Fowl adenovirus I group 4 type, 8a type and 8b type trivalent subunit vaccine as well as preparation method and application of fowl adenovirus I group 4 type, 8a type and 8b type trivalent subunit vaccine

Abstract

The invention belongs to the technical field of biological medicines, discloses a fowl adenovirus I group 4 type, 8a type and 8b type trivalent subunit vaccine as well as a preparation method and application thereof, and provides an antigen composition prepared from a Fiber2 protein of FAdV-4, a Hexon protein of FAdV-8a and a Hexon protein of FAdV-8b in combination with a molecular adjuvant (such as Ch-IFN-gamma). The antigen composition is combined with an adjuvant to prepare the trivalent subunit vaccine. The vaccine has the advantages of high safety, comprehensive immune protection, easiness in large-scale production and the like, breaks through the technical bottleneck of the traditional inactivated vaccine, and provides a new tool for prevention and control of the fowl adenovirus disease.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a trivalent subunit vaccine of avian adenovirus group I types 4, 8a and 8b, and a preparation method and application thereof. Background Art

[0002] Group I avian adenoviruses (FAdVs) are among the major diseases impacting the healthy development of the poultry industry. Detection rates of FAdV-4 and FAdV-8a / 8b have recently increased significantly, and cases of mixed infections are also on the rise. Currently, the primary method of preventing and controlling Group I avian adenoviruses is through vaccination of poultry. However, commercially available vaccines in my country (Table 1) are primarily multivalent inactivated vaccines or monovalent inactivated vaccines. Subunit vaccines targeting multiple serotypes of avian adenovirus are lacking. Currently, few subunit vaccines are commercially available on the market.

[0003] Table 1 Commercialized avian adenovirus vaccines in my country

[0004] Summary of the Invention

[0005] The purpose of the first aspect of the present invention is to provide an antigen composition.

[0006] The purpose of the second aspect of the present invention is to provide the use of the antigen composition of the first aspect of the present invention in preparing a product.

[0007] The third aspect of the present invention aims to provide a trivalent subunit vaccine.

[0008] In order to achieve the above object, the technical solution adopted by the present invention is:

[0009] The first aspect of the present invention provides an antigen composition comprising Fiber2 protein of FAdV-4, Hexon protein of FAdV-8a / 8b and a molecular adjuvant, wherein the molecular adjuvant is interferon.

[0010] In some embodiments of the present invention, the interferon comprises chicken gamma-interferon.

[0011] In some embodiments of the present invention, the nucleotide sequence of the chicken interferon-γ is shown in SEQ ID NO: 1.

[0012] In some embodiments of the present invention, the nucleotide sequence of the Fiber2 protein of the FAdV-4 is shown as SEQ ID NO:8, and the nucleotide sequence of the Hexon protein of the FAdV-8a / 8b is shown as SEQ ID NO:9.

[0013] The hexon protein, a face of the icosahedral capsid of avian adenovirus, is a crucial capsid protein, contributing to its structural stability. It is the most abundant protein compared to other capsid proteins and has the largest molecular weight. The hexon protein is composed of three homologous polypeptides, which can be divided into conserved regions (P1 and P2) and hypervariable regions (Loop 1–Loop 4). The hexon protein has a "tower-like" structure, with P1 and P2 located at the base of the tower, Loops 1, 2, and 4 forming the outer structure, and Loop 3 connecting the two regions within the tower. The hexon protein contains specific antigenic determinants and is also the primary neutralizing antibody epitope, which plays a decisive role in determining the type of antibody produced. Research has shown that the hexon protein is the primary antigenic region that elicits immune responses. Because it carries the primary antigenic determinants and contains type- and group-specific epitopes, it is a prime candidate for protein expression studies. The fiber protein is a homotrimeric structure consisting of a tail, shaft, and head region. The fiber protein is anchored to the viral capsid via the penton protein, which helps maintain the stability of the viral structure. The fiber protein extends outward in a filamentous structure, consisting of the shaft and head regions. The shaft region is composed of repeating β-helices, and the length of the fiber protein varies depending on the group I avian adenovirus serotype. The head region, at the end of the fiber protein, specifically binds to viral receptors on the host cell surface, accelerating viral entry. The fiber protein influences the infection and pathogenesis of avian adenoviruses. The fiber2 and hexon proteins are closely associated with the pathogenicity of FAdV-4.

[0014] In some embodiments of the present invention, the Fiber2 protein of FAdV-4 and the Hexon protein of FAdV-8a / 8b are expressed using an insect baculovirus expression system.

[0015] The insect baculovirus expression system offers advantages such as high safety, high yield, protein modification capabilities, and advantages in complex protein assembly. However, this expression system has high technical requirements for operators and high environmental requirements, so the cost of large-scale production still needs to be further evaluated and optimized. The present invention analyzes the gene sequences of the major capsid proteins of FAdV-4 and FAdV-8a / 8b, screening for regions that are both conserved and rich in antigenic epitopes. Based on the insect baculovirus expression system, the recombinant proteins FAdV-4-Fiber2 and FAdV-8a / 8b-Hexon were successfully expressed and purified.

[0016] In some embodiments of the present invention, the insect baculovirus expression system includes the following steps: constructing a recombinant shuttle plasmid Bacmid containing a DNA fragment of the target protein (i.e., the Fiber2 gene of FAdV-4 and the Hexon gene of FAdV-8a / 8b), then mixing the recombinant shuttle plasmid Bacmid with a transfection reagent and transfecting the suspension-cultured insect cells, collecting the culture supernatant to obtain the P0 generation recombinant baculovirus; inoculating the suspension-cultured insect cells in a shake flask with the P0 generation recombinant baculovirus, culturing on a shaker, and collecting the culture supernatant to obtain the P1 generation recombinant baculovirus; repeating the above culture steps, and expanding the culture volume, collecting the cell pellet, and disrupting it to obtain the Fiber2 protein of FAdV-4 and the Hexon protein of FAdV-8a / 8b.

[0017] In some embodiments of the present invention, the interferon is expressed via an Escherichia coli expression system.

[0018] In some embodiments of the present invention, the expression in the E. coli expression system includes recombining the target gene (Ch-IFN-γ) into a vector plasmid through molecular cloning technology, transforming the recombinant plasmid into E. coli DH5α, amplifying the recombinant plasmid, screening through resistance genes, and sequencing verification to obtain E. coli DH5α (i.e., recombinant strain) in which the recombinant plasmid is successfully transformed, expanding the recombinant strain, inducing the expression of the target protein, collecting the bacteria, lysing (such as ultrasonic disruption), and purifying to obtain the target protein (interferon).

[0019] In some embodiments of the present invention, the induction comprises inducing with 0.1 mM to 1 mM IPTG at 15 to 37° C. for 8 to 14 h; and further inducing with 0.25 mM to 0.75 mM IPTG at 16 to 20° C. for 10 to 12 h.

[0020] In some embodiments of the present invention, when the E. coli expression system is used for expression, the steps include expression of inclusion bodies, denaturation and renaturation.

[0021] The second aspect of the present invention provides the use of the antigen composition of the first aspect of the present invention in preparing a product.

[0022] In some embodiments of the present invention, the product includes at least one of a drug, a reagent, and a kit.

[0023] In some embodiments of the present invention, the medicament comprises a vaccine.

[0024] In some embodiments of the present invention, the vaccine is a subunit vaccine.

[0025] In some embodiments of the present invention, the product has the function of preventing and / or treating diseases caused by avian adenovirus.

[0026] The third aspect of the present invention provides a trivalent subunit vaccine comprising the antigen composition of the first aspect of the present invention.

[0027] In some embodiments of the present invention, the mass ratio of the Fiber2 protein of FAdV-4, the Hexon protein of FAdV-8a / 8b and the molecular adjuvant is 1:(2-4):(0.05-0.1); preferably 1:2:0.08.

[0028] In some embodiments of the present invention, the trivalent subunit vaccine further comprises a pharmaceutically acceptable excipient and / or adjuvant.

[0029] In some embodiments of the present invention, the adjuvant includes at least one of white oil adjuvant, aluminum stearate, ISA763A, aluminum hydroxide, lecithin, mpltm (3-O-deacylated monophosphatidyl lipid A), IL-12, ISA51vg, ISA720vg, MF59, QS21, and AS03 adjuvant. Those skilled in the art may also select other immune adjuvants for preparing suitable vaccines according to actual use requirements.

[0030] In some embodiments of the present invention, the vaccine is administered by intramuscular injection.

[0031] When the vaccine is prepared using a "cocktail" mixing model, technical personnel in this field can promptly adjust the vaccine formula based on the results of subsequent epidemiological surveys, increasing or decreasing the number of protein types.

[0032] The present invention also provides a method for preparing the trivalent subunit vaccine, which comprises mixing the antigen composition with an adjuvant and emulsifying the mixture.

[0033] The beneficial effects of the present invention are:

[0034] The present invention provides an antigen composition made of the Fiber2 protein of FAdV-4, the Hexon protein of FAdV-8a / 8b and a molecular adjuvant (such as Ch-IFN-γ). The antigen composition is combined with the adjuvant to prepare a trivalent subunit vaccine (oil emulsion). After evaluating the immune effect of the trivalent oil emulsion subunit vaccine, it was found that after immunizing SPF chickens with the vaccine, the serum antibody level of the SPF chickens in the immunized group was significantly increased, and the survival rate of the SPF chickens in the immunized group after infection with FAdV-4, FAdV-8a or FAdV-8b was 100%, which was significantly higher than that of the negative control group. Pathological analysis confirmed that the liver tissue of the SPF chickens in the immunized group did not show typical lesions of avian adenovirus disease such as inclusion bodies or inflammatory cell infiltration, while the control group showed extensive hepatocyte necrosis and inclusion bodies.

[0035] This invention develops for the first time a trivalent subunit vaccine against FAdV-4 and FAdV-8a / 8b. This vaccine has the advantages of high safety, comprehensive immune protection, and easy large-scale production. It breaks through the technical bottleneck of traditional inactivated vaccines and provides a new tool for the prevention and control of avian adenovirus diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of the process for expressing Ch-IFN-γ molecular adjuvant using the E. coli expression system.

[0037] Figure 2 PCR verification of the bacterial solution of the recombinant plasmid (pET-28b(+)-Ch-IFN-γ) (a, in the figure, M: 5000 DNA Marker (bp); 1-7: 7 monoclonal colonies of Ch-IFN-γ) and the expression distribution of the recombinant protein his-Ch-IFN-γ (b, in the figure, M: protein Marker (10-170 kDa); 1: PET-28b(+) blank vector control group; 2: whole bacterial sample after disruption; 3: precipitate sample after disruption; 4: supernatant sample after disruption).

[0038] Figure 3 The optimization results of IPTG concentration used for the expression of recombinant protein his-Ch-IFN-γ (a, in the figure, M: protein marker (10-170kDa); 1: 0.1mM IPTG induction group; 2: 0.25mM IPTG induction group; 3: 0.5mM IPTG induction group; 4: 0.75mM IPTG induction group; 5: 1mM IPTG induction group) and expression time optimization results (b, in the figure, M: protein marker (10-170kDa); 1: 8h induction time group; 2: 10h induction time group; 3: 12h induction time group; 4: 14h induction time group).

[0039] Figure 4 This is the purification result of the recombinant protein his-Ch-IFN-γ. In the figure, M: protein marker (10-170kDa); 1: protein flow-through; 2: 20mM imidazole elution; 3: 40mM imidazole elution; 4: 80mM imidazole elution; 5: 150mM imidazole elution; 6: 300mM imidazole elution; 7: 400mM imidazole elution; 8: 500mM imidazole elution.

[0040] Figure 5 Schematic diagram of the process for expressing FAdV-4-fiber2 and FAdV-8a / 8b-hexon proteins using the insect baculovirus expression system.

[0041] Figure 6For the amplification of the target gene, in the figure, M: 5000 DNA Marker (bp); 1-3: FAdV-4-Fiber2 gene; 4-6: FAdV-8a / 8b-Hexon gene; 7-10: linearized vector.

[0042] Figure 7 This is the plasmid map of the recombinant plasmid pFastBac-EGFP-Fiber2.

[0043] Figure 8 This is the plasmid map of the recombinant plasmid pFastBac-EGFP-Hexon.

[0044] Figure 9 PCR verification of bacterial liquid; among them, a is the PCR verification result of pFastBac-EGFP-Fiber2 monoclonal colony, in the figure, M: 5000 DNA Marker (bp), 1~9: 9 pFastBac-EGFP-Fiber2 monoclonal colonies; b is the PCR verification result of pFastBac-EGFP-Hexon monoclonal colony, in the figure, M: 5000 DNA Marker (bp), 1~9: 9 pFastBac-EGFP-Hexon monoclonal colonies.

[0045] Figure 10 The construction and identification results of pFastBac1-N-EGFP-Hexon; among them, a is the identification result of the white monoclonal colony of Bacmid-EGFP-Fiber2, in the figure, M: 5000 DNA Marker (bp), 1~9: 9 white monoclonal colonies of Bacmid-EGFP-Fiber2; b is the identification result of the white monoclonal colony of Bacmid-EGFP-Hexon, in the figure, M: 5000 DNA Marker (bp), 1~9: 9 white monoclonal colonies of Bacmid-EGFP-Hexon.

[0046] Figure 11 These are the results of fluorescence microscopy observation; among them, a is the Bacmid-EGFP-Fiber2 transfection result (fluorescence); b is the Bacmid-EGFP-Fiber2 transfection result (white light); c is the Bacmid-EGFP-Hexon transfection result (fluorescence); d is the Bacmid-EGFP-Hexon transfection result (white light).

[0047] Figure 12The expression of target proteins (EGFP-Fiber2 protein and EGFP-Hexon protein) in Sf9 cells. In the figure, M: protein marker (40-100 kDa); 1: precipitate after baculovirus EGFP-Hexon insect cell disruption; 2: supernatant after baculovirus EGFP-Hexon insect cell disruption; 3: precipitate after baculovirus EGFP-Fiber2 insect cell disruption; 4: supernatant after baculovirus EGFP-Fiber2 insect cell disruption.

[0048] Figure 13 These are the purification and elution results of the recombinant proteins EGFP-Fiber2 protein (a) and EGFP-Hexon protein (b). In the figure, M: protein marker (15-170 kDa); 2: 20 mM imidazole elution; 3: 40 mM imidazole elution; 4: 80 mM imidazole elution; 5: 150 mM imidazole elution; 6: 300 mM imidazole elution; 7: 500 mM imidazole elution.

[0049] Figure 14 The results of enzyme digestion of recombinant proteins EGFP-Fiber2 protein (a) and EGFP-Hexon protein (b) are shown. In the figure, M: protein marker (15-170 kDa); 1: EGFP-Fiber2 protein or EGFP-Hexon protein stock solution; 2-4: results after enzyme digestion using TEV enzyme.

[0050] Figure 15 The results of purification of recombinant proteins EGFP-Fiber2 (a) and EGFP-Hexon (b) after TEV digestion. In the figure, M: protein marker (15-170 kDa); 1: protein stock solution after TEV digestion; 2: flow-through 1; 3: flow-through 2; 4: 500 mM imidazole eluent.

[0051] Figure 16 Western blot identification results of Fiber2 protein (a) and Hexon protein (b). In the figure, M: protein marker (40-70 kDa); 1: Fiber2 protein or Hexon protein.

[0052] Figure 17 Schematic diagram of the preparation process of oil emulsion vaccine (trivalent subunit vaccine of FAdV-4 and FAdV-8a / 8b).

[0053] Figure 18 The results of the dosage form test (a) and stability test (b) of the oil emulsion vaccine are shown.

[0054] Figure 19The sterility test results of oil-emulsion vaccine (LB agar medium (a) and XLD medium (b)).

[0055] Figure 20 The results of sterility test (anaerobic broth culture medium) (a) and mycoplasma test (b) of oil emulsion vaccine.

[0056] Figure 21 Survival curves of SPF chickens in different treatment groups.

[0057] Figure 22 Statistical results of changes in serum antibody levels in SPF chickens in different treatment groups.

[0058] Figure 23 The visual observation of liver tissues of SPF chickens in different treatment groups; a~i correspond to Group 1~Group 9 respectively.

[0059] Figure 24 The following are pathological sections of liver tissues of SPF chickens in different treatment groups; a~i correspond to Group 1~Group 9, respectively. In the figure, black arrows: hepatocyte necrosis; red arrows: inflammatory cell infiltration; green arrows: inclusion bodies; blue arrows: vacuolar degeneration. DETAILED DESCRIPTION

[0060] The present invention is further described in detail below through specific examples.

[0061] It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0062] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0063] The solution preparation involved in the embodiment:

[0064] Inclusion body washing solution: Weigh 2.42 g Tris, 120 g urea, and 8.7 g sodium chloride, dissolve them in 990 mL PBS, add 5 mL Triton-X 100, adjust the pH to 8, and then dilute to 1000 mL with PBS.

[0065] Inclusion body dissolution solution: Weigh 480 g of urea and dissolve it in 600 mL of PBS. After it is fully dissolved, adjust the pH to 8 and then use PBS to make up to 1000 mL.

[0066] Inclusion body purification eluent: Weigh 68.08 g of imidazole powder and dissolve it in 990 mL of inclusion body solubilization solution. Adjust the pH to 8 and then use inclusion body solubilization solution to make up to 1000 mL.

[0067] Dialysis bag treatment solution 1: Weigh 0.372 g EDTA and 20 g NaHCO3 and dissolve them in 980 mL deionized water, adjust the pH to 8, and then dilute to 1000 mL with deionized water.

[0068] Dialysis bag treatment solution 2: Weigh 0.372 g of EDTA and dissolve it in 995 mL of deionized water. Adjust the pH to 8, and then dilute to 1000 mL with deionized water.

[0069] Refolding dialysate 1: Weigh 360 g urea, 96.1 g L-arginine, 6.05 g Tris, 29.22 g NaCl, and 2 g sodium lauryl sarcosinate and dissolve them in 990 mL PBS. Adjust the pH to 8, and then dilute to 1000 mL with PBS.

[0070] Refolding dialysate 2: Weigh 96.1 g L-arginine, 6.05 g Tris, 29.22 g NaCl, and 2 g sodium lauryl sarcosinate and dissolve them in 990 mL PBS. Adjust the pH to 8 and then dilute to 1000 mL with PBS.

[0071] Refolding dialysate 3: Weigh 6.05 g Tris, 29.22 g NaCl, and 2 g sodium lauryl sarcosinate and dissolve them in 990 mL PBS. Adjust the pH to 8, and then dilute to 1000 mL with PBS.

[0072] Refolding dialysate 4: Weigh 6.05 g Tris and 29.22 g NaCl and dissolve them in 990 mL PBS, adjust the pH to 8, and then dilute to 1000 mL with PBS.

[0073] Refolding dialysate 5: Weigh 29.22 g of NaCl and dissolve it in 990 mL of PBS, adjust the pH to 8, and then dilute to 1000 mL with PBS.

[0074] Protein eluent: Weigh 68.08 g of imidazole powder and dissolve it in 990 mL of PBS. Adjust the pH to 8 and then dilute to 1000 mL with PBS.

[0075] The concentration of primers used in the examples was 10 μM.

[0076] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0077] Example 1 Prokaryotic Expression of Molecular Chaperones (i.e., Prokaryotic Expression of Chicken γ-Interferon Ch-IFN-γ)

[0078] 1. Construction of pET-28b(+)-Ch-IFN-γ prokaryotic expression system (schematic diagram as shown in the figure) Figure 1 shown)

[0079] The Ch-IFN-γ gene sequence was obtained from NCBI and synthesized by Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd. after codon optimization (the optimized sequence is shown in SEQ ID NO: 1). It was then synthesized and subcloned into the pET-28b(+) vector to construct the recombinant plasmid pET-28b(+)-Ch-IFN-γ. After confirmation of the plasmid's accuracy, large-scale amplification was performed. This plasmid was transformed into BL21(DE3) competent cells, and single clones were verified by PCR using T7 and T7T primers (T7: TAATACGACTCACTATAGGG (SEQ ID NO: 2), T7T: TGCTAGTTATTGCTCAGCGG (SEQ ID NO: 3)). Expression was initiated after positive PCR results and sequencing results were correct. The pET-28b(+)-Ch-IFN-γ-BL21(DE3) recombinant E. coli strain was amplified to express the target protein. Inoculate 1 mL of the recombinant strain into 50 mL of LB broth containing kanamycin and incubate it in a constant temperature shaker at 37°C and 200 rpm / min for 1.5 to 3 hours. 600 Perform the test and wait for its OD 600When the pH reaches between 0.5 and 0.8, first remove 4 mL of the bacterial suspension to maintain the cells. Then, add a sufficient amount of IPTG solution to achieve a final IPTG concentration of 0.1 mM in the shake flask. Return the shake flask to a constant temperature shaker at 16°C and 120 rpm / min and incubate for 20 hours. After 20 hours, transfer the bacterial suspension to a 50 mL centrifuge tube and centrifuge at 12,000 rpm / min for 1 minute. Discard the supernatant and weigh the cells. Resuspend each gram of cells in 20 mL of PBS and remove 1 mL of the resuspension into a 1.5 mL EP tube. Label the tube for later use. Disrupt the cells using an ultrasonic disruptor. Keep the sample tube in an ice-water bath during sonication. Set the ultrasonic disruptor parameters to 200 W, sonicate for 2 seconds, and pause for 3 seconds per cycle, for a total of 30 minutes. Continue sonicating until the cells are completely disrupted and intact bacteria are no longer visible under a microscope. After disruption, take out 1 mL of the disrupted mixture and place it in a 1.5 mL EP tube. Then take out 1 mL of the disrupted mixture and centrifuge it at 4°C, 12,000 rpm / min for 10 minutes to separate the supernatant and precipitate. Resuspend the precipitate with 1 mL of PBS. Label all samples and store them in a 4°C refrigerator until ready for use. All sample processing is now complete. Subsequently, protein samples (i.e., Ch-IFN-γ protein) need to be prepared from the unbroken whole bacterial solution, the disrupted mixture, the disrupted precipitate, and the disrupted supernatant for SDS-PAGE and Western blot experiments.

[0080] The bacterial solution PCR verification of the pET-28b(+)-Ch-IFN-γ-BL21(DE3) recombinant plasmid was as follows Figure 2 shown.

[0081] 2. Optimization of prokaryotic expression conditions

[0082] Since the protein still exists in the form of inclusion bodies under the conditions of 16℃ and 0.1mM IPTG, in order to save experimental time and increase protein expression, the shaking temperature can be directly set to 37℃ and the shaking speed to 200rpm / min. After confirming that the protein expression is correct, 1mL of the recombinant strain is inoculated into 150mL LB broth containing kanamycin and placed in a constant temperature shaking incubator at 37℃ and 200rpm / min for 1.5 to 3h. Starting from 1.5h, the OD value of the recombinant strain is measured every half hour using a microplate reader. 600 Perform the test and wait for its OD 600When the pH value reaches between 0.5 and 0.8, 150 mL of bacterial solution is evenly divided into 5 50 mL conical flasks, and IPTG solution is added to make the final IPTG concentration in the shake flasks 0.1 mM, 0.25 mM, 0.5 mM, 0.75 mM and 1 mM respectively. These five conical flasks are placed in a constant temperature shaker for cultivation. After the samples are harvested in batches at regular intervals, all samples are ultrasonically disrupted and subjected to SDS-PAGE experiments and Western blot experiments. After the IPTG concentration used is determined, the protein expression time is explored and the protein expression time is set to 8 h, 10 h, 12 h and 14 h respectively to express the protein. After the samples are harvested in batches at regular intervals, all samples are ultrasonically disrupted and subjected to SDS-PAGE experiments and Western blot experiments.

[0083] The target protein was expressed under the conditions of 16°C and 0.1mM IPTG. The bacteria were then collected and disrupted using an ultrasonic disruptor. The supernatant and precipitate were separated by centrifugation, and 5×SDS Loading Buffer was added in proportion to prepare the protein sample. After SDS-PAGE electrophoresis, Coomassie Brilliant Blue staining was performed. Figure 2 As shown in the figure, the target protein band can be seen near 25kDa in the whole bacterial sample and the precipitated sample after disruption. It can be seen that the target protein mainly exists in the form of inclusion bodies, and the inclusion bodies need to be renatured later.

[0084] Keeping the temperature, shaking time and shaking speed constant, 0.1mM IPTG, 0.25mMIPTG, 0.5mM IPTG, 0.75mM IPTG and 1mM IPTG were used to induce the target protein. The bacteria induced by different IPTG concentrations were collected, and the bacterial precipitates were collected after ultrasonic disruption and prepared as protein samples. After SDS-PAGE electrophoresis, Coomassie Brilliant Blue staining was performed. Figure 3 As shown in a, the target protein band can be seen near 25 kDa. The IPTG concentration is selected based on the protein band. In subsequent experiments, 0.5 mM IPTG concentration is selected as the optimal condition for protein induction.

[0085] Under the condition of keeping the temperature, IPTG concentration and shaking speed consistent, the target protein was induced using shaking time of 8h, 10h, 12h and 14h respectively. The induced bacteria were collected, and the bacterial precipitates were collected after ultrasonic disruption and prepared as protein samples. After SDS-PAGE electrophoresis, Coomassie brilliant blue staining was performed. Figure 3 As shown in b, the target protein band can be seen near 25 kDa. The shaking time is selected based on the protein band, and 12 h is determined as the optimal shaking time.

[0086] 3. Preparation of Recombinant Protein Sample (Ch-IFN-γ)

[0087] The above analysis of recombinant protein expression showed that Ch-IFN-γ was primarily expressed in the precipitate, i.e., as inclusion bodies. After selecting optimal conditions for large-scale protein expression, the cells were collected in a 50 mL centrifuge tube, disrupted by sonication, and centrifuged to collect the inclusion bodies. The inclusion bodies were resuspended in inclusion body wash buffer and centrifuged at 4°C, 12,000 rpm / min for 10 minutes. This process was repeated three times. The inclusion bodies were dissolved in inclusion body solubilization buffer (20 mL per 1 g of inclusion bodies). The cells were then placed in an ice-water mixture and shaken overnight on a horizontal shaker. Once the inclusion bodies were fully dissolved, the cells were centrifuged at 4°C, 12,000 rpm / min for 10 minutes. The supernatant was aspirated using a 50 mL syringe and filtered through a 0.22 μm filter. The filtered solution was then ready for protein purification.

[0088] 4. Purification and Identification of Recombinant Protein

[0089] After the instrument is self-cleaned, connect a 5mL Ni-NTA-Beads-6FF affinity chromatography column to the protein purifier. Tube A of the protein purifier is typically used to transport samples, while tube B is typically used to transport buffers such as imidazole. First, simultaneously transfer 25mL of 20% ethanol through tubes A and B, followed by 25mL of deionized water through both tubes, with the flow rate set at 1mL / min. Simultaneously transfer the inclusion body solubilization solution through tubes A and B at a flow rate of 1mL / min to equilibrate the columns. After the UV absorption line (UV280) stabilizes, zero the columns. Place tube A in a pre-prepared sample tube and inject the sample at a flow rate of 0.5mL / min. After the UV absorption line rises, collect the flow-through in a collection tube for later use. Continue transferring the inclusion body solubilization solution through tube A until the UV absorption line returns to zero. Place tube A in the inclusion body solubilization solution, and tube B in the purification eluate. Gradually adjust the sample loading percentage in tube B from 2% to 50%, setting the flow rate to 1 mL / min. Observe the UV absorbance. Each time it shows a significant increase, collect the eluate using a collection tube and label it for later use. First, simultaneously pass 25 mL of deionized water through tubes A and B, followed by 25 mL of 20% ethanol through tubes A and B. Set the flow rate to 1 mL / min, and then remove the affinity column from the protein purifier. Perform SDS-PAGE and Coomassie blue staining on the flowthrough and protein eluates containing different imidazole concentrations.

[0090] The target protein was purified using Ni NTABeads 6FF (AKTA) with a protein purifier. The protein flow-through and the eluate with different imidazole concentrations were subjected to SDS-PAGE and Coomassie Brilliant Blue staining. It can be seen that when the imidazole concentration is lower than 150mM, the main purpose is to wash away the impurities, while using 150mM imidazole for elution can obtain high-purity target protein ( Figure 4 ).

[0091] 5. Renaturation of Recombinant Cytokines

[0092] Dry-use dialysis bags require pretreatment before use. First, boil the bag in Dialysis Bag Treatment Solution 1 for 10 minutes, rinse thoroughly with pure water, and then boil the bag in Dialysis Bag Treatment Solution 2 for 10 minutes. After rinsing thoroughly with pure water, the bag can be stored in 20% ethanol. First, clamp one end of the dialysis bag with a sealing clip. Then, add the validated purified eluent to the bag, leaving 20% ​​headspace in the bag. Then, clamp the bag with another sealing clip. Place the dialysis bag in 1L of refolded Dialysis Solution 1, add a magnetic stir bar, and place in a 4°C refrigerator for overnight dialysis. After overnight dialysis, add refolded Dialysis Solution 2 to the water bag and add it dropwise to the dialysate in the beaker through the infusion tube. Each time the beaker reaches 2L of dialysate, discard 1L of dialysate and continue adding refolded Dialysis Solution 2. Repeat this process five times. Finally, dialyze overnight in refolding dialysate 2 to completely remove urea. Use refolding dialysate 3, 4, and 5 to gradually remove L-arginine, sodium lauryl sarcosinate, and Tris by dilution dialysis. After dialysis is complete, collect the recombinant protein solution in the dialysis bag and add PMSF to a final concentration of 1 mM. Store in a 4°C refrigerator for short periods of time.

[0093] Example 2 Eukaryotic Expression of Target Proteins (Hexon Protein of Group I Type 8a / 8b Fowl Adenovirus and Fiber2 Protein of Group I Type 4 Fowl Adenovirus)

[0094] The process flow diagram of eukaryotic expression of target protein is as follows Figure 5 shown.

[0095] 1. Amplify the target gene

[0096] Since the selected gene is conservative, the target gene can be amplified in most group I type 4 avian adenovirus strains and group I type 8a / 8b avian adenovirus strains.

[0097] Extract the total DNA of the virus strain, use the extracted viral DNA as a template, and perform the first PCR using primers (primers used for the fiber2 gene of group I type 4 fowl adenovirus: 4-fiber2-f: ATCAAGAACAGATCGGTGGACT (SEQ ID NO: 4), 4-fiber2-r: TTACGGGAGGGAGGCCGCT (SEQ ID NO: 5); primers used for the hexon gene of group I type 8a / 8b fowl adenovirus: 8a / 8b-hexon-f: CCCGAAACCGATAACGTG (SEQ ID NO: 6), 8a / 8b-hexon-r: GTCCTGGAAGTTGGGACCCT (SEQ ID NO: 7)). Since it is needed to construct a vector later, a high-fidelity enzyme is needed to amplify the target gene to obtain the primary PCR product to ensure the accuracy of the gene. If takara's high-fidelity enzyme is used, Max DNA Polymerase (Cat. No. R045A) uses a PCR reaction system consisting of 25 μL of high-fidelity enzyme, 1 μL of upstream / downstream primers, 30 ng of sample DNA, and deionized water to a final volume of 50 μL. The reaction program is as follows: 98°C for 5 minutes, followed by 45 cycles of 98°C for 10 seconds, 55°C for 5 seconds, and 72°C for 8 seconds, followed by 72°C for 5 minutes, and finally 4°C forever.

[0098] The amplified 4-fiber2 gene fragment was 1197 bp in size (the sequence is shown in SEQ ID NO: 8); the amplified 8a / 8b-hexon gene fragment was 966 bp in size (the sequence is shown in SEQ ID NO: 9).

[0099] 2. Vector linearization

[0100] The pFastBac-EGFP vector was linearized by inverse PCR.

[0101] The pFastBac1-N-EGFP plasmid from Beyotime was used and the vector was linearized using the following primers.

[0102] pFASTbac-EGFP-ZTXXH-F: GACTCTAGACTGCAGCTCGAGAAG (SEQ ID NO: 10); pFASTbac-EGFP-ZTXXH-R: GACGAATTCAGATCTAGGACCCTGG (SEQ ID NO: 11).

[0103] The linearized PCR reaction system was 25 μL high-fidelity enzyme ( High-fidelity enzyme), 1 μL upstream / downstream primers, 30 ng sample DNA (pFastBac1-N-EGFP plasmid), and deionized water to 50 μL. The reaction program was: 98°C for 5 min; 45 cycles of 98°C for 10 s, 55°C for 5 s, and 72°C for 30 s; 72°C for 5 min; and 4°C forever.

[0104] The linearized vector gene fragment amplified was 5517 bp in length ( Figure 6 ).

[0105] 3. Secondary PCR

[0106] The primers were used to perform secondary PCR on the primary PCR products of Fiber2 gene and Hexon gene (i.e., the products amplified in step 1). The PCR reaction system was 25 μL high-fidelity enzyme ( High-fidelity enzyme), 1 μL upstream / downstream primers, 30 ng of primary PCR product, and deionized water to 50 μL. The reaction program was: 98°C for 5 min; 45 cycles of 98°C for 10 s, 55°C for 5 s, and 72°C for 8 s; 72°C for 5 min; and 4°C forever.

[0107] The primer sequences used are as follows:

[0108] 4-Fiber2-TYCZ-F: GTCCTAGATCTGAATTCGTCATCAAGAACAGATCGGTGGA (SEQ ID NO: 12); 4-Fiber2-TYCZ-R: CTCGAGCTGCAGTCTAGAGTCTTACGGGAGGGAGGCCGCTG (SEQ ID NO: 13); 8a / 8b-Hexon-TYCZ-F: GTCCTAGATCTGAATTCGTCCCCGAAACCGATAACGTGGA (SEQ ID NO: 14); 8a / 8b-Hexon-TYCZ-R: TCGAGCTGCAGTCTAGAGTCCTAGTCCTGGAAGTTGGGACCC (SEQ ID NO: 15);

[0109] The amplified 4-fiber2+homology arm gene fragment was 1238 bp in size; the amplified 8a / 8b-hexon+homology arm gene fragment was 1009 bp in size ( Figure 6 ).

[0110] 4. Use homologous recombination to connect the target gene to the target vector

[0111] Homologous recombination was performed using the EZ-HiFi Seamless Cloning Kit. The homologous recombination system (10 μL) consisted of: 5 μL 2×HiFi Seamless Cloning Mix, 0.5 μL linearized vector (prepared in step 2), 2 μL target fragment (prepared in step 3), and 2.5 μL deionized water. The specific steps were as follows: gently mix, react at 50°C for 50 minutes, and place on ice after the reaction. The reaction product can be directly transformed into competent cells or stored in a -20°C refrigerator. The recombinant plasmids (denoted as pFastBac-EGFP-Fiber2 and pFastBac-EGFP-Hexon, the plasmid mass spectra of which are shown in Figure 2) were obtained. Figures 7 and 8 After the construction of the recombinant plasmid is completed and the gene sequence is confirmed to be correct, the recombinant plasmid is amplified in large quantities. Use a pipette to take 2 μL of the recombinant plasmid and add it to the DH10Bac competent cells. Tap the EP tube wall to mix the contents, mark it, place it in an ice water bath, and let it stand for 30 minutes. Transfer the EP tube to a 42°C constant temperature water bath for 70 seconds, then quickly transfer the centrifuge tube to an ice water bath and let it stand for 2 minutes. Add 900 μL of non-resistant SOC medium to each tube, mix well, and place it in a constant temperature shaker at 37°C and 200 rpm / min for 5 hours. After 5 hours, centrifuge at 3500 rpm / min for 5 minutes, discard most of the supernatant, and resuspend the cells in the remaining culture medium. Spread a portion of the resuspended bacteria onto LB agar plates containing 50 μg / mL kanamycin, 7 μg / mL gentamicin, 7 μg / mL tetracycline, 40 μg / mL X-gal, and 40 μg / mL IPTG. Incubate the plates at 37°C for 36-48 hours. After 36 hours, pick white monoclonal colonies and transfer them to LB agar plates containing 50 μg / mL kanamycin, 7 μg / mL gentamicin, 7 μg / mL tetracycline, 40 μg / mL X-gal, and 40 μg / mL IPTG. Incubate the plates at 37°C for 36-48 hours. Repeat twice. Use a 10μL pipette tip to pick a white monoclonal colony. Place the pipette tip containing a positive single colony into a centrifuge tube containing 500μL of LB liquid medium containing the corresponding resistance. Incubate the tube in a shaker at 37°C, 200 rpm / min for 2-4 hours. Then, use the shaken bacterial solution as a template and perform PCR detection on the selected colonies using primers M13-F and M13-R (SEQ ID NOs: 16-17).

[0112] The PCR system for bacterial liquid detection consists of 10 μL Green Tap Mix, 0.5 μL upstream / downstream primers, 1 μL bacterial liquid, and deionized water to 50 μL. The PCR reaction program is 95°C for 5 minutes, followed by 40 cycles of 95°C for 15 seconds, 55°C for 15 seconds, and 72°C for 1 minute, followed by 72°C for 5 minutes and 4°C forever.

[0113] PCR products were verified using agarose gel electrophoresis. Since shuttle plasmids carry sequences between transposition sites during transposition, using M13 primers for identification of bacmids introduces approximately 2300 bp of sequence. Therefore, a positive clone consists of: 2300 bp + EGFP tag size (717 bp) + the size of the inserted target gene.

[0114] The constructed recombinant plasmid was transformed into DH5α competent cells, and the culture medium was spread on ampicillin LB agar plates to screen for monoclonal colonies. The colonies were picked and amplified, and then PCR detection was performed using the PH-Profor and SV40Parev primers (PH-Profor: AAATGATAACCATCTCGC (SEQ ID NO: 18); SV40Parev: GAAATTTGTGATGCTATTGC (SEQ ID NO: 19)). The detection results are shown in Figure 2. Figure 9 As shown in the figure, the colonies with bright bands near 2300 bp and 2100 bp were positive colonies.

[0115] The constructed and verified plasmid was transformed into DH10Bac competent cells and evenly spread on LB agar plates containing 50μg / mL kanamycin, 7μg / mL gentamicin, 7μg / mL tetracycline, 40μg / mL X-gal and 40μg / mL IPTG. White monoclonal colonies were obtained by blue-white screening. Finally, white colonies were picked and amplified, and then PCR detection was performed using the M13-F and M13-R primer pairs. The test results are as follows. Figure 10 As shown in the figure, the colonies with bright bands near 4200bp and 4000bp respectively are positive colonies.

[0116] 5. Extraction of Recombinant Baculovirus Plasmid Bacmid

[0117] Follow the instructions of the Biyuntian Bacmid extraction kit. The specific steps are as follows:

[0118] Add white monoclonal colonies that are positive and sequenced correctly to 3 mL of LB broth (containing 7 μg / mL gentamicin, 100 μg / mL kanamycin, and 10 μg / mL tetracycline) and incubate overnight at 37°C in a shaker at 200 rpm / min. Collect the cells by centrifugation at 12,000 rpm / min for 1 minute. Add 600 μL of Solution I and resuspend the bacterial pellet using a micropipette or vortex mixer. Then add 600 μL of Solution II and gently invert the tube 6–8 times. Avoid vigorous vortexing to completely lyse the bacteria. Finally, add 600 μL of Solution III and invert the tube 8 times. A white flocculent precipitate will form. After standing for 5 minutes, centrifuge at 12,000 rpm / min for 5 minutes. The white precipitate will settle at the bottom of the tube. Pipette the supernatant into another tube. Add 800 μL of pre-chilled isopropanol to the supernatant, mix thoroughly by inversion, and place in a -20°C refrigerator for 30 minutes. Centrifuge at 4°C, 12,000 rpm / min, and discard the supernatant. Resuspend the pellet in 500 μL of 70% ethanol, which has been pre-placed in an ice-water bath, and centrifuge at 4°C, 15,000 rpm / min, for 5 minutes. Discard the supernatant. Resuspend the pellet again in 200 μL of pre-chilled 70% ethanol and centrifuge at 4°C, 15,000 rpm / min, for 5 minutes. Discard the supernatant. Uncap the centrifuge tube and dry it in a clean bench at room temperature. After the ethanol has evaporated completely, dissolve the pellet in autoclaved deionized water and store in a -20°C refrigerator until needed.

[0119] 6. Transfection of Recombinant Baculovirus into Sf9 Cells and Obtaining P1 Virus

[0120] Resuscitate Sf9 cells in advance and confirm that the cells are within the 2-3 day passage cycle and are in good condition. Add 3 μL of transfection reagent to 100 μL of SFM medium. Add 3 μL of Bacmid to 100 μL of SFM medium and mix gently. Mix the diluted Bacmid and transfection reagent and incubate for 30 minutes. Add 8×10 5100 Sf9 cells were cultured for 15 minutes. After the cells adhered, the original culture medium was discarded. A mixture of bacmid and transfection reagent was added to a six-well cell culture plate. The plate was placed in a 27°C cell culture incubator and allowed to stand for 4 hours. The mixture was then discarded and 2 mL of SFM culture medium was added to each well. The six-well cell culture plate was cultured in a 27°C cell culture incubator. After 60-72 hours, the Sf9 cells were observed under a fluorescence microscope to determine if fluorescence was present. When the fluorescence percentage exceeded 80%, the six-well tissue cell culture plate was freeze-thawed. After one freeze-thaw cycle, the plate was centrifuged at 4°C at 12,000 rpm for 3 minutes. The supernatant was the P1 viral fluid.

[0121] 7. Baculovirus Titer Determination

[0122] Sf9 cells were diluted to 1.5 × 10 5 100 μL of virus was added to each well of a 96-well cell plate and placed in a 27°C cell culture incubator for 1 hour to allow the cells to adhere. The virus was diluted with SFM medium at a dilution of 10 -1 ~10 -10 Use a pipette to aspirate the culture medium from the 96-well plate. Inoculate the diluted virus at a volume of 100 μL / well, performing eight replicates for each dilution. Continue incubating the cells in a 27°C cell incubator. Observe the cells daily for fluorescence, and record the fluorescence at 60-72 hours. The recorded results can be used to calculate the baculovirus titer using the Reed-Muench method.

[0123] 8. Obtaining P2 and P3 generation recombinant viruses

[0124] 8×10 5 cells, let it stand for 15 minutes in a biosafety cabinet, and discard the original culture medium after the cells adhere to the wall. Calculate the virus inoculation amount according to MOI = 0.5, and the formula is as follows: Previous generation virus inoculation amount (mL) = (MOI × number of cells) / virus titer. Inoculate 500μL of the previous generation virus liquid in each well and let it stand in a cell culture incubator at 27°C for 1 hour. After 1 hour, discard the virus liquid and add 2mL SFM culture medium to each well. Observe the fluorescence of the cells every day. When the fluorescence accounts for more than 80%, the six-well tissue cell culture plate can be frozen and thawed. After freezing and thawing once, centrifuge at 4°C and 12000rpm / min for 3 minutes. The supernatant is the virus liquid.

[0125] Bacmid identified as positive by PCR and sequenced correctly was Transfected into Sf9 cells, because it has an EGFP tag, the transfection efficiency can be clearly observed under a microscope. The transfected cell sample is collected as the P1 generation virus, and the P2 and P3 generation viruses are obtained by re-infecting Sf9 cells. Because the recombinant baculovirus has a fluorescent tag, the titer of the virus can be accurately and clearly measured. The results of fluorescence microscopy observation are as follows Figure 11 shown.

[0126] A portion of the P3 virus was centrifuged and ultrasonically disrupted, then centrifuged again. The supernatant and precipitate were separated for Western Blot identification. Mouse EGFP tag antibody was used as the primary antibody, and fluorescently labeled goat anti-mouse secondary antibody was used as the secondary antibody. It was found that Sf9 cells successfully expressed the target protein, and both target proteins were present in the supernatant. The size of EGFP-Hexon protein was approximately 68kDa, and the size of EGFP-Fiber2 protein was approximately 72kDa. Figure 12 ).

[0127] 9. Preparation of Recombinant Protein

[0128] The Sf9 cell culture volume was expanded to 1L, and the cells were cultured in a shaking flask, inoculated with P3 generation virus liquid, and cultured in a constant temperature shaker at 27°C. After 72 hours, the culture medium was centrifuged at 4°C and 4000rpm / min for 20 minutes, and the cell pellet was collected. The cell pellet was weighed, and 10mL PBS was added to each 1g of cell pellet for resuspending, and 1% PMSF was added to make the final concentration of PMSF 1mM. The cells were crushed using an ultrasonic crusher, and the sample needed to be placed in an ice water bath during ultrasonic crushing. The parameters of the ultrasonic crusher were set to 200W, ultrasonic for 2s, and pause for 3s. This was one cycle, and the total ultrasonic crushing was 50 minutes. The crushed mixture was centrifuged at 4°C and 12000rpm / min for 10 minutes, and the supernatant was collected to obtain the recombinant protein sample (i.e., EGFP-Fiber2 protein and EGFP-Hexon protein).

[0129] 10. Purification of Recombinant Protein

[0130] After the instrument self-cleans, connect the 5mL Ni-NTA-Beads-6FF affinity chromatography column to the protein purifier. First, simultaneously transfer 25mL of 20% ethanol through tubes A and B. Then, transfer 25mL of deionized water through both tubes A and B, setting the flow rate to 1mL / min. Simultaneously transfer PBS through tubes A and B at a flow rate of 1mL / min to equilibrate the columns. Once the UV absorbance stabilizes, zero the column. Transfer the recombinant protein sample prepared in step 7 through tube A at a flow rate of 0.5mL / min. After the UV absorbance increases, collect the flow-through via a collection tube for later use. Continue transferring PBS via tube A until the UV absorbance returns to zero. Place tube A in PBS and tube B in 1M imidazole solution. Gradually increase the sample loading percentage in tube B from 2% to 50%, setting the flow rate to 1mL / min. Observe the UV absorbance. Each time the UV absorbance increases, collect the eluate via a collection tube and mark it for later use. First, simultaneously deliver 25 mL of deionized water through tubes A and B, followed by 25 mL of 20% ethanol through both tubes A and B, with the flow rate set at 1 mL / min. The affinity chromatography column can then be removed from the protein purifier. The flow-through and the recombinant protein eluates containing different imidazole concentrations are then subjected to SDS-PAGE and stained with Coomassie Brilliant Blue.

[0131] The target protein was purified using Ni NTABeads 6FF (AKTA) with a protein purifier, and the protein flow-through and eluates with different imidazole concentrations were subjected to SDS-PAGE and Coomassie Brilliant Blue staining. Figure 13 As shown, for the two proteins, when imidazole at a concentration of 150 mM or higher is used to elute the proteins, the target proteins with higher purity can be obtained.

[0132] 11. Enzymatic cleavage of recombinant proteins

[0133] Use TEV Protease (His-tag) to enzymatically digest the purified protein. The specific steps are as follows: Use the corresponding concentration of pure imidazole solution as a negative sample to dissolve BSA and draw a BSA protein quantitative standard curve. Use the BCA protein quantitative standard curve drawn above to measure the concentration of the recombinant protein. 400U TEV Protease can be used for enzymatic digestion for every 1mg of protein. Add TEV Protease to the above-mentioned purified recombinant protein solution and perform enzymatic digestion while dialyzing to remove imidazole in a 4°C refrigerator. According to the method in "10. Protein Purification", pass through the nickel column again to remove TEV Protease (His-tag) and EGFP tags to obtain the purified target protein (i.e., FAdV-4-Fiber2 protein and FAdV-8a / 8b-Hexon protein).

[0134] There is a PreScission cleavage site between the EGFP tag protein and the target protein, which can be cleaved by TEV enzyme, which can minimize the impact on the structure and function of the target protein. The size of TEV enzyme protein is about 27kDa, the size of EGFP tag protein is about 30kDa, the size of Fiber2 protein is about 42kDa, and the size of Hexon protein is about 38kDa. After the fusion protein is cleaved, when the cleavage is sufficient, the original sample can be cleaved into EGFP tag protein and target protein. The cleavage results are as follows: Figure 14 shown.

[0135] Because TEV enzyme and EGFP tagged protein are both preceded by his tags, the TEV enzyme and EGFP tagged protein can be removed from the sample by passing through NiNTABeads6FF (AKTA) again, thereby achieving the purification of the target protein. The size of TEV enzyme protein is about 27kDa, the size of EGFP tagged protein is about 30kDa, the size of Fiber2 protein is about 42kDa, and the size of Hexon protein is about 38kDa. When the sample passes through NiNTABeads 6FF (AKTA), the target protein will appear in the flow-through because it has no his tag, while the TEV enzyme and EGFP tagged protein will be in the subsequent eluent. The results after enzyme purification are as follows Figure 15 shown.

[0136] The purified target protein was used as a sample. The size of Fiber2 protein is about 42kDa, and the size of Hexon protein is about 38kDa. FAdV-4 positive serum and FAdV-E positive serum stored in the laboratory were used as primary antibodies, and HRP-labeled goat anti-chicken IgG was used as secondary antibody. After Western Blot identification, the target bands were observed in the target interval ( Figure 16 ).

[0137] Example 3 Preparation of trivalent subunit vaccine

[0138] 1. Preparation of trivalent subunit vaccine (flow chart as shown Figure 17 shown)

[0139] Preparation of antigen liquid: The antigen liquid is jointly prepared by FAdV-4-Fiber2 protein, FAdV-8a / 8b-Hexon protein (prepared by Example 2) and IFN-γ molecular chaperone (i.e., Ch-IFN-γ, prepared by Example 1). Each protein needs to be diluted with PBS according to the experimental requirements and premixed in the same system to form an antigen mixture. The injection volume of each dose of the vaccine is 500 μL. When calculating the dilution of the target protein, it can be known that the final concentration of FAdV-4-Fiber2 protein needs to be adjusted to 150 μg / mL, the final concentration of FAdV-8a / 8b-Hexon needs to be adjusted to 300 μg / mL, and the final concentration of IFN-γ needs to be adjusted to 12 μg / mL by calculating the emulsification ratio of the aqueous phase and the oil phase and the vaccine injection volume. The three are diluted in PBS according to this ratio and can be emulsified with the oil phase to prepare a vaccine. The specific amount of each protein is shown in Table 2.

[0140] Table 2 Amount of each protein used in trivalent avian adenovirus subunit vaccine / dose

[0141]

[0142] Preparation of oil phase: Measure 47 mL of white oil adjuvant, then add 2 g of aluminum stearate and shake vigorously until the aluminum stearate is completely dispersed and the mixture becomes milky white. Then add 3 mL of Span-80 and shake again. Sterilize by high-pressure steam at 121°C. After cooling, it can be stored at room temperature for a short period of time.

[0143] Prepare the aqueous phase: Mix the diluted proteins (i.e., the AdV-4-Fiber2 protein, FAdV-8a / 8b-Hexon protein, and Ch-IFN-γ from the antigen solution) according to the appropriate ratio. After mixing thoroughly, filter the protein mixture through a 0.22 μm filter. Autoclave Tween-80 in advance. After cooling, add 1 mL of Tween-80 to 19 mL of the protein mixture and mix thoroughly.

[0144] Emulsification: Autoclave the stirring rod and small beaker of the high-speed stirring homogenizer in advance. After cooling to room temperature, take 30 mL of oil phase and put it in a small beaker. The stirring rod of the high-speed stirring homogenizer needs to be immersed below the liquid surface. Start the high-speed stirring homogenizer first and stir in medium-speed stirring mode. At the same time, slowly add 15 mL of water phase. After adding, stir in high-speed stirring mode for 3 minutes, pause for 5 minutes, and repeat this as a cycle. Repeat 10 times to obtain an oil emulsion vaccine, that is, a trivalent subunit vaccine.

[0145] The dosage form and stability of the oil-emulsion vaccine were tested. If qualified, the prepared oil-emulsion vaccine could be transferred to a 50 mL centrifuge tube and stored in a 4°C refrigerator for later use.

[0146] 2. Characteristic testing of trivalent subunit vaccine (oil emulsion vaccine)

[0147] (1) Dosage form inspection

[0148] Take a petri dish and fill it with cold water. Place a drop of oil-emulsion vaccine 2-3 cm above the liquid surface. After a 10-second interval, observe whether it diffuses and sinks. Repeat three times. If no diffusion or sinking occurs, the oil-emulsion vaccine formulation is qualified.

[0149] The results are as follows Figure 18 As shown in a, the prepared oil emulsion vaccine showed no diffusion or sinking phenomenon, and the oil emulsion vaccine dosage form was qualified.

[0150] (2) Stability test

[0151] Place 1 mL of the oil-emulsion vaccine in a 1.5 mL EP tube and centrifuge at 5000 rpm / min for 10 minutes. Observe the bottom of the tube to see if there is any aqueous phase precipitation. If no aqueous phase precipitation occurs, the oil-emulsion vaccine meets the required stability standards.

[0152] The results are as follows Figure 18 As shown in b, the oil-emulsion vaccine has no water phase precipitation, and the oil-emulsion vaccine is stable.

[0153] (3) Sterility test

[0154] The antigen liquid, oil phase, aqueous phase and oil emulsion vaccine were inoculated onto antibiotic-free LB agar, XLD agar and anaerobic broth culture media, respectively, and placed in a 37°C constant temperature incubator for 24 to 48 hours to observe whether there was colony growth and reproduction.

[0155] The results are as follows Figures 19 and 20 As shown, the oil-emulsion vaccine grew sterilely in LB agar, XLD agar, and anaerobic broth.

[0156] (4) Mycoplasma test

[0157] The oil emulsion vaccine was inoculated into Frey solid medium, which was placed in a 37°C constant temperature incubator for one month to observe whether mycoplasma growth and reproduction occurred.

[0158] The results are as follows Figure 20 As shown in middle b, no mycoplasma grew and multiplied in the oil emulsion vaccine on Frey solid medium.

[0159] (5) Safety inspection

[0160] Twelve two-week-old SPF chickens were raised and divided equally into three groups. At two weeks of age, Group 1 received 500 μL of the oil-emulsion vaccine via intramuscular injection; Group 2 received 500 μL of sterile white oil adjuvant via intramuscular injection; and Group 3 received 500 μL of normal saline via intramuscular injection. Following vaccination, the animals were observed daily for their mental state, food intake, and injection site condition.

[0161] The mental state and feeding habits of the SPF chickens in the oil-emulsion vaccine group were relatively good, and no SPF chickens died, proving that the subunit vaccine passed the safety test.

[0162] Example 4 Animal Experiment

[0163] 90 SPF chickens were raised to 10 days of age and divided into 9 groups, with 10 chickens in each group. The specific experimental groups, immunization types, and virus infection types are shown in Table 3.

[0164] "New Flu Gland" trivalent inactivated vaccine: Shandong Binzhou Wohua Bioengineering Co., Ltd., Huadeng Corning, commercial vaccine certificate number: (2021) New Veterinary Drug Certificate No. 54.

[0165] Table 3 Animal immunization and protection experimental groups

[0166]

[0167] The immunization procedure is as follows: the first vaccination is performed at 12 days of age, and SPF chickens are immunized by leg muscle injection, with each SPF chicken being inoculated with 500 μL; the second vaccination is performed on the 14th day after the first vaccination, with each chicken being injected with 500 μL through the leg muscle.

[0168] On the 7th day, 14th day (before the second vaccination) and 21st day (before virus infection) after the first vaccination, blood was collected from SPF chickens, serum was separated, labeled and stored in a -20℃ refrigerator for future use. The antibody titer in the serum could be tested subsequently using ELISA.

[0169] On the 7th day after the second vaccination, the SPF chickens were infected with the virus according to the groups. The virus infection dose of each SPF chicken was 105.5TCID 50Groups 1, 4, and 7 were injected with GS / GZBJ / 032612023 (FAdV-4) through the leg muscles; Groups 2, 5, and 8 were injected with DK / GDJM / 0313 / 2022 (FAdV-8a) through the leg muscles; and Groups 3, 6, and 9 were injected with CK / GDJM / 0516 / 2021 (FAdV-8b) through the leg muscles. The SPF chickens were observed continuously every day for 14 days after virus infection, and the clinical condition and survival rate of the SPF chickens were recorded. Cloacal swabs were collected from each SPF chicken at 1 dpi, 3 dpi, 5 dpi, 7 dpi, 9 dpi, 11 dpi, and 13 dpi, and placed in 1 mL of DMEM / F-12 culture medium containing 1% penicillin-streptomycin mixture (100×) and 30% glycerol. The swabs were labeled and stored in a -80°C refrigerator for later use or for PCR identification. At 5 dpi, one SPF chicken in each group was randomly selected for autopsy, and the organs were pathologically examined to observe whether the chickens showed the characteristic symptoms of avian adenovirus. Some liver tissue with obvious lesions was then removed and sent to Aifang Biological for preparation of pathological sections.

[0170] Determination of antibody titer in serum: Antibody levels were determined using an indirect ELISA method. First, the purified target protein (prepared in Example 2) was diluted to a concentration of 10 μg / mL using a coating solution. A 96-well ELISA plate was coated at 100 μL / well, placed in a 37°C constant temperature incubator for 1 hour, and then transferred to a 4°C refrigerator for overnight coating. The next day, the coating solution was discarded and the ELISA plate was washed with TBST. 200 μL of TBST was added to each well, and the plate was placed on a horizontal shaker for 5 minutes. After discarding the liquid, the plate was tapped to remove any residue. This plate washing step was repeated three times. 200 μL of blocking solution was added to each well for blocking, and the plate was placed in a 37°C constant temperature incubator for 2 hours. After discarding the blocking solution, the plate washing step was repeated three times. The serum sample to be tested was diluted 1:50 with blocking solution, added at 100 μL / well, incubated in a 37°C incubator for 1 hour for antigen-antibody specific binding, and the plate was washed 3 times to remove unbound components; HRP-labeled goat anti-chicken IgG was used as the secondary antibody, added at 100 μL / well, incubated in a 37°C constant temperature incubator for 1 hour, and then washed 3 times; 100 μL of TMB single-component colorimetric solution was added to each well, and the reaction was carried out in the dark at room temperature for 10 minutes. After the color development was completed, 100 μL of stop solution was added to terminate the reaction; finally, a microplate reader was used to read the OD value. 450 The experimental results were detected at a wavelength of .

[0171] Results: According to the virus infection protection experiment, Group 1 to Group 3 were immunized with the trivalent oil emulsion subunit vaccine prepared in Example 3 of the present invention, Group 4 to Group 6 were immunized with the "New Fluid Gland" triple inactivated vaccine, and Group 7 to Group 9 were negative controls; virus infection was performed on the 21st day after the first immunization, and the death rate of SPF chickens was recorded every day to draw a survival curve of SPF chickens, as shown in FIG. Figure 21 As shown. During the entire experimental process, the SPF chickens of Group 1 to Group 4 did not show obvious clinical symptoms, and their feeding and mental state were good, with a final survival rate of 100%; the SPF chickens of Group 5 died on 4dpi, with 2 deaths. In the subsequent experimental process, the remaining SPF chickens in this group only showed a decrease in feed intake and unwillingness to move, and no further deaths occurred, with a final survival rate of 80%; one SPF chicken of Group 6 died on 3dpi, and two died on 4dpi. There was no further death afterwards, but there was also a decrease in feed intake and unwillingness to move, with a final survival rate of 70%; the SPF chickens of Group 7 showed symptoms such as ruffled feathers and lethargy 24 hours after virus infection, and died on 2dpi, with 2 deaths, 3 deaths on 3dpi, 3 deaths on 4dpi, and 1 death on 5dpi, with a final survival rate of 10%; One SPF chicken in Group 8 died at 4 dpi and one died at 5 dpi, and no subsequent deaths occurred, with a final survival rate of 20%; one SPF chicken in Group 9 died at 3 dpi, two died at 4 dpi, and one died at 5 dpi, with a final survival rate of 60%.

[0172] Cloacal swabs were collected from each SPF chicken at 1, 3, 5, 7, 9, 11, and 13 dpi. After PCR testing, the toxin shedding status of the SPF chickens was recorded and the data were compiled. The toxin shedding status is shown in Table 4. At 1 dpi, one SPF chicken in Group 2 and Group 3 each had a positive cloacal swab. At 3 dpi, two SPF chickens in Group 1 and Group 2 each had a positive cloacal swab, while one SPF chicken in Group 3 and Group 4 each had a positive cloacal swab. No positive cloacal swabs were detected in Groups 1 to 4 after 5 dpi. However, cloacal swabs were positive in Groups 5 to 8 throughout the experiment.

[0173] Table 4 Detoxification of SPF chickens

[0174]

[0175] Note: Number of animals with positive shedding of toxins / total number of animals surviving.

[0176] The antibody levels of the serum collected on the 7th day, 14th day (before the second vaccination) and 21st day (before virus infection) after the first vaccination were measured and the antibody level change curve was drawn. Group 1 and Group 4 were measured using the Fiber2 protein ELISA method, and Group 2 and Group 3 were measured using the Hexon protein ELISA method. The antibody change curves of the four groups of serum are shown in Figure 2. Figure 22 As shown in the figure, antibody levels in the four SPF chicken groups changed slowly within 7 days after immunization. They gradually increased from 7 to 14 days, and then surged from 14 to 21 days, demonstrating that the subunit vaccine was able to induce antibody production. On day 21, antibody levels in Group 1 reached a peak and were significantly higher than those in the other three groups.

[0177] At 5 dpi, one surviving SPF chicken was randomly selected from the other groups except Group 7 for autopsy. Group 7 autopsied the SPF chicken that died at 5 dpi and visually inspected its liver. Figure 23 As shown in the figure, the livers of SPF chickens in each group showed significant pathological differentiation: in Group 1 to Group 4, the livers of SPF chickens were uniformly dark red, with a smooth liver surface and no bruises. The liver tissue felt firm and elastic, and rebounded quickly after being pressed. After dissection, the cross-section texture was clear, without fat infiltration or necrotic foci, and no obvious lesions were found. The livers of SPF chickens in Group 5 and Group 6 showed symptoms of IBH, with obvious jaundice on the liver surface, and pinpoint to millet-shaped hemorrhages scattered on the surface, and dark red hemorrhages were visible locally. The SPF chickens in Group 7 showed obvious symptoms of HHS, with severe pericardial effusion, significantly enlarged liver volume, blunt edges, irregular hemorrhages and jaundice on the surface, and hemorrhage at the edge of the liver. The livers of SPF chickens in Group 8 became brittle and fragile, with cord-like yellow-brown necrotic lesions distributed on the edge of the liver. The central area became brittle and easily broken when touched, and jaundice occurred on the liver surface. The liver lesions of SPF chickens at 9 were extremely obvious, with extensive fatty degeneration of the liver, large areas of jaundice and hemorrhagic plaques on the surface, yellowing in color, and a noticeable greasy feeling on the cross-section of the liver.

[0178] Samples of liver tissue from prominently affected areas were collected, fixed with 4% paraformaldehyde, and sent to Aifang Biotechnology for pathological sectioning. Histological analysis was then performed based on the results. The results, shown in Figure 24, showed significant differences in the liver tissue structure among the SPF chicken groups. Groups 1 through 4 exhibited intact liver capsules, uniform hepatocyte cytoplasm, normal structure, and neatly arranged hepatic lobules, with no apparent inflammatory cell infiltration. In contrast, the remaining groups exhibited widespread hepatocyte degeneration and necrosis, inflammatory cell infiltration, and inclusion bodies, characteristic of HHS and IBH histological pathology. For example, in the tissue sections of Group 6, disordered hepatocyte structure can be observed, with a large number of hepatocytes showing degeneration and necrosis, loose cytoplasm, light staining and reticular vacuolation, and pale staining or even disappearance of the cell nucleus. For example, in Group 8, disordered hepatocyte structure, vacuolar degeneration, localized lipid droplet deposition, and cytoplasm filled with lipid droplet vacuoles of varying sizes were observed. Focal necrosis was obvious, with a large number of inflammatory cell infiltration and the appearance of numerous inclusion bodies. For example, in Group 10, disordered hepatocyte structure, vacuolar degeneration, localized lipid droplet deposition, and expansion and fusion of necrotic areas to form obvious necrotic foci were observed. A large number of inflammatory cells infiltrated and inclusion bodies appeared.

[0179] After a comprehensive evaluation of the vaccine's immune effect and analysis of the survival rate, antibody level, detoxification, clinical symptoms and pathological histological changes of SPF chickens, it was shown that the overall immune effect of the trivalent oil emulsion subunit vaccine prepared by the present invention was significantly better than that of the "New Rheumatoid Arthritis" triple inactivated vaccine and the negative control.

[0180] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.

Claims

1. An antigen composition comprising Fiber2 protein of FAdV-4, Hexon protein of FAdV-8a / 8b and a molecular adjuvant, wherein the molecular adjuvant is interferon.

2. The antigen composition according to claim 1, characterized in that The interferon includes chicken gamma-interferon.

3. The antigen composition according to claim 2, characterized in that The nucleotide sequence of the chicken interferon-γ is shown in SEQ ID NO:

1.

4. The antigen composition according to any one of claims 1 to 3, characterized in that The nucleotide sequence of the Fiber2 protein of the FAdV-4 is shown in SEQ ID NO: 8, and the nucleotide sequence of the Hexon protein of the FAdV-8a / 8b is shown in SEQ ID NO:

9.

5. The antigen composition according to claim 4, characterized in that The Fiber2 protein of FAdV-4 and the Hexon protein of FAdV-8a / 8b are expressed through an insect baculovirus expression system; and / or the interferon is expressed through an Escherichia coli expression system.

6. Use of the antigen composition according to any one of claims 1 to 5 in the preparation of a product; Preferably, the product comprises at least one of a drug, a reagent, and a kit; Preferably, the medicament comprises a vaccine; Preferably, the product has the function of preventing and / or treating diseases caused by avian adenovirus.

7. A trivalent subunit vaccine comprising the antigen composition according to any one of claims 1 to 5.

8. The trivalent subunit vaccine according to claim 7, characterized in that The mass ratio of the Fiber2 protein of FAdV-4, the Hexon protein of FAdV-8a / 8b and the molecular adjuvant is 1:(2-4):(0.05-0.1).

9. The trivalent subunit vaccine according to claim 7 or 8, characterized in that The trivalent subunit vaccine further comprises a pharmaceutically acceptable excipient and / or adjuvant.

10. The trivalent subunit vaccine according to claim 9, characterized in that The adjuvant includes at least one of white oil adjuvant, aluminum stearate, ISA763A, aluminum hydroxide, lecithin, mpltm, IL-12, isa51vg, isa720vg, mf59, qs21, and as03 adjuvant.

Images