Diabetic nephropathy marker PARP1, primer combination and application

Abstract

The invention discloses a diabetic nephropathy marker PARP1, a primer combination and application, and relates to the technical field of biology. The sequence of the primer combination is PARP1-F, and is as shown in SEQ ID NO. 1; 1, PARP1-R as shown in SEQ ID NO. 2; an internal reference primer beta-actin-F, which is as shown in SEQ ID NO. 17; an internal reference primer beta-actin-R is as shown in SEQ ID NO. 18. The invention finds that the expression of PARP1 in the kidney tissue of a patient with diabetic nephropathy is increased and is positively correlated with ACR (Activated Receptor). The invention also finds that PARP1 is related to podocyte damage, and knocking down PARP1 can relieve podocyte endoplasmic reticulum stress and apoptosis, and can reflect the progress of DKD to a certain extent.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more particularly to a diabetic nephropathy marker PARP1, a primer combination and an application thereof. Background Art

[0002] Diabetic kidney disease (DKD) is a common microvascular complication of diabetes and a major contributor to chronic kidney disease (CKD). Clinically, DKD often presents as progressive renal damage, characterized by increased albuminuria, decreased glomerular filtration rate, and elevated blood pressure. Early clinical manifestations of DKD are atypical, and definitive diagnosis relies on renal biopsy. Therefore, a noninvasive method to accurately diagnose DKD is urgently needed. Identifying new diagnostic targets for DKD and developing effective treatments are crucial.

[0003] Podocytes are highly differentiated glomerular epithelial cells that, along with glomerular endothelial cells and the glomerular basement membrane, form the glomerular filtration barrier. The high-glucose environment caused by DKD can lead to foot process fusion and podocyte shedding, thereby impairing their ability to maintain the integrity of the glomerular filtration barrier, ultimately causing proteinuria and exacerbating DKD progression. Identifying differentially expressed genes and proteins in DKD and exploring their mechanisms of regulating podocyte injury can provide targets and strategies for DKD treatment and are key research areas in this field. Summary of the Invention

[0004] In view of this, the present invention provides a primer combination for detecting diabetic nephropathy using PARP1 as a marker, and the use of primers for knocking down PARP1 expression in the preparation of drugs for treating diabetic nephropathy.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] A primer combination for detecting PARP1, a diabetic nephropathy marker, wherein the primer combination sequence is:

[0007] PARP1-F: 5′-GAATGCCAGCGTTACAAGCC-3′, as shown in SEQ ID NO. 1;

[0008] PARP1-R: 5′-TCTCCCTGAGACGTATGGCA-3′, as shown in SEQ ID NO. 2;

[0009] Internal reference primer β-actin-F: 5′-GAAGACTACGAGCTGCCTGA-3′, as shown in SEQ ID NO. 17;

[0010] Internal reference primer β-actin-R: 5'-CAGACAGCACTGTGTTGGCG-3', as shown in SEQ ID NO.18.

[0011] A primer combination for detecting the diabetic nephropathy marker PARP1 is used in the preparation of a diabetic nephropathy diagnostic kit.

[0012] A primer for knocking down the expression of PARP1, a diabetic nephropathy marker, in the preparation of a drug for treating diabetic nephropathy, wherein the primer is an interfering RNA with the sequence: 5'-GCAGCUUCAUAACCGAAGAUU-3', as shown in SEQ ID NO. 19.

[0013] It can be seen from the above technical solution that compared with the prior art, the beneficial effects of the present invention are:

[0014] The present invention discloses the role of PARP1 in the diagnosis and targeted drug treatment of DKD. The present invention found that PARP1 expression is elevated in the renal tissue of patients with diabetic nephropathy and is positively correlated with the urine albumin-to-creatinine ratio (ACR). The present invention also found that PARP1 is associated with podocyte damage, and knocking down PARP1 reduces podocyte endoplasmic reticulum stress and apoptosis, which can reflect the progression of DKD to a certain extent. Therefore, PARP1 can be used as an auxiliary diagnostic marker for diabetic nephropathy. Further in vivo and in vitro experiments will be conducted to verify the specific mechanism of PARP1's involvement in podocyte damage in diabetic nephropathy, laying a theoretical foundation for the treatment of diabetic nephropathy and the development of targeted drugs.

[0015] Compared with the healthy control group, PARP1 expression in the renal tissue of DKD patients was increased, and the number of WT-1 positive cells was decreased, and the two were negatively correlated. PARP1 was positively correlated with ACR.

[0016] Compared with the control group, PARP1 expression was elevated in podocytes stimulated by high glucose. High glucose stimulation upregulated the endoplasmic reticulum stress-related genes IRE1, GRP78, and CHOP, upregulated the apoptosis-related gene BAX, downregulated BCL2, increased the expression of the podocyte injury-related molecule Desmin, and decreased the expression of ZO-1. Knockdown of the PARP1 gene reversed these abnormal expressions. Overexpression of PARP1 reversed these findings, promoting the abnormal expression of genes associated with endoplasmic reticulum stress, apoptosis, and damage in podocytes.

[0017] PARP1 expression is elevated in STZ-induced DKD mice. Podocyte-specific knockout of PARP1 alleviates STZ-induced podocyte and glomerular damage in DKD mice. Compared with wild-type WT mice, STZ-treated mice showed increased UACR, increased mesangial matrix, thickened basement membrane, widened podocyte footpads, and decreased WT-1-positive cells. Endoplasmic reticulum stress and apoptosis were also increased, with elevated expression of related proteins IRE1, GRP78, CHOP, and BAX, and decreased expression of BCL2. Knockdown of the PARP1 gene ameliorated these podocyte and glomerular damage. These changes were significantly alleviated, suggesting that podocyte-specific knockdown of PARP1 alleviates STZ-induced podocyte and glomerular damage in DKD mice by reducing endoplasmic reticulum stress and apoptosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the figures required for use in the embodiments or the description of the prior art. Obviously, the figures described below are merely embodiments of the present invention. For ordinary technicians in this field, other figures can be obtained based on the provided figures without paying any creative work.

[0019] Figure 1 Immunohistochemical staining and quantification of PARP1 and WT-1 expression in kidney tissues of healthy controls and DKD patients, n = 20 in the control group, n = 18 in the DKD group, *P < 0.05, **P < 0.01;

[0020] Figure 2 The correlation analysis between glomerular PARP1 expression and WT-1 and ACR in DKD patients was performed;

[0021] Figure 3 This is the detection of PARP1 knockdown efficiency after transfection of human podocytes with PARP1 small interfering agent, *P<0.05, **P<0.01;

[0022] Figure 4 [P > 0.05] are the mRNA expression levels of endoplasmic reticulum stress-related molecules IRE1, GRP78, and CHOP, apoptosis-related molecules BCL2 and BAX, and podocyte injury-related molecules ZO-1 and Desmin in human podocytes after corresponding stimulation, *P < 0.05, **P < 0.01;

[0023] Figure 5 Protein expression and quantitative analysis of IRE1, GRP78, CHOP, BCL2, BAX, ZO-1, and Desmin in human podocytes after corresponding stimulation, *P<0.05, **P<0.01;

[0024] Figure 6Immunofluorescence was used to detect the protein expression levels of ZO-1 and Desmin, *P<0.05, **P<0.01;

[0025] Figure 7 To detect the efficiency of PARP1 overexpression after transfection of human podocytes with PARP1 overexpression plasmid;

[0026] Figure 8 are the mRNA expression levels of ZO-1, Desmin, BCL2, BAX, IRE1, GRP78, and CHOP in human podocytes after corresponding stimulation;

[0027] Figure 9 Protein expression and quantitative analysis of ZO-1, Desmin, BCL2, BAX, IRE1, GRP78, and CHOP in human podocytes after corresponding stimulation, *P<0.05, **P<0.01;

[0028] Figure 10 Immunofluorescence was used to detect the protein expression levels of ZO-1 and Desmin. *P<0.05, **P<0.01;

[0029] Figure 11 construct protocols for animal models;

[0030] Figure 12 Verification of the efficiency of mouse podocyte-specific PARP1 knockout, *P<0.05, **P<0.01;

[0031] Figure 13 Analysis of urine albumin-creatinine ratio, kidney weight / body weight, and blood glucose in mice, n = 6, *P < 0.05, **P < 0.01;

[0032] Figure 14 PAS staining, WT-1 staining and electron microscopy images of kidney, scale bar = 50 μm

[0033] Figure 15 Quantitative analysis of the percentage of mesangial matrix area in mouse kidneys and quantification of WT-1-positive cells in each glomerular cross-section, *P < 0.05, **P < 0.01;

[0034] Figure 16 Quantitative analysis of GBM thickness and foot process width in transmission electron microscopy images of mouse kidneys, scale bar = 1 μm, *P < 0.05, **P < 0.01;

[0035] Figure 17 The protein and mRNA expression levels of IRE1, GRP78, CHOP, BCL2, BAX, ZO-1, and Desmin were shown in Table 1. *P < 0.05, **P < 0.01. DETAILED DESCRIPTION

[0036] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the figures in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0037] Example 1: Determination of PARP1 expression in kidney tissue of DKD patients

[0038] Collecting kidney tissue samples

[0039] From November 2020 to May 2024, a total of 38 renal tissue samples were collected. Twenty samples in the control group consisted of normal adjacent renal tissue from patients with renal tumors undergoing surgical resection, excluding those with diabetes or other renal diseases. The diabetic nephropathy group consisted of 18 samples from patients with diabetic nephropathy undergoing puncture biopsy at the Department of Nephrology, Provincial Hospital Affiliated to Shandong First Medical University. Before all samples were collected, the patients or their guardians were informed of the purpose of the sample collection, and their consent was obtained through signed informed consent forms. All human specimen collection and research were approved by the Ethics Committee of the Provincial Hospital Affiliated to Shandong First Medical University.

[0040] Immunohistochemical staining was used to detect the expression levels of PARP1 and WT-I in the renal tissues of DKD patients, and their correlation with ACR was further analyzed.

[0041] The specific steps are as follows:

[0042] Immunohistochemical staining:

[0043] (1) Bake at 65℃ for 60-90min.

[0044] (2) Dewaxing and hydration: xylene I for 15 min, xylene II for 15 min, xylene III for 15 min, anhydrous ethanol I for 8 min, anhydrous ethanol II for 8 min, 95% ethanol for 5 min, 85% ethanol for 5 min, and 75% ethanol for 5 min.

[0045] (3) Soak in distilled water three times, 5 minutes each time; soak in PBS once, 5 minutes each time.

[0046] (4) Antigen repair: Prepare antigen repair solution, perform high pressure heat repair for 3-5 minutes, and then cool naturally to room temperature.

[0047] (5) Rinse with PBS solution for 5 min × 3 times;

[0048] (6) Add an appropriate amount of endogenous peroxidase blocker and incubate at room temperature for 15 minutes;

[0049] (7) Wash with PBS buffer for 5 min × 3 times;

[0050] (8) Add an appropriate amount of blocking normal goat serum working solution and incubate at room temperature for 30 minutes. Pour off the serum.

[0051] (9) Add an appropriate amount of primary antibody PARP1 (Proteintech, 66520-1-Ig) according to the size of the tissue and incubate at 4°C overnight;

[0052] (10) The next day, transfer the slices to a 37°C incubator and rewarm for 30 minutes.

[0053] (11) Soak in PBS three times, 5 minutes each time.

[0054] (12) Incubation with secondary antibody: add biotinylated goat anti-mouse / rabbit IgG working solution and incubate at room temperature for 20 min.

[0055] (13) Soak in PBS three times, 5 minutes each time.

[0056] (14) Prepare DAB reaction solution and add it dropwise to the tissue sections for reaction. Rinse with running water for 10 minutes to terminate the color development reaction.

[0057] (15) Add hematoxylin solution and incubate for 3-5 minutes.

[0058] (16) Add hydrochloric acid alcohol differentiation solution, differentiate for a few seconds, and then rinse with running water to turn blue.

[0059] (17) Dehydrate with gradient alcohol, make the slides transparent with xylene, and seal them with neutral gum before observing them under a microscope.

[0060] The results showed that compared with the healthy control group, the expression of PARP1 in the kidney tissue of DKD patients was increased, and the number of WT-1 positive cells was decreased, and the two were negatively correlated (r=-0.647, P<0.01) ( Figure 1 PARP1 was positively correlated with ACR (r=0.481,P<0.01) ( Figure 2 ).

[0061] Example 2: PARP1 is involved in podocyte endoplasmic reticulum stress and apoptosis

[0062] Target gene and internal reference gene primer sequences:

[0063] PARP1

[0064] PARP1-F: 5'-GAATGCCAGCGTTACAAGCC-3', SEQ ID NO.1;

[0065] PARP1-R:5'-TCTCCCTGAGACGTATGGCA-3',SEQ ID NO.2;

[0066] IRE1

[0067] IRE1-F:5'-GGACAGTGAATCTGGGGACG-3',SEQ ID NO.3;

[0068] IRE1-R:5'-GGTCTCCACAGCGACATTGA-3',SEQ ID NO.4;

[0069] GRP78

[0070] GRP78-F:5'-GACGGGCAAAGATGTCAGGA-3',SEQ ID NO.5;

[0071] GRP78-R:5'-AACACTTTCTGGACGGGCTT-3',SEQ ID NO.6;

[0072] CHOP

[0073] CHOP-F:5'-CTTGTTCCAGCCACTCCCCAT-3',SEQ ID NO.7;

[0074] CHOP-R:5'-TCTGAAGACAGGACCTCTTG-3',SEQ ID NO.8;

[0075] BCL2

[0076] BCL2-F:5'-GTGAACTGGGGGAGGATTGT-3',SEQ ID NO.9;

[0077] BCL2-R:5'-GCCCAGACTCACATCACCAAG-3',SEQ ID NO.10;

[0078] BAX

[0079] BAX-F:5'-GAGGTCTTTTTCCCGAGTGGCA-3',SEQ ID NO.11;

[0080] BAX-R:5'-GGCAAAGTAGAAAAGGGCGAC-3',SEQ ID NO.12;

[0081] ZO-1

[0082] ZO-1-F: 5'-CCCCAACTCAAACCGAAGA-3', SEQ ID NO.13;

[0083] ZO-1-R: 5'-AGATGCTACTTCTGGAGGCTTA-3', SEQ ID NO.14;

[0084] Desmin

[0085] Desmin-F: 5'-AGGACCGATTTGCCAGTGAG-3', SEQ ID NO.15;

[0086] Desmin-R: 5'-CTTGAGGTGCCGGATTTCCT-3', SEQ ID NO.16;

[0087] β-actin

[0088] β-actin-F: 5'-GAAGACTACGAGCTGCCTGA-3', SEQ ID NO.17;

[0089] β-actin-R: 5'-CAGACAGCACTGTGTTGGCG-3', SEQ ID NO.18;

[0090] Primary antibodies used in Western blot and their product numbers:

[0091] PARP1 (66520-1-Ig, Proteintech); IRE1 (27528-1-AP, Proteintech); GRP78 (11587-1-AP, Proteintech); CHOP (15204-1-AP, Proteintech); BCL2 (ab1828 58, Abcam); BAX (50599-2-Ig, Proteintech); ZO-1 (21773-1-AP, Proteintech); Desmin (16520-1-AP, Proteintech); β-actin (66009-1-Ig, Proteintech).

[0092] To clarify the role of PARP1 in podocyte endoplasmic reticulum stress and apoptosis, the present invention first stimulated podocytes with high-glucose culture medium to simulate the in vitro diabetic nephropathy environment. Simultaneously, the present invention constructed PARP1 small interfering and overexpressing plasmids and transfected them into podocytes.

[0093] According to the experimental purpose, podocytes were divided into two groups: low sugar group, high sugar group, high sugar + si-NC group, high sugar + si-PARP1 group; low sugar group, high sugar group, low sugar + OE-NC group, low sugar + OE-PARP1 group.

[0094] Real-time PCR and Western blot were used to detect the mRNA expression levels of endoplasmic reticulum stress-related molecules IRE1, GRP78, and CHOP, apoptosis-related molecules BCL2 and BAX, and podocyte injury-related molecules ZO-1 and Desmin; immunofluorescence staining was used to detect the expression of ZO-1 and Desmin.

[0095] PARP1 small interfering sequence:

[0096] PARP1-siRNA: 5'-GCAGCUUCAUAACCGAAGAUU-3', SEQ ID NO.19;

[0097] NC-siRNA: 5'-UUCUCCGAACGUGUCACGU-3', SEQ ID NO. 20.

[0098] The specific steps are as follows:

[0099] Western blot

[0100] 1. Protein extraction

[0101] (1) Remove the culture medium from the cells in good growth condition in the 6-well plate, rinse twice with PBS buffer, and discard the PBS.

[0102] (2) Preparation of lysis buffer: RIPA lysis buffer: protease inhibitor: protein phosphatase inhibitor = 100:1:1

[0103] (3) Add 150 μL of lysis buffer to each well and lyse on ice for 30 min.

[0104] (4) Transfer the cell lysate into a 1.5 mL EP tube and vortex 2-3 times for 2 minutes each time.

[0105] (5) Centrifuge at 12000 rpm at 4°C for 30 min.

[0106] (6) Take the supernatant and add 5× loading buffer at a ratio of supernatant to 5× loading buffer = 4:1. Vortex mix thoroughly and place in a 100°C metal bath for 10 min. Store at -20°C until use.

[0107] 2. Electrophoresis and electrotransfer

[0108] (1) Prepare 1× electrophoresis buffer: dissolve 1 pack of SDS-PAGE Running Buffer Powder in 1 L of distilled water.

[0109] (2) Sample loading: Sample loading is based on grouping and protein concentration.

[0110] (3) Maintain a constant voltage of 80 V for 20-30 min until bromophenol blue reaches the boundary between the stacking gel and the separation gel, then adjust the voltage to 120 V for 1 h.

[0111] (4) Prepare 1× electro-transfer buffer: dissolve 1 pack of SDS-PAGE Transfer Buffer Powder in 800 mL of distilled water, then add 200 mL of methanol solution.

[0112] (5) Cut the gel at an appropriate location according to the molecular weight of the protein and cover it with a methanol-activated PVDF membrane.

[0113] (6) Transfer the membrane under 220mA constant current conditions. The transfer time depends on the molecular weight.

[0114] 3. Blocking and Antibody Incubation

[0115] (1) Place the strips in 5% skim milk (prepared in TBST) and block at room temperature for 1-2 hours.

[0116] (2) Aspirate the blocking solution and wash the membrane three times with TBST, each time for 5 minutes.

[0117] (3) Place the membrane in the diluted primary antibody and incubate with slow shaking at 4°C overnight.

[0118] (4) Remove the membrane and wash it with TBST three times, 5 min each time.

[0119] (5) Dilute the corresponding secondary antibody with TBST solution containing 5% skim milk and incubate at room temperature for 1 h.

[0120] (6) Aspirate the secondary antibody and wash the membrane three times with TBST, each time for 5 minutes.

[0121] (7) Chemiluminescence imaging was performed using AI680 images and quantification was performed using Image J.

[0122] Real-time PCR

[0123] 1. RNA Extraction

[0124] (1) Aspirate the culture medium from the 6-well plate and wash twice with PBS.

[0125] (2) Add 1 mL of Trizol and lyse on ice for 15 min. Mix thoroughly by pipetting and transfer to a 1.5 mL EP tube.

[0126] (3) Add 200 μL of chloroform, invert the tube 30 times, and let it stand for 5-7 minutes to separate the layers.

[0127] (4) Centrifuge at 12000 rpm at 4°C for 15 min, take 300 μL of the supernatant, add an equal volume of isopropanol, vortex and let stand for 5 min.

[0128] (5) Centrifuge at 12000 rpm for 10 min at 4°C, discard the supernatant, add 1 mL of 75% ethanol, and vortex.

[0129] (6) Centrifuge at 7500 rpm at 4°C for 5 min, discard the supernatant, add 1 mL of anhydrous ethanol, and vortex.

[0130] (7) Centrifuge at 7500 rpm at 4°C for 5 min, discard the supernatant and remove the residual liquid with a pipette. After the EP tube is completely dry, add an appropriate amount of DEPC water to fully dissolve it.

[0131] 2. Reverse transcription

[0132] RNA concentration and purity were measured using a NanoDrop 2000 spectrophotometer. Reverse transcription into cDNA was performed according to the Evo M-MLV RT Mix Kit with gDNA Clean for qPCR kit instructions. Samples can be temporarily stored at -20°C or long-term storage at -80°C.

[0133] (1) Genomic DNA removal: Operate on ice. Prepare the following reaction system according to Table 1 in a sterile, enzyme-free EP tube. Mix thoroughly by gently pipetting. Centrifuge briefly and incubate in a gene amplifier at 42°C for 2 min.

[0134] Table 1 Reaction system for removing genomic DNA

[0135] Component Name Volume Added RNase free water To 10 μL gDNA Clean Reaction Mix Ver. 2 2 μL Total RNA 1 μg

[0136] (2) Prepare the reverse transcription reaction system: Operate on ice and add 5×Evo M-MLV RT Reaction Mix Ver.2 to the reaction tube in step 1. Mix by gently pipetting.

[0137] Table 2 Reverse transcription reaction system

[0138] Component Name Volume Added 5X EvoM-MLV RT Reaction Mix Ver. 2 4 μL RNase free water 6 μL Mix from Step 1 10 μL

[0139] (3) Perform reverse transcription reaction: Place the above reaction system in a gene amplification instrument, react at 37°C for 15 minutes, react at 85°C for 5 seconds, and store at 4°C.

[0140] 3. Fluorescence quantitative PCR

[0141] The SYBR Green Pro Taq HS premixed qPCR kit (Acori Biotech, China) was used to prepare the PCR reaction system on ice according to the manufacturer's instructions. The reaction system was added to a 96-well plate and sealed according to the experimental design. The plate was centrifuged at 3000 rpm for 3 minutes at room temperature. The quantitative expression level of the target gene was detected by qPCR using the Thermo QuantStudio1 real-time fluorescence quantitative PCR platform. The gene expression level was normalized to β-actin and 2 -ΔΔCt Method for analysis.

[0142] Table 3 qPCR reaction system

[0143] Component Name Volume Added 2X SYBR Green Pro Taq HS Premix 10 μL cDNA 2 μL Primer F (10 μM) 0.4 μL Primer R (10 μM) 0.4 μL RNase free water 7.2 μL Total 20 μL

[0144] Immunofluorescence staining

[0145] (1) Seed cells in a 6-well plate, add cell suspension and corresponding stimulation, and start staining when the cells grow to 50%-70%.

[0146] (2) Aspirate the culture medium in the well plate and wash with PBS three times, 5 minutes each time.

[0147] (3) Fix the cells with 4% paraformaldehyde for 15 min and wash with PBS three times, each time for 5 min.

[0148] (4) Permeabilize with 0.1% Triton for 10 min and wash with PBS three times, 5 min each time.

[0149] (5) Block with 5% BSA at room temperature for 30 minutes.

[0150] (6) Primary antibody incubation, overnight at 4°C: ZO-1 (Proteintech, 21773-1-AP), Desmin (Proteintech, 16520-1-AP).

[0151] (7) Rewarm at 37°C for 30 min and wash with PBS three times, 5 min each time.

[0152] (8) Add fluorescent secondary antibody Alexa 594-conjugated donkey anti-rabbit IgG (ab150076, abcam) and Alexa 488-conjugated goat anti-mouse IgG (ab150113, abcam), incubate at 37°C for 1-1.5 h, and wash three times with PBS, each time for 5 min.

[0153] (9) DAPI was used to stain the cell nuclei for 8 min, and the cells were washed with PBS 5 times, each time for 5 min.

[0154] (10) Seal the slides with anti-fluorescence quencher and observe under a fluorescence microscope.

[0155] The results showed that: Western Blot and Real-time PCR results showed that transfection of PARP1 small interfering RNA could significantly inhibit the expression of PARP1 ( Figure 3 ), transfection of overexpression plasmid can significantly increase its expression ( Figure 7 ).

[0156] Compared with the low glucose group, high glucose stimulation increased the mRNA and protein expression levels of IRE1, GRP78, CHOP, BAX, and Desmin, and decreased the expression of BCL2 and ZO-1; knockdown of the PARP1 gene reversed the above abnormal expression ( Figure 4-5 At the same time, immunofluorescence results showed that compared with the high glucose group, the foot damage in the high glucose + si-PARP1 group was alleviated, as shown by increased expression of ZO-1 protein and decreased expression of Desmin protein ( Figure 6 ).

[0157] Western Blot and Real-time PCR results showed that compared with the low glucose group, overexpression of PARP1 increased the mRNA and protein expression levels of IRE1, GRP78, CHOP, BAX, and Desmin, and decreased the expression of BCL2 and ZO-1 ( Figure 8-9 The immunofluorescence results were consistent with those of Western blot ( Figure 10 ).

[0158] Example 3: Role of PARP1 in podocyte injury in STZ-induced diabetic nephropathy mice. Vector used: AAV-nphs1-GFR-miR30-shRNA

[0159] PARP1 shRNA sequence:

[0160] AAGGGACGAACTCCTATTACATAGTGAAGCCACAGATGTATGTAA TAGGAGTTCGTCCTTT, SEQ ID NO.21;

[0161] Mouse primer sequences

[0162] PARP1

[0163] PARP1-F1: 5'-GCGGAGAAGACATTGGGTGA-3', SEQ ID NO. 22;

[0164] PARP1-R1: 5'-ACCATCTTCTTGGACAGGCG-3', SEQ ID NO. 23;

[0165] IRE1

[0166] IRE1-F1: 5'-AGGTTCCGCTCATACAAAGGG-3', SEQ ID NO. 24;

[0167] IRE1-R1: 5'-TGTAGTGGTGCTTCTTGTTCCTC-3', SEQ ID NO. 25;

[0168] GRP78

[0169] GRP78-F1: 5'-GTGAACTGGGGGAGGATTGT-3', SEQ ID NO. 26;

[0170] GRP78-R1: 5'-GCCCAGACTCACATCACCAAG-3', SEQ ID NO. 27;

[0171] CHOP

[0172] CHOP-F1: 5'-AACAGAGGTCACACGCACAT-3', SEQ ID NO. 28;

[0173] CHOP-R1: 5'-ACTTTCCGCTCGTTCTCCTG-3', SEQ ID NO. 29;

[0174] BCL2

[0175] BCL2-F1: 5'-CCAGCTAATGAAAGGGGAACC-3', SEQ ID NO. 30;

[0176] BCL2-R1: 5'-CAGGGTGTGATAATGCCCCAA-3', SEQ ID NO. 31;

[0177] BAX

[0178] BAX-F1: 5'-ACCAGGGTGGCTGGGAAG-3', SEQ ID NO. 32;

[0179] BAX-R1: 5'-CCTTTCCCCTTCCCCCATTC-3', SEQ ID NO. 33;

[0180] ZO-1

[0181] ZO-1-F1: 5'-GATTTACCCGTCAGAAATTCT-3', SEQ ID NO.34;

[0182] ZO-1-R1: 5'-TGGGCCTAAGTATCCCGTCT-3', SEQ ID NO.35;

[0183] Desmin

[0184] Desmin-F1: 5'-GTGCATGAAGAGGAGATCCGT-3', SEQ ID NO.36;

[0185] Desmin-R1: 5'-ATGTTCTTAGCCGCGATGGT-3', SEQ ID NO.37;

[0186] β-actin

[0187] β-actin-F1: 5'-CATGTACGTTGCTATCCAGGC-3', SEQ ID NO.38;

[0188] β-actin-R1: 5'-CTCCTTAATGTCACGCACGAT-3', SEQ ID NO.39;

[0189] C57BL / 6 mice were provided by the Experimental Animal Center of Shandong First Medical University. All animal studies were reviewed and approved by the Experimental Animal Ethics Committee of Shandong Provincial Hospital Affiliated to Shandong First Medical University.

[0190] According to the experimental purpose, mice were randomly divided into 4 groups: WT group, STZ group, STZ-shNC group, and STZ-shPARP1 group. After one week of adaptive feeding, mice in the STZ-shNC group and STZ-shPARP1 group were injected with AAV9-NC and AAV9-nphs1-shPARP1 via tail vein, respectively; the other two groups were injected with the same dose of normal saline. Two weeks later, the STZ group, STZ-shNC group, and STZ-shPARP1 group were injected with streptozotocin (STZ, 50 mg / kg) intraperitoneally for five consecutive days, and the WT group was injected with an equal amount of citric acid buffer ( Figure 11 ).

[0191] After 16 weeks, mice were sacrificed and urine and kidney tissue were collected: ① Primary podocytes were isolated and cultured, and PARP1 expression was analyzed by Western blot to verify knockdown efficiency; ② Urine was collected and the urine albumin-to-creatinine ratio was measured; ③ Kidney tissue was collected to assess glomerular pathological damage; renal cortical protein and RNA were extracted and the expression levels of related molecules were measured.

[0192] The specific steps are as follows:

[0193] Isolation and culture of primary podocytes

[0194] Glomeruli were isolated using a mesh sieve method. The mouse kidneys were stripped of their capsules and cut into small pieces. The pieces were placed in a digestion solution containing collagenase and pronase E and digested at 37°C for 15 minutes. Complete culture medium was added to terminate the digestion. The digested tissue was sequentially passed through a 50-mesh sieve, a 100μm sieve, and a 400-mesh sieve to collect the glomeruli. The collected glomeruli were cultured in an incubator for 5 days, and then the podocytes that crawled out were digested and passaged. After trypsin digestion, the completely digested cells were passed through a 40μm sieve to remove the glomerular core and seeded into 6-well plates. After maturation, podocytes were identified using the podocyte-specific marker molecule WT-1.

[0195] PAS staining

[0196] (1) Bake the slices at 65°C for 1-2 hours.

[0197] (2) The dewaxing and hydration process is the same as above.

[0198] (3) Wash with distilled water three times, 5 minutes each time.

[0199] (4) Add oxidant dropwise and incubate at room temperature for 8 minutes.

[0200] (5) Rinse with tap water for 5 minutes and then with distilled water twice, each time for 5 minutes.

[0201] (6) Add Schiff reagent dropwise and stain at room temperature in the dark for 20-30 minutes.

[0202] (7) Rinse with tap water for 10-15 minutes.

[0203] (8) Add hematoxylin solution and stain the nucleus for 1-2 minutes.

[0204] (9) Rinse with distilled water 2-3 times until the floating color is washed away.

[0205] (10) Differentiate in acidic differentiation medium for 2-5 seconds.

[0206] (11) Rinse with tap water for 10-15 minutes until the blue color returns.

[0207] (12) Dehydrate with ethanol step by step, make transparent with xylene, and seal with neutral gum.

[0208] (13) After drying, observe under a microscope and take photos.

[0209] Immunohistochemical staining

[0210] Same as Example 1

[0211] Transmission electron microscopy

[0212] (1) Cut the kidney tissue into 1mm pieces 3 Place the tissue blocks of about 100 μg / cm2 in pre-cooled glutaraldehyde solution and place them in a 4°C refrigerator for fixation for 2-4 hours.

[0213] (2) The tissue was thoroughly washed with PBS buffer and fixed in 1% osmium hydroxide for 1-2 h.

[0214] (3) After the tissue was thoroughly washed with PBS buffer, it was immersed in 30%, 50%, 70%, 90% and 100% acetone in sequence for gradient dehydration.

[0215] (4) After embedding and polymerization, the tissue blocks were cut into 50 nm thick slices using an ultrathin microtome.

[0216] (5) Tissue sections were stained with uranyl acetate and lead citrate, observed under a transmission electron microscope, and photographed.

[0217] Western blot

[0218] Same as Example 2

[0219] Real-time PCR

[0220] Same as Example 2

[0221] The results showed that compared with the WT group, the urine albumin-creatinine ratio (ACR) level and kidney weight / body weight of the STZ group mice were significantly increased, while those of the STZ group mice were significantly decreased after knockdown of PARP1 ( Figure 12 There was no significant difference in blood glucose levels between STZ-shPARP1 mice and STZ mice ( Figure 13 Subsequently, PAS and IHC staining revealed a significant increase in mesangial matrix and a decrease in WT-1 positive cells in STZ-induced mice; transmission electron microscopy revealed thickening of the glomerular basement membrane and widening of the podocyte footpads in STZ-treated mice ( Figure 14-16 Western blot and real-time PCR results showed that compared with the WT group, the protein and mRNA expression levels of IRE1, GRP78, CHOP, BAX, and Desmin in the kidney tissue of STZ mice were increased, and the expression of BCL2 and ZO-1 was decreased. After knocking down the PARP1 gene, the above-mentioned podocyte and glomerular damage were improved and these changes were significantly alleviated ( Figure 17 ), suggesting that podocyte-specific knockdown of PARP1 alleviates STZ-induced podocyte and glomerular injury in DKD mice by alleviating ER stress and apoptosis.

[0222] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A primer combination for detecting PARP1, a diabetic nephropathy marker, characterized in that: The primer combination sequence is: PARP1-F: 5′-GAATGCCAGCGTTACAAGCC-3′, as shown in SEQ ID NO. 1; PARP1-R: 5′-TCTCCCTGAGACGTATGGCA-3′, as shown in SEQ ID NO. 2; Internal reference primer β-actin-F: 5′-GAAGACTACGAGCTGCCTGA-3′, as shown in SEQ ID NO. 17; Internal reference primer β-actin-R: 5'-CAGACAGCACTGTGTTGGCG-3', as shown in SEQ ID NO.

18.

2. Use of the primer combination according to claim 1 in preparing a diagnostic kit for diabetic nephropathy.

3. Use of a primer for knocking down the expression of PARP1, a marker of diabetic nephropathy, in the preparation of a drug for treating diabetic nephropathy, characterized in that: The primer is an interfering RNA, and the sequence is: 5'-GCAGCUUCAUAACCGAAGAUU-3', as shown in SEQ ID NO.19.

Images