrations ranging from 3.76 to 3.76 × 40⁻⁴. -7 Eight dilutions (ng / μL) were used as templates for triple RT-qPCR amplification to evaluate the sensitivity of the system.

[0094] 10. Repeatability testing

[0095] Intra-batch repeatability test: 2 × 10 8 2×10 6 2×10 4 Triple RT-qPCR experiments were performed using p-G4 / 5 / 9-PoRVA (copies / μL) of positive plasmid as a template, with six replicates per batch. Inter-batch replication experiments were conducted using 2×10-1 μL of plasmid. 8 2×10 6 2×10 4 Triple RT-qPCR assays were performed using the standard plasmid p-G4 / 5 / 9-PoRVA (copies / μL) as a template, with six batches tested at 24-hour intervals. The pUC57 empty vector served as a negative control. The Ct values ​​for repeatability experiments were statistically analyzed, and the mean Ct value, standard deviation, and coefficient of variation for each concentration were calculated to evaluate the repeatability of the triple RT-qPCR assay.

[0096] 11. Testing of clinical samples

[0097] Between 2023 and 2025, a total of 109 diarrhea samples were collected from various pig farms in Guangdong Province and from experimental pigs in our laboratory, along with 5 laboratory virus cultures. Nucleic acid was extracted and used as templates for testing. The samples were simultaneously detected using three methods: RT-PCR based on the VP7 gene (primers, reaction system, and reaction procedure are shown in Tables 4-6), RT-qPCR based on the RVA NSP5 gene (primers, reaction system, and reaction procedure are shown in Tables 7-9), and the PoRVA G4, G5, and G9 triple RT-qPCR method established in this invention.

[0098] Table 4. RT-PCR primers based on the VP7 gene

[0099]

[0100] Table 5. RT-PCR reaction system based on VP7 gene

[0101]

[0102]

[0103] Table 6. RT-PCR reaction procedure based on the VP7 gene.

[0104]

[0105] Table 7 Primers for RT-qPCR based on the RVA NSP5 gene

[0106]

[0107] Table 8. RT-qPCR reaction system based on RVANSP5 gene.

[0108]

[0109] Table 9. RT-qPCR reaction procedure based on RVA NSP5 gene

[0110]

[0111]

[0112] II. Results and Analysis

[0113] 1. Results of reaction condition optimization

[0114] By comparing the Ct values ​​of the amplification curves at different annealing temperatures, the results are as follows: Figure 1 As shown, the VP7 gene amplification of group A porcine rotavirus G4, G5, and G9 types was optimal at 48.2℃. Therefore, 48.2℃ is the optimal annealing temperature for PoRVA G4, G5, and G9 triplet RT-qPCR. Amplification curves were obtained by performing amplification with five different concentrations of upstream and downstream primers (0.1, 0.2, 0.3, 0.4, and 0.5 μmol / L), and the primer concentrations were optimized. The results are shown below. Figure 2 As shown, when the concentrations of the upstream and downstream primers for PoRVA G4, G5, and G9 are all 0.4 μmol / L and the probe concentration is 0.15 μmol / L, the amplification efficiency of the p-G4 / 5 / 9-PoRVA positive control plasmid is the highest, and the Ct value is the lowest. Therefore, the optimal concentrations of the upstream and downstream primers for PoRVA G4, G5, and G9 are all 0.4 μmol / L, and the optimal concentration of the probe is 0.15 μmol / L.

[0115] 2. Specificity test results

[0116] The genomes of TGEV, PEDV, PRV, PDCoV, GETV, and PRRSV, along with the recombinant plasmids p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA and p-G4 / 5 / 9-PoRVA, were simultaneously detected by RT-qPCR. The results are as follows: Figure 3 As shown, only the p-G4 / 5 / 9-PoRVA positive recombinant plasmid can produce a specific fluorescence curve, while the rest are negative, proving that this method has good specificity.

[0117] 3. Establishment of the standard curve

[0118] p-G4 / 5 / 9-PoRVA positive control plasmid was diluted 10-fold to 2×10⁻⁶. 3 ~2×10 8 Six dilutions (copies / μL) were used for triple RT-qPCR amplification, and amplification curves were obtained, as shown below. Figure 4 As shown, the concentration of the standard curve is 2×10⁻⁶. 3 ~2×10 8 PoRVA G4, G5, and G9 showed good correlation within the copies / μL range, with the linear equations being PoRVA G4: y = -3.418x + 39.73, R0 2 =0.9980; PoRVA G5: y=-3.455x+38.96, R 2 =0.9966; PoRVA G9: y=-3.487x+40.22, R 2 =0.9979.

[0119] 4. Sensitivity test results

[0120] p-G4 / 5 / 9-PoRVA positive control plasmid was diluted 10-fold to 2×10⁻⁶. 0 ~2×10 8 Nine dilutions (copies / μL) were used for triple RT-qPCR amplification. The results showed that the amplification curves for each gene exhibited a typical S-shape, with uniform spacing between the curves (see [link to data]). Figure 5 The concentration is 2×10⁻⁶. 2 Of the 10 parallel samples with Ct ≤ 35, the numbers were G4 (9 / 10), G5 (9 / 10), and G9 (10 / 10), respectively, while the number of parallel samples with Ct ≤ 35 for the other concentrations was less than 9 (Table 10). The detection limits based on the VP7 gene of group A porcine rotavirus G4, G5, and G9 were all 100-200 copies.

[0121] With 3.76~3.76×4 -7Triple RT-qPCR amplification was performed using eight concentrations of G9 PoRVA nucleic acid (3.76 × 4 ng / μL) as templates. The results showed that when the nucleic acid concentration was 3.76 × 4 ng / μL... -6 The test result was positive at a concentration of ng / μL, with a nucleic acid concentration of 3.76 × 4 ng / μL. -7 ng / μL indicates a negative test result. Figure 6 Considering the differences in plasmid detection sensitivity among the three genotypes, the triplet RT-qPCR method established in this invention achieves a detection sensitivity of 3.76 × 4⁴ for PoRVA of the G4, G5, and G9 genotypes. -6 ng / μL.

[0122] Table 10 Determination of the lowest detection limit for triple RT-qPCR

[0123] Concentration (copies / µL) <![CDATA[1×10 1 ]]> <![CDATA[5×10 1 ]]> <![CDATA[1×10 2 ]]> <![CDATA[2×10 2 ]]> G4(FAM) 0 / 10 1 / 10 1 / 10 9 / 10 G5 (Cy5) 0 / 10 1 / 10 7 / 10 9 / 10 G9 (Texas Red) 0 / 10 1 / 10 7 / 10 10 / 10

[0124] 5. Repeatability test results

[0125] like Figure 7 As shown, the detection results of the three repeatable amplification curves of PoRV G4, G5 and G9 are basically consistent, and the corresponding fluorescence curves can be observed at the same position. The coefficient of variation of intra-batch repeatability test is ≤1.25%, and the coefficient of variation of inter-batch repeatability test is ≤2.13%, indicating that the nucleic acid probe RT-qPCR method has good repeatability.

[0126] 6. Testing of clinical samples

[0127] The triple RT-qPCR method and the RVA NSP5 gene-based RT-qPCR method established in this invention (primers, reaction system, and reaction procedure are shown in Tables 7-9) were used to detect 109 diarrhea samples collected from various pig farms in Guangdong Province from 2023 to 2025 and diarrhea samples from pigs tested in our laboratory, as well as 5 cell samples. The results are shown in Tables 11 and 12. Triple RT-qPCR detected 46 positive samples and 68 negative samples, with a total positive rate of 40.35% (46 / 114) for PoRVA G4, G5, and G9 types. Among the positive samples, G9 type was the most common (24 / 46), followed by G4 type (18 / 46), and G5 type was the least common (1 / 46). Two samples were found to be double-infected with G4+G9 type, and one sample was found to be double-infected with G5+G9 type. No triple-infected samples were detected. Forty-one samples tested positive by singlet RT-qPCR, with a positive rate of 35.96% (41 / 114), and a concordance rate of 92.98% with triplet RT-qPCR results. Sample 18 tested negative by triplet RT-qPCR but positive by singlet qPCR, and was identified as G3 type by sequencing. Except for some samples with high Ct values ​​that failed sequencing, the triplet RT-qPCR typing results of the remaining 26 successfully sequenced positive samples showed a 100% concordance rate with the sequencing results.

[0128] Table 11 Results of clinical sample detection using triple RT-qPCR and single qPCR

[0129]

[0130] Table 12 Number of positive results for each genotype in clinical samples

[0131]

[0132] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A triplex RT-qPCR primer set for detection of group A porcine rotavirus G4, G5 and G9 strains, characterized in that, The primer set comprises the following primers and probes: PoRVA G4F: GCTCCTTTTAATGTATGGTATTG; PoRVA G4R: ATTTATTCCATAATTTTGTGCATTAG; PoRVA G4P: TTCGTTCTTGTGAGTTAYATTYTGAAAAC; PoRVA G5F: GCTCCTTTTAATGTATGGTATTG; PoRVA G5R: ATCCAGTTATTGGTAAATTAATTCC; PoRVA G5P: ATAAAGTCCATTGTTCTAGTHACTGATTT; PoRVA G9F: GGCCAACTGGATCAGTYT; PoRVA G9R: ACCATTCATTTAGAATCAAATCAGC; PoRVA G9P: ATCGCTTCATTCTCAATTGAYCCACA; The 5' end of the PoRVA G4P is modified with FAM, and the 3' end is modified with BHQ1; The 5' end of the PoRVA G5P is modified with CY5, and the 3' end is modified with BHQ2; The 5' end of the PoRVA G9P is modified with Texas red, and the 3' end is modified with BHQ2.

2. Use of the primer set of claim 1 in the preparation of a triple RT-qPCR kit for detecting Group A porcine rotavirus G4, G5 and G9 strains.

3. A triplex RT-qPCR kit for detection of group A porcine rotavirus G4, G5 and G9 strains, characterized in that, The kit comprises the primer set of claim 1.

4. The kit of claim 3, wherein The kit detects Group A porcine rotavirus G4, G5 and G9 strains according to the following steps: Using the primer set of claim 1, perform triple RT-qPCR reaction on the RNA template of the sample to be tested, collect the fluorescence signal, and obtain the Ct value of the sample to be tested.

5. The kit of claim 4, wherein If the sample to be tested has no Ct value, it is negative, indicating that the sample to be tested does not contain Group A porcine rotavirus G4, G5 and G9 strains; if the Ct value of the sample to be tested is > 35, it is suspicious and needs to be detected again; If the Ct value of the sample to be tested is ≤ 35 and the fluorescence is green, it is determined that the sample to be tested contains Group A porcine rotavirus G4 strain; If the Ct value of the sample to be tested is ≤ 35 and the fluorescence is red, it is determined that the sample to be tested contains Group A porcine rotavirus G5 strain; If the Ct value of the sample to be tested is ≤ 35 and the fluorescence is orange-red, it is determined that the sample to be tested contains Group A porcine rotavirus G9 strain; If the Ct value of the sample to be tested is ≤ 35 and there is green fluorescence and red fluorescence, it is determined that the sample to be tested contains Group A porcine rotavirus G4 strain and G5 strain; If the Ct value of the sample to be tested is ≤ 35 and there is red fluorescence and orange-red fluorescence, it is determined that the sample to be tested contains Group A porcine rotavirus G5 strain and G9 strain; If the Ct value of the sample to be tested is ≤ 35 and there is green fluorescence, red fluorescence and orange-red fluorescence, it is determined that the sample to be tested contains Group A porcine rotavirus G4 strain, G5 strain and G9 strain.

6. The kit of claim 4, wherein The reaction system of the triple RT-qPCR reaction is as follows: 10 μL of reaction buffer, 0.4 μL of DNA polymerase, 0.4 μL of reverse transcriptase mixture, 0.8 μL of each of upstream and downstream primers, 0.3 μL of each of probes, 1.5 μL of ribonuclease-free water, and 2 μL of template RNA.

7. The kit of claim 4, wherein The reaction procedure of the triple RT-qPCR reaction is as follows: 42 ℃, 5 min, 95 ℃, 10 s; 95 ℃, 5 s, 48.2 ℃, 30 s, 40 cycles; 24 ℃, 30 s.

Citation Information

Patent Citations

  • New method for rapid detection of G genotype of group A rotavirus by VP7 gene

    CN102226221A

  • RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer for identifying porcine rotavirus G4, G5 and G9 type strains and detection method thereof

    CN117778622A

  • PCR (Polymerase Chain Reaction) primer and typing detection method for various porcine rotavirus subtypes

    CN118086588A