Recombinant pichia pastoris for high expression of porcine pancreatic phospholipase A2 and application of recombinant pichia pastoris

Abstract

The invention relates to recombinant pichia pastoris for high expression of porcine pancreatic phospholipase A2 and application of the recombinant pichia pastoris, and belongs to the technical field of genetic engineering. According to the method disclosed by the invention, a vacuole sorting receptor Vps10 is knocked out by utilizing a CRISPR-Cas9 system, a CPY sorting way between a trans-golgi apparatus and a vacuole is interrupted, and ppPLA2 degradation is reduced; then, in order to relieve unfolded protein response in the endoplasmic reticulum, molecular chaperones are introduced into the genome, and synthesis of ppPLA2 is enhanced; the expression intensity of the ppPLA2 is improved by increasing the gene copy number of the ppPLA2; and finally, high-density fermentation is performed in a 3-L bioreactor, so that high-efficiency expression of the ppPLA2 in the pichia pastoris is realized.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to a recombinant Pichia pastoris capable of highly expressing porcine pancreatic phospholipase A2 and an application thereof. Background Art

[0002] Phospholipase A2 (PLA2) is a family of enzymes that specifically catalyzes the hydrolysis of acyl groups at the sn-2 position of phospholipids, releasing free fatty acids and lysophospholipids. It is ubiquitous in the body and participates in a variety of physiological processes, such as lipid metabolism, inflammatory responses, and immune function. Porcine pancreatic phospholipase A2 is an important enzyme belonging to the secretory phospholipase A2 family that specifically catalyzes the hydrolysis of acyl groups at the sn-2 position of phospholipids, generating free fatty acids and lysophospholipids. It participates in a variety of physiological processes in the body, such as lipid metabolism, inflammatory responses, and cell signaling.

[0003] Traditional extraction methods involve isolation and purification from porcine pancreas, but this process is complex and costly. In recent years, researchers have used genetic engineering techniques to clone the porcine pancreatic phospholipase A2 gene into microbial expression systems, such as Pichia pastoris and Aspergillus niger, to achieve efficient expression and production of the recombinant protein.

[0004] Currently, research on porcine pancreatic phospholipase A2 primarily focuses on increasing its expression and activity. For example, by constructing multi-copy plasmids and optimizing fermentation processes, the activity and yield of recombinant phospholipase A2 have been significantly improved. Furthermore, novel separation techniques such as crystal gel chromatography have been applied to phospholipase A2 purification, improving separation efficiency and purity. However, the expression and activity of porcine pancreatic phospholipase A2 obtained through genetic recombinant production remain low. Summary of the Invention

[0005] Therefore, the technical problem to be solved by the present invention is to overcome the problem in the prior art of lacking a microbial synthesis method for high-yield and high-activity porcine pancreatic phospholipase A2.

[0006] To solve the above technical problems, the present invention provides a recombinant Pichia pastoris that highly expresses porcine pancreatic phospholipase A2 and its application. The present invention optimizes the secretory expression of ppPLA2 in Pichia pastoris through multiple strategies. The CRISPR-Cas9 system is used to knock out the vacuolar sorting receptors Vps10-1 and Vps10-2, interrupting the CPY sorting pathway between the trans-Golgi apparatus and the vacuole, reducing ppPLA2 degradation, and increasing the enzyme activity and concentration by 48.11% and 38.37%, respectively. Subsequently, in order to alleviate the unfolded protein response in the endoplasmic reticulum, the effects of 16 molecular chaperones on the secretory expression of ppPLA2 were explored, and it was finally determined that the overexpression of the chaperone protein Ero1 enhanced the disulfide synthesis of ppPLA2. The formation of the bond further increased the ppPLA2 enzyme activity and concentration by 42.64% and 94.29% at the shake flask level. Subsequently, by increasing the copy number of the ppPLA2 gene, the expression intensity of ppPLA2 was improved, and the ppPLA2 enzyme activity and concentration of the 2-copy strain were further increased by 142.40% and 36.97% respectively. The engineered strain X33-EXG1-ppPLA2-CN2-ΔVps10-1 / 2-Ero1 was fermented at high density in a 3-L bioreactor. After 120 h of methanol induction, the ppPLA2 enzyme activity and concentration increased to 1.83×10 5 ±469.07U·L -1 , 1.79±0.21g·L -1 , which is 70 times and 38.48 times higher than the shake flask level.

[0007] A first object of the present invention is to provide a recombinant Pichia pastoris that highly expresses porcine pancreatic phospholipase A2. The recombinant Pichia pastoris is obtained by modifying Pichia pastoris (Komagataella phaffii) as follows: constructing a porcine pancreatic phospholipase A2 expression cassette and a molecular chaperone, and knocking out the vacuolar sorting receptor Vps10-1 and / or the vacuolar sorting receptor Vps10-2; wherein the porcine pancreatic phospholipase A2 expression cassette comprises an AOX1 promoter, an EXG1 signal peptide, porcine pancreatic phospholipase A2, and a terminator, and the molecular chaperone is selected from any one of Rpl10, Rpl43, Mxr1, Prm1, Mit1, Cpr6, Fes1, Hac1, Hsp28, Jem1, Kar2, Rft1, Pdi1, Ssa1, Sti1, and Ero1.

[0008] Furthermore, the recombinant Pichia pastoris overexpresses 1-4 copies of porcine pancreatic phospholipase A2. Preferably, the gene copy number of porcine pancreatic phospholipase A2 is 2.

[0009] Furthermore, the GenBank ID of the porcine pancreatic phospholipase A2 is CAA68341.1.

[0010] Furthermore, the porcine pancreatic phospholipase A2 expression cassette includes the start codon ATG, the AOX1 promoter, the EXG1 signal peptide, the gene sequence shown in SEQ ID NO.1 or 2, and the terminator, and the intron INT6 and / or intron INT15 of Pichia pastoris are replaced with the porcine pancreatic phospholipase A2 expression cassette, wherein the INT6 is located at 17928-17947 of Pichia pastoris ChrII, and INT15 is located at 1910010-1910029 of Pichia pastoris ChrIII.

[0011] Further, SEQ ID NO.1:

[0012] GCCTTATGGCAATTTAGGTCAATGATAAAATGCGCTATCCCTGGTTCCCACCCTCTAATGGACTTCAACAATTACGGCTGTTACTGTGGACTAGGCGGATCTGGCACGCCCGTTGATGAACTGGATCGTTGCTGTGAGACGCACGATAATTGCTATAGGGACGCAAAAAACTTAGACTC ATGTAATCCTTATACTGAGTCCTATTCATACAGTTGTTCTAATACTGAGATCACCTGCAATTCTAAGAATAACGCTTGCGAAGCTTTTATGTAACTGTGATAGGAACGCCGCTATATGCTTTTCCAAGGCACCATACAACAAAGAGCACAAAAATTTGGACACGAAGAAATACTGT.

[0013] Further, SEQ ID NO.2:

[0014] GCCCTGTGGCAGTTCCGGTCGATGATCAAATGCGCAATTCCGGGTTCCCATCCCTTAATGGACTTTAATAACTATGGCTGCTACTGCGGACTCGGAGGCAGTGGGACGCCAGTTGATGAGCTAGACCGTTGCTGTGAGACACACGATAATTGTTATCGCGACGCTAAAAATTTGGATAG CTGTAACCCATACACGGAATCATATTCCTATTCTTGTTCAAATACCGAAATAACCTGCAACAGTAAGAATAACGCTTGCGAAGCGTTCATCTGTAATTGTGATAGGAATGCGGCAATTTGCTTTTTAAAGCCCCTTACAACAAGGAGCACAAAAACCTTGACACTAAAAAGTACTGT.

[0015] Furthermore, the Gene ID of the vacuolar sorting receptor Vps10-1 is 8198939, PAS_chr2-1_0625, and the Gene ID of the vacuolar sorting receptor Vps10-2 is 8199852, PAS_chr3_0653.

[0016] Furthermore, the NCBI number of the Rpl10 is PAS_chr2-2_0054, the NCBI number of the Rpl43 is PAS_chr3_0336, the NCBI number of the Mxr1 is PAS_chr4_0487, the NCBI number of the Prm1 is PAS_chr4_0203, the NCBI number of the Mit1 is PAS_chr3_0836, the NCBI number of the Cpr6 is PAS_chr3_0567, the NCBI number of the Fes1 is PAS_chr2-1_0042, and the NCBI number of the Hac1 is PAS_chr1-1_0381. The NCBI number of the Hsp28 is PAS_chr1-4_0072, the NCBI number of the Jem1 is PAS_chr2-2_0015, the NCBI number of the Kar2 is PAS_chr2-1_0140, the NCBI number of the Rft1 is PAS_chr4_0844, the NCBI number of the Pdi1 is PAS_chr4_0443, the NCBI number of the Ssa1 is PAS_chr4_0552, the NCBI number of the Sti1 is PAS_chr2-1_0518, and the NCBI number of the Ero1 is PAS_chr1-1_0011.

[0017] Furthermore, the NCBI number of the AOX1 promoter is PAS_chr4_0821, and the NCBI number of the EXG1 signal peptide is PAS_chr2-1_0454.

[0018] Furthermore, the Pichia pastoris includes Pichia pastoris X33.

[0019] The second object of the present invention is to provide a use of the above-mentioned recombinant Pichia pastoris in the preparation of porcine pancreatic phospholipase A2, wherein the recombinant Pichia pastoris is inoculated into a fermentation medium and fermented to obtain the porcine pancreatic phospholipase A2.

[0020] Furthermore, the fermentation medium contains one or more of a carbon source, a nitrogen source, an inorganic salt and a metal ion, wherein the carbon source includes glycerol or methanol.

[0021] Furthermore, the fermentation culture includes glycerol fermentation culture, starvation culture and methanol fermentation culture;

[0022] Wherein, the carbon source of the glycerol fermentation culture is glycerol;

[0023] When the glycerol content in the culture medium is 0 g / L, starvation culture is performed, wherein no carbon source is added to the fermentation medium of the starvation culture, and the starvation culture time is 1-2 hours;

[0024] The carbon source of the methanol fermentation culture is methanol.

[0025] Beneficial effects of the present invention:

[0026] The present invention optimizes the secretory expression of ppPLA2 in Pichia pastoris through multiple strategies. The CRISPR-Cas9 system is used to knock out the vacuolar sorting receptors Vps10-1 and Vps10-2, interrupting the CPY sorting pathway between the trans-Golgi apparatus and the vacuole, reducing the degradation of ppPLA2, and increasing the enzyme activity and concentration by 48.11% and 38.37%, respectively. Subsequently, in order to alleviate the unfolded protein response in the endoplasmic reticulum, the effects of 16 molecular chaperones on the secretory expression of ppPLA2 were explored, and it was finally determined that the overexpression of the chaperone protein Ero1 enhanced the disulfide synthesis of ppPLA2. The formation of the bond further increased the ppPLA2 enzyme activity and concentration by 42.64% and 94.29% at the shake flask level. Subsequently, by increasing the copy number of the ppPLA2 gene, the expression intensity of ppPLA2 was improved, and the ppPLA2 enzyme activity and concentration of the 2-copy strain were further increased by 142.40% and 36.97% respectively. The engineered strain X33-EXG1-ppPLA2-CN2-ΔVps10-1 / 2-Ero1 was fermented at high density in a 3-L bioreactor. After 120 h of methanol induction, the ppPLA2 enzyme activity and concentration increased to 1.83×10 5 ±469.07U·L -1 , 1.79±0.21g·L -1 , which is 70 times and 38.48 times higher than the shake flask level. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings, wherein

[0028] Figure 1 This is a flow chart of efficient expression of ppPLA2;

[0029] Figure 2 It is a schematic diagram of the homologous recombination mechanism;

[0030] Figure 3 It is the Vps10-mediated CPY sorting mechanism;

[0031] Figure 4 It is the CRISPR-Cas9-mediated gene knockout mechanism;

[0032] Figure 5 The effect of Vps10-1, Vps10-2, and Prb1 deletion on ppPLA2 secretion expression was analyzed by SDS-PAGE;

[0033] Figure 6 is the effect of the deletion of Vps10-1, Vps10-2, and Prb1 on ppPLA2 fermentation;

[0034] Figure 7 It is the construction of strains that overexpress molecular chaperones;

[0035] Figure 8 Effects of overexpression of molecular chaperones on ppPLA2 secretion; (a) Effects of molecular chaperones on ppPLA2 concentration, enzyme activity, and cell growth; (b) SDS-PAGE analysis of ppPLA2 expression in culture supernatant;

[0036] Figure 9 It is a multi-copy integration mechanism;

[0037] Figure 10 The effect of ppPLA2 gene copy number on its secretory expression; (a) SDS-PAGE analysis of the effect of gene copy number on ppPLA2; (b) The effect of gene copy number on ppPLA2 enzyme activity; (c) The effect of gene copy number on the growth of recombinant strains;

[0038] Figure 11 This is the high-density fermentation of the engineered strain X33-ppPLA2-CN2-ΔVps10-1 / 2-Ero1 in a 3-L bioreactor. (a) Determination of the biomass of the engineered strain X33-ppPLA2-CN2-ΔVps101 / 2-Ero1 and analysis of the enzyme activity of the produced ppPLA2; (b) SDS-PAGE analysis of the secretory expression of ppPLA2. DETAILED DESCRIPTION

[0039] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0040] The biological operations involved in the following examples are as follows:

[0041] (1) CRISPR-Cas9-mediated gene editing

[0042] (1) Construction of Cas9 plasmid

[0043] Using the pCas9-Mre11-sgRNA-GUT1 plasmid as a template, the pCas9-Mre11-sgRNA plasmid containing different sgRNAs was constructed by PCR amplification. The sgRNA sequences were designed and obtained through the CHOPCHOP (http: / / chopchop.cbu.uib.no / ) website.

[0044] (2) Construction of DNA donor fragment and DNA integration expression cassette

[0045] DNA donors for Vps10-1, Vps10-2, and Prb1: First, the upstream and downstream homology arms (HAs, 750-1000 bp in length) of each gene were amplified from the K. phaffii X33 genome, and then the upstream and downstream homology arms were fused by overlap extension PCR amplification to construct a DNA donor expression cassette.

[0046] Construction of molecular chaperone (including 16 types such as Rpl10 and Rpl43): The target protein coding sequence, PGAP promoter and HAs of the INT1 site were amplified from the K. phaffii X33 genome; at the same time, the TAOX1 terminator was amplified from the pPICZαA plasmid; the above fragments were fused to form a molecular chaperone integration expression cassette; at the same time, in order to allow for reuse, the primer pair INT1-28a-F / R was used for fusion PCR during the second round of fusion to construct the molecular chaperone integration expression cassette plasmid.

[0047] Construction of a multi-copy expression cassette: The ppPLA2 gene sequence was codon-optimized by Nanjing GenScript Biotechnology Co., Ltd. to generate the two-codon plasmids pPICZαA-ppPLA2 and pPICZαA-ppPLA2c2. Using the pPICZαA-ppPLA2 plasmid as a backbone, the PAOX1-ppPLA2-TAOX1 expression cassette was amplified by PCR using primers AOX1-INT6-F / R. Simultaneously, the HAs of INT6 was amplified from the K. phaffii X33 genome. The two DNA fragments were then fused to create the single-copy integrative expression cassette INT6-CN1. For ppPLA2c2, the pPICZαA-ppPLA2c2 plasmid was used as the backbone, and the PAOX1-ppPLA2 sequence was amplified by PCR using the primer pair AOX1-INT6-F / ppPLA2-R. The terminator TDAS1 and the HAs of INT15 were simultaneously amplified from the K. phaffii X33 genome. These DNA fragments were then fused to create the single-copy integration expression cassette INT15-CN1. For the dual-copy expression cassette, to avoid mismatching of homologous sequences, the ppPLA2 expression cassettes for the two codons were connected by a 29-bp overlap, and then fused to the HAs of INT6 and INT15, respectively, to create the dual-copy expression cassettes INT6-CN2 and INT15-CN2.

[0048] (II) Construction of recombinant Pichia pastoris strains

[0049] 1. Construction of recombinant strains using homologous recombination

[0050] In the Pichia pastoris expression system, the plasmid used for transformation often does not contain its own replication origin. If the circular plasmid is directly transferred into the cell, the plasmid cannot exist stably. Therefore, it must be linearized and integrated into the chromosome by homologous recombination. Only then will the target gene exist stably in the cell ( Figure 2 ).

[0051] Take the plasmid pPICZαA-ppPLA2 as an example. The protein sequence of ppPLA2 was obtained from UniProt (http: / / chopchop.cbu.uib.no / ). The ppPLA2 gene sequence was optimized according to the codon preference of Pichia pastoris and directly inserted between the α-MF signal peptide and the His tag of the pPICZαA plasmid (Suzhou GENEVIZ Company) to obtain the plasmid pPICZαA-ppPLA2. The primer pair AOX1-Line-F / R was used for linearization. After PCR product recovery, it was transformed into Pichia pastoris and the protein sequence was obtained from the culture medium containing 100 μg·L -1 Positive single clones were picked from the Zeocin YPD transformation plate for colony PCR verification. After the correct size was verified by agarose gel electrophoresis, the construction of the recombinant strain was completed.

[0052] 2. Construction of recombinant strains using the CRISPR-Cas9 system

[0053] When using the CRISPR-Cas9 system for gene editing, 1 μg of pCas9-Mre11-sgRNA plasmid is mixed with 5 μg of DNA donor fragment or DNA integration expression cassette, and then Pichia pastoris is transformed. Positive single clones are picked from the transformation plate for colony PCR verification and size verification by agarose gel electrophoresis to determine whether the construction of the recombinant strain is complete.

[0054] After knockout or integration using the CRISPR-Cas9 system, the Cas9 plasmid needs to be eliminated for subsequent gene editing. To eliminate the Cas9 plasmid, select a verified strain and culture it in 5 mL of antibiotic-free YPD liquid medium for 16-20 hours. Then, streak it onto antibiotic-free YPD plates for 2-3 days. Once single colonies have grown, pick 6-12 single colonies and transfer them to antibiotic-free YPD and YPD plates containing Zeocin. Colonies that grow on YPD plates but not on YPD plates containing Zeocin are considered to have successfully eliminated the Cas9 plasmid.

[0055] (3) Fermentation of recombinant Pichia pastoris

[0056] 1. Shake flask fermentation

[0057] The shake flask fermentation method of the recombinant Pichia pastoris strain is shown in Table 1.

[0058] Table 1 Shake flask fermentation steps and operating instructions

[0059]

[0060] 2. Bioreactor scale-up culture

[0061] The high-density fermentation method of the recombinant Pichia pastoris strain in a 3-L bioreactor is shown in Table 2 .

[0062] Table 2 Relevant steps and operating instructions for bioreactor scale-up culture

[0063]

[0064]

[0065] The culture medium used is as follows:

[0066] YPD (Yeast extract peptone dextrose) medium: 10 g L -1 Yeast powder, 20g·L -1 Peptone, 10 g L -1 glucose;

[0067] BMGY (Buffered Glycerol-complex) medium: yeast powder, 20 g L -1 Peptone, 100 mL·L -1 1 M potassium phosphate buffer (pH 6.0), 13.4 g·L -1 YNB, 0.0004 g·L-1 biotin, 10 mL·L -1 glycerin;

[0068] BMMY (Buffered Methanol-complex) medium: 10 g·L -1 Yeast powder, 20g·L -1 Peptone, 100 mL·L -1 1 M potassium phosphate buffer (pH 6.0), 13.4 g·L -1 YNB, 0.0004 g L -1 Biotin, 15 mL·L -1 Methanol.

[0069] BSM medium: 0.93 g / L CaSO4, 18 g / L K2SO4, 7.28 g / L MgSO4, 4.13 g / L KOH, 40 g / L glycerol, 26.7 mL / L phosphoric acid.

[0070] PTM1 trace elements: 6 g / L CuSO4·5H2O, 0.08 g / L NaI, 3 g / L MnSO4·H2O, 0.2 g / LNa2MoO4·2H2O, 0.02 g / L H3BO3, 0.5 g / L CoCl2, 20 g / L ZnCl2, 65 g / L FeSO4·7H2O and 0.2 g / L biotin.

[0071] (IV) Related analysis and verification

[0072] 1. Cell density and fluorescence measurement

[0073] 2. Cell density, OD 600 As the evaluation criteria for biomass; mScarlet-I fluorescence intensity and OD 600 The ratio FL / OD 600 , that is, relative fluorescence intensity, is used as the standard for fluorescence screening.

[0074] 2. ppPLA2 enzyme activity assay

[0075] The enzyme activity of ppPLA2 was determined according to Phospholipase A2 Assay Kit (ThermoFisher Scientific, USA) was used for determination.

[0076] 3. ppPLA2 secretion expression detection

[0077] In order to detect the secretion expression level of ppPLA2, after the fermentation of the recombinant strain was completed, the culture medium was centrifuged at room temperature and 10,000 rpm for 20 minutes to obtain the culture supernatant, which was then filtered through a 0.45 μm microporous filter membrane to obtain the culture supernatant for subsequent analysis, and the excess sample was stored at 4°C.

[0078] Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was used to separate the proteins. The C-terminus of the recombinant protein was fused with a His tag, and the protein purifier AKTAPURE 25L (Cytiva, Sweden) was used to purify the ppPLA2 in the culture supernatant. After the purification column HisTrap HP (Cytiva, Sweden) was connected to AKTA, the column was equilibrated with binding buffer A. After the baseline was balanced, the crude enzyme solution sample filtered through a 0.45 μm microporous filter membrane was pumped into the column at a flow rate of 5 mL·min-1 using an automatic sampler. The sample volume was about 50 mL. After the loading was completed, the column was equilibrated with 10 times the column volume of binding buffer A to remove residual impurities. After the 280 nm detection baseline was stable, the target protein bound to the column was eluted with elution buffer B, and the eluted protein was collected in stages by a collector. The recombinant enzyme obtained after purification was eluted using 50 mM Tris-HCl (pH 7.5) at The product was desalted by ultrafiltration using an Ultra filter (3 kDa MWCO). After purification, the concentration of ppPLA2 was determined using a modified Bradford protein quantification kit (Shanghai Sangon Co., Ltd.).

[0079] The primers involved in the following examples are shown in Table 3

[0080] Table 3 Primers involved in the following examples

[0081]

[0082]

[0083]

[0084] Example 1: Effect of blocking protein degradation pathway on ppPLA2 secretion expression

[0085] Yeast itself has a strict quality control system in the protein secretion pathway. When the polypeptide chain is introduced into the endoplasmic reticulum by the signal peptide for folding and post-translational modification, it will trigger the unfolded protein response (UPR). In order to maintain cell homeostasis, misfolded or aggregated proteins are easily transferred to the vacuole for digestion and decomposition by various sorting proteins. Figure 3This is a schematic diagram of the Golgi-CPY sorting mechanism and the secretory pathway of secretory proteins in Pichia pastoris. Vps10, as a sorting receptor for CPY, recognizes the CPY precursor in the trans-Golgi and directs it to the vacuole, thereby activating the CPY hydrolytic protease activity. When a large number of heterologous proteins are processed in the endoplasmic reticulum, if Vps10 incorrectly sorts and directs them to the vacuole containing multiple protease hydrolytic enzyme activities, it may eventually cause the target protein to be degraded by the protease in the vacuole (such as activated CPY, Prb1, etc.), thereby affecting the expression intensity of the protein. Therefore, interrupting the CPY sorting pathway and knocking out the vacuolar protease can enhance the expression level of heterologous proteins. In this example, based on the recombinant strain X33-EXG1-pro-ppPLA2, the vacuolar sorting receptors Vps10-1 and Vps10-2 and the protease Prb1 were knocked out using the CRISPR-Cas9 system to explore their effects on the expression level of ppPLA2.

[0086] First, this example constructs a CRISPR-Cas9 gene editing system. The sgRNA sequence is introduced into the pCas9-Mre11-sgRNA plasmid by reverse PCR with primers to obtain pCas9-Mre11-sgRNA-Vps10-1, pCas9-Mre11-sgRNA-Vps10-2, and pCas9-Mre11-sgRNA-Prb1 plasmids. Using K. phaffii X33 as a template, colony PCR was performed using primers to amplify the upstream and downstream homology arms of Vps10-1, Vps10-2, and Prb1, and then agarose gel electrophoresis verification and DNA recovery were performed. Then, the donor DNA fragment was obtained by fusion PCR. The gene knockout process is as follows Figure 4 The sgRNA plasmid and donor DNA fragment were transformed into the recombinant strain X33-EXG1-pro-ppPLA2. After colony PCR verification and Sanger sequencing, the single knockout strains X33-EXG1-pro-ppPLA2-ΔVps10-1, X33-EXG1-pro-ppPLA2-ΔVps10-2, and X33-EXG1-pro-ppPLA2-ΔPrb1 were obtained. The double knockout strain X33-EXG1-pro-ppPLA2-ΔVps10-1 / 2 was generated by eliminating the pCas9-Mre11-sgRNA plasmid from the single knockout strain X33-EXG1-pro-ppPLA2-ΔVps10-1 and knocking out Vps10-2.

[0087] The above strains were fermented in shake flasks. Figure 5The results of SDS-PAGE analysis showed that single knockout of Vps10-1, Vps10-2, and double knockout of Vps10 had no negative effect on ppPLA2 secretion, while the loss of Prb1 inhibited ppPLA2 secretion. Further determination of protein content showed that the ppPLA2 concentration of the Vps10 double knockout strain reached 116.16±8.1mg / ·L. -1 , which increased by 38.37% compared with the control strain (X33-EXG1-pro-ppPLA2); the ppPLA2 concentrations of Vps10-1 and Vps10-2 single knockout strains were similar to those of the control, at 88.03±0.92 mg·L -1 and 85.48±1.26mg / ·L -1 The ppPLA2 concentration of the Prb1 knockout strain decreased to 61.4±0.93 mg·L -1 , only 73.14% of the control ( Figure 5 ).

[0088] Subsequently, enzyme activity assays showed that the deletion of Prb1 reduced ppPLA2 activity by 52.31% compared with the control strain, while the double deletion of Vps10-1 / 2 significantly increased ppPLA2 activity, reaching 755.93±20.84 U·L after 120 h of induction. -1 , which was 48.11% higher than the control ( Figure 6 a) The activity of the Vps10-1 knockout strain increased slightly to 566.59±31.32 U·L. -1 , while the activity of the Vps10-2 single knockout strain was lower, at 431.84±102.18 U·L -1 ( Figure 6 a) Double deletion of Vps10-1 / 2 significantly increased both the enzymatic activity and concentration of ppPLA2. This suggests that single deletion of either Vps10-1 or Vps10-2 does not completely disrupt the sorting pathway, while double deletion of Vps10-1 / 2 completely blocks ppPLA2 from being targeted to the vacuole by Vps10, thereby reducing its degradation by vacuolar proteases and ultimately enhancing secretion. However, single deletion of Prb1 does not completely block the CPY degradation pathway, which allows Vps10 to recognize peptides and target them to the vacuole. Furthermore, other vacuolar proteases can still degrade ppPLA2 that has been missorted into the vacuole.

[0089] In addition, if Figure 6 b shows that the OD of the recombinant strain 600Monitoring of the CPY values showed that the growth state of the modified strain was basically normal, and the genetic modification did not seriously affect the enzyme activity of the cell itself. These findings emphasize the importance of Vps10 in regulating protein degradation and reveal the potential of enhancing recombinant protein secretion in K. phaffii by interrupting the CPY sorting pathway.

[0090] Example 2: Effects of molecular chaperones on the secretory expression of ppPLA2

[0091] The UPR is a highly conserved cellular response in eukaryotic cells that counteracts endoplasmic reticulum stress (ER stress). Rapid cell growth itself causes the UPR, which increases with gene copy number and protein synthesis. ppPLA2, which contains seven pairs of disulfide bonds, has a suboptimal folding environment in the ER, resulting in large accumulation of unfolded and misfolded ppPLA2. In Example 1, the ER burden was alleviated to a certain extent due to the missorting of Vps10, but the UPR became more intense when the CPY pathway was interrupted. Transcription factors and chaperone proteins related to processes such as peptide chain synthesis, folding, and disulfide bond formation are crucial for the early stages of protein secretion, and molecular chaperones are often overexpressed to reduce the burden on the ER. Therefore, overexpression of transcription factors and chaperone proteins is effective for enhancing the expression level of heterologous proteins. As shown in Table 4 below, this example explores the effects of molecular chaperones on the secretory expression of ppPLA2 by constitutively overexpressing 16 molecular chaperones using the CRISPR-Cas9 system.

[0092] Table 4 Numbers and functions of 16 molecular chaperones

[0093]

[0094]

[0095] The genome integration process Figure 7As shown in the figure, the sgRNA sequence was introduced into the pCas9-Mre11-sgRNA plasmid using inverse PCR with primers to generate the corresponding sgRNA plasmid. Using K. phaffii X33 as a template, colony PCR with primers was performed to amplify gene fragments of Rpl10, Rpl43, Mxr1, Prm1, Mit1, Cpr6, Fes1, Hac1, Hsp28, Jem1, Kar2, Rft1, Pdi1, Ssa1, Sti1, and Ero1, as well as the promoter PGAP sequence, the terminator TAOX1 sequence, and the upstream and downstream homology arms of INT 1. The fragments were verified by agarose gel electrophoresis and DNA was recovered. The constitutive chaperone overexpression cassette was then generated by fusion PCR. The sgRNA plasmid and overexpression cassette DNA fragments were transformed into the recombinant strain X33-EXG1-pro-ppPLA2-ΔVps10-1 / 2. After colony PCR verification and Sanger sequencing, strains overexpressing multiple chaperones were generated.

[0096] Shake flask fermentation results showed that compared with the control strain (X33-EXG1-pro-ppPLA2-ΔVps10-1 / 2), overexpression of Rpl10, Rpl43, Mxr1, and Mit1 led to a decrease in ppPLA2 enzyme activity by 18.93%, 17.77%, 15.46%, and 39.65%, respectively. However, overexpression of Hac1, Kar2, Pdi1, and Ero1 significantly increased ppPLA2 enzyme activity by 29.59%, 11.82%, 25.1%, and 42.61%, respectively, reaching 979.59±11.98 U·L -1 、845.29±15.83U·L -1 , 945.65±18.27U·L -1 and 1078.03±21.16U·L -1 ; However, the ppPLA2 enzyme activity after overexpression of Prm1, Cpr6, Fes1, Hsp28, Jem1, Rft1, Ssa1 and Sti1 was similar to that of the control ( Figure 8 a).

[0097] Subsequently, SDS-PAGE analysis showed that the extracellular expression levels of ppPLA2 in different strains were different ( Figure 8b). This difference is hypothesized to be due to the presence of seven disulfide bonds in ppPLA2. Correct folding of ppPLA2 is crucial for its stability and activity. ppPLA2 faces a poor folding environment in the endoplasmic reticulum of the original strain, so overexpressing Kar2, Pdi1, or Ero1 (all genes involved in disulfide bond formation in the yeast endoplasmic reticulum) alleviated this problem. Compared to the control strain, overexpression of Pdi1 and Ero1 increased ppPLA2 concentrations by 42.56% and 94.29%, respectively, to 165.60 ± 2.34 mg·L. -1 and 225.69±1.02mg·L -1 )( Figure 8 a); Overexpression of Kar2 resulted in a 13% decrease in ppPLA2 concentration ( Figure 8 a) Hac1 acts as a UPR response factor in yeast, activating UPR components (such as Kar2, Pdi1, and Ero1) to regulate their gene expression. Overexpression of Hac1 enhanced the cellular response to UPR caused by ER stress, increasing ppPLA2 concentration by 26.28% to 146.69±6.91 mg·L -1 ( Figure 8 a).

[0098] Based on the above studies, the engineered strain X33-EXG1-ppPLA2-ΔVps101 / 2-ERO1 showed the highest ppPLA2 enzyme activity (1078.03±21.16U·L -1 ) and concentration (225.69±1.02mg·L -1 )( Figure 8 These findings highlight the key role of molecular chaperones in improving the expression levels of recombinant proteins expressed by K. phaffii.

[0099] Example 3: Effect of gene copy number on ppPLA2 secretion expression

[0100] In multicopy strains, mRNA molecules generated by multiple gene copies can be read simultaneously by multiple ribosomes during the translation phase, thereby improving the efficiency of protein synthesis. Therefore, to further improve the expression intensity of ppPLA2, this study increased the gene copy number to increase the synthesis capacity of ppPLA2. Figure 9Schematic diagram of multi-copy integration of the ppPLA2 gene. The single-copy expression cassette A contains the promoter PAOX1, signal peptide EXG1-pro, ppPLA2, and terminator TAOX1. To prevent repeated use of ppPLA2 with repetitive DNA sequences, which could trigger homologous recombination between the repetitive sequences and lead to genetic instability, we codon-optimized the ppPLA2 gene sequence (Nanjing GenScript) and linked it between the signal peptide EXG1-pro and terminator TDAS1 to create the single-copy expression cassette B (promoter PAOX1, signal peptide EXG1-pro, ppPLA2-2, and terminator TDAS1). The two-copy expression cassette is formed by connecting the single-copy expression cassettes A and B with a 29-bp overlap. Simultaneously, based on the host optimization results described above, the X33-ΔVps101 / 2-Ero1 chassis cell line was reconstructed. Subsequently, based on the chassis cells, the CRISPR-Cas9 system was used to increase the copy number of the ppPLA2 gene, and engineered strains containing 1-4 copies were constructed, namely X33-INT6-CN1-ΔVps10-1 / 2-Ero1 (1 copy; INT6-CN1), X33-ppPLA2-CN2-ΔVps10-1 / 2-Ero1 (2 copies; INT6-CN1 and INT15-CN1), X33-ppPLA2-CN3-ΔVps10-1 / 2-Ero1 (3 copies; INT6-CN1 and INT15-CN1), and X33-ppPLA2-CN3-ΔVps10-1 / 2-Ero1 (4 copies; INT6-CN1 and INT15-CN1). CN2) and X33-ppPLA2-CN4-ΔVps10-1 / 2-Ero1 (4 copies; INT6-CN2 and INT15-CN2), where INT6-CN1 means replacing the single copy expression frame A at the INT6 site; INT15-CN1 means replacing the single copy expression frame B at the INT15 site; INT6-CN1 and INT15-CN2 mean replacing the single copy expression frame A at INT6 and the double copy expression frame at INT15; INT6-CN2 and INT15-CN2 mean replacing the double copy expression frame at the INT6 and 15 sites.

[0101] SDS-PAGE analysis showed that the ppPLA2 production of strains containing 2, 3, and 4 copies increased to 309.13 ± 1.17 mg·L, respectively. -1 , 250.52±3.21mg·L -1 and 268.57±2.11mg·L -1 , which were 136.97%, 111.00% and 119.00% of the control strain's yield ( Figure 10a) As the number of gene copies increased, the enzyme activity of ppPLA2 also increased to varying degrees. The activity of strains containing three or four copies of ppPLA2 was higher than that of strains containing one copy, increasing by 24.98% and 59.99%, respectively, but still lower than that of strains containing two copies. The ppPLA2 activity of the strain X33-ppPLA2-CN2-ΔVps10-ERO1 reached 2.61×10 3 ±122.90U·L -1 , which is 242.40% of 1 copy ( Figure 10 b).

[0102] In addition, as the copy number increased, the OD values of strains containing different copy numbers increased. 600 The value gradually decreased, but when the copy number was 2, although the cell growth was inhibited, it did not have a significant effect on the secretion expression and enzyme activity of ppPLA2 ( Figure 10 ). The above phenomenon may be attributed to the excessive metabolic burden caused by multiple gene copies. When the copy number is ≤2, the gene dosage effect causes the amount of mRNA and protein synthesis to increase with the increase in copy number, thereby increasing the yield of recombinant protein. When the gene copy number exceeds 2, the energy and raw materials (such as ATP, amino acids, etc.) in the host cell will be over-consumed, resulting in intensified competition for metabolic resources in the cell, thereby causing host metabolic overload and inhibiting its growth rate. In addition, high expression of ppPLA2 may aggravate protein misfolding, forming inactive products or retaining them in the ER and Golgi apparatus, thereby causing overload of the secretory pathway; at the same time, due to the accumulation of misfolded proteins or the accumulation of toxic substances in the cellular metabolic environment, the production of ppPLA2 no longer increases significantly or even decreases.

[0103] Example 4: Bioreactor scale-up validation

[0104] Pichia pastoris is capable of high-density fermentation and efficient expression of recombinant proteins in a simple mineral salt medium (BSM). During the high-cell density fermentation of Pichia pastoris, methanol addition is usually initiated when the cells reach a certain growth stage or a specific metabolic state. After continuous culture stages such as seed culture, glycerol batch fermentation (18-24 hours), and glycerol batch feeding (8-10 hours), complete depletion of glycerol triggers a rebound in dissolved oxygen (DO), a phenomenon that indicates that the cells have achieved high biomass accumulation. Subsequently, after the cells have depleted the culture medium and residual intracellular carbon source through starvation culture (2-3 hours), methanol addition is initiated. Starting methanol addition at this transition point has a dual effect: it can maintain the metabolic activity of the cells, activate the expression of heterologous proteins, and avoid the inhibitory effect of glycerol on methanol-induced recombinant proteins. To evaluate the biosynthetic ability of the engineered strain X33-ppPLA2-CN2-ΔVps10-1 / 2-Ero1, high-density fermentation was carried out in a 3-L bioreactor using BSM inorganic salt medium, and samples were taken every 24 h to determine the activity, content, and dry weight of ppPLA2.

[0105] After 24 h of inoculation into the 3-L bioreactor, the cell dry weight reached 17.09 ± 0.25 g·L -1 At this time, glycerol was added and batch feeding was performed. During the 10-h feeding period, the bacteria proliferated rapidly and the cell dry weight reached 78.89±1.42 g·L -1 After starvation culture (2 h), methanol was added to induce fermentation. During the fermentation induction period, the enzyme activity and dry weight of ppPLA2 gradually increased. After 120 h of fermentation induction, the enzyme activity increased from 6.85×10 4 ±4.74×10 3 U.L. -1 (24h) increased to 1.83×10 5 ±469.07U·L -1 (120 h), increased by about 1.67 times, and the dry weight reached 122.17 ± 1.29 g·L -1 ( Figure 11 a). Figure 11 The SDS-PAGE results in b showed that after 120 h of induction, the concentration of ppPLA2 increased to 1.79 ± 0.21 g·L -1 The activity and concentration of ppPLA2 were 70.13-fold and 5.79-fold higher than those observed in shake flask culture, respectively. In summary, the engineered strain X33-ppPLA2-CN2-ΔVps10-Ero1 achieved efficient expression of ppPLA2 in a 3-L bioreactor and has the potential for further optimization for industrial large-scale production.

[0106] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will appreciate that other variations or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. A recombinant Pichia pastoris that highly expresses porcine pancreatic phospholipase A2, characterized in that: The recombinant Pichia pastoris is modified in the following manner on Pichia pastoris: porcine pancreatic phospholipase A2 and molecular chaperones are overexpressed, and vacuolar sorting receptor Vps10-1 and / or vacuolar sorting receptor Vps10-2 are knocked out; wherein the porcine pancreatic phospholipase A2 is enhanced in expression by an AOX1 promoter and an EXG1 signal peptide, and the molecular chaperone is selected from any one of Rpl10, Rpl43, Mxr1, Prm1, Mit1, Cpr6, Fes1, Hac1, Hsp28, Jem1, Kar2, Rft1, Pdi1, Ssa1, Sti1 and Ero1.

2. The recombinant Pichia pastoris according to claim 1, characterized in that The recombinant Pichia pastoris overexpresses 1-4 copies of porcine pancreatic phospholipase A2.

3. The recombinant Pichia pastoris according to claim 1, characterized in that The GenBank ID of the porcine pancreatic phospholipase A2 is CAA68341.

1.

4. The recombinant Pichia pastoris according to claim 1, characterized in that The Gene ID of the vacuolar sorting receptor Vps10-1 is 8198939, and the Gene ID of the vacuolar sorting receptor Vps10-2 is 8199852.

5. The recombinant Pichia pastoris according to claim 1, characterized in that The NCBI number of the Rpl10 is PAS_chr2-2_0054, the NCBI number of the Rpl43 is PAS_chr3_0336, the NCBI number of the Mxr1 is PAS_chr4_0487, the NCBI number of the Prm1 is PAS_chr4_0203, the NCBI number of the Mit1 is PAS_chr3_0836, the NCBI number of the Cpr6 is PAS_chr3_0567, the NCBI number of the Fes1 is PAS_chr2-1_0042, the NCBI number of the Hac1 is PAS_chr1-1_0381, The NCBI number of the Hsp28 is PAS_chr1-4_0072, the NCBI number of the Jem1 is PAS_chr2-2_0015, the NCBI number of the Kar2 is PAS_chr2-1_0140, the NCBI number of the Rft1 is PAS_chr4_0844, the NCBI number of the Pdi1 is PAS_chr4_0443, the NCBI number of the Ssa1 is PAS_chr4_0552, the NCBI number of the Sti1 is PAS_chr2-1_0518, and the NCBI number of the Ero1 is PAS_chr1-1_0011.

6. The recombinant Pichia pastoris according to claim 1, characterized in that The NCBI number of the AOX1 promoter is PAS_chr4_0821, and the NCBI number of the EXG1 signal peptide is PAS_chr2-1_0454.

7. The recombinant Pichia pastoris according to claim 1, characterized in that The Pichia pastoris includes Pichia pastoris X33.

8. Use of the recombinant Pichia pastoris according to any one of claims 1 to 7 in the preparation of porcine pancreatic phospholipase A2, characterized in that: The recombinant Pichia pastoris is inoculated into a fermentation medium for fermentation and culture to obtain the porcine pancreatic phospholipase A2.

9. The use according to claim 8, characterized in that The fermentation medium contains one or more of a carbon source, a nitrogen source, an inorganic salt and a metal ion, wherein the carbon source includes glycerol and / or methanol.

10. The use according to claim 9, characterized in that The fermentation culture includes glycerol fermentation culture, starvation culture and methanol fermentation culture; Wherein, the carbon source of the glycerol fermentation culture is glycerol; When the glycerol content in the culture medium is 0 g / L, starvation culture is performed, wherein no carbon source is added to the fermentation medium of the starvation culture, and the starvation culture time is 1-2 hours; The carbon source of the methanol fermentation culture is methanol.

Images