A method for constructing a lupus-susceptible animal model and application thereof

By knocking out the MTCH2 gene using CRISPR Cas9 technology, an animal model of lupus erythematosus was constructed, solving the problem of the lack of effective lupus models in existing technologies and enabling in-depth research on the progression of lupus disease and drug screening.

CN120519461BActive Publication Date: 2026-04-17BEIJING HOSPITAL
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510720888.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-30
Publication Date
2026-04-17
Estimated Expiration
2045-05-30

AI Technical Summary

Technical Problem

The lack of effective animal models for lupus in current technologies makes it difficult to conduct in-depth research on the pathogenesis of lupus and to screen for therapeutic drugs.

Method used

A lupus animal model was constructed by knocking out the MTCH2 gene using CRISPR Cas9 technology. The lupus animal model was constructed by knocking out the MTCH2 gene and combined with Pristane or Imiquimod inducing drugs to establish a lupus model at multiple tissue levels.

Benefits of technology

This study provides a tool for in-depth exploration of lupus disease progression, verifies the important role of the MTCH2 molecule in lupus, and offers new insights for the study of lupus disease mechanisms and the screening of therapeutic drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519461B_ABST
    Figure CN120519461B_ABST
Patent Text Reader

Abstract

This invention discloses a method for constructing a lupus susceptibility animal model and its application. This application is the first to propose using MTCH2 knockout to construct a lupus animal model, building the model at multiple tissue levels (systemic knockout and B cell-specific knockout). Using this model, a series of functions of lupus B cells, including apoptosis, activation, mitochondrial membrane potential difference, oxidative stress, oxidative phosphorylation, and antibody production, are investigated in depth. This verifies the important role of the MTCH2 molecule in the progression of lupus disease and provides new insights for the study of the disease mechanism of lupus and the screening of therapeutic drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a method for constructing an animal model of lupus susceptibility and its application. Background Technology

[0002] Systemic lupus erythematosus (SLE) is an autoimmune disease with a complex pathogenesis, characterized by the production of large amounts of autoantibodies and persistent chronic inflammation, which can lead to damage to multiple tissues and organs throughout the body. A key feature of SLE is the formation of an immune response against nuclear autoantigens (such as nucleic acids and histones).

[0003] Laboratory animals are indispensable tools in biomedical research, playing a vital role in exploring the basic functions of genes, investigating the pathogenesis of diseases, and screening drugs for preclinical applications. Providing an animal model of lupus is crucial for understanding the pathogenesis and effective treatment of lupus. Summary of the Invention

[0004] To overcome the shortcomings of existing technologies, this invention provides a method for constructing a lupus susceptibility animal model and its application.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A first aspect of the present invention provides a gRNA targeting the MTCH2 gene, the sequence of which is shown in any one of SEQ ID NO: 1-4.

[0007] Furthermore, the gRNA also includes biological materials associated with the gRNA.

[0008] Furthermore, the biomaterial is selected from any of the following:

[0009] (1) A nucleic acid molecule encoding the gRNA;

[0010] (2) An expression cassette containing the nucleic acid molecule described in (1);

[0011] (3) A recombinant vector containing the nucleic acid molecule described in (1) or the expression cassette described in (2);

[0012] (4) Recombinant cells containing the nucleic acid molecule described in (1), the expression cassette described in (2), or the recombinant vector described in (3).

[0013] A second aspect of the present invention provides a product comprising the gRNA described in the first aspect of the present invention.

[0014] Furthermore, the product includes a reagent kit.

[0015] Furthermore, the kit also includes Cas9 mRNA.

[0016] Furthermore, the kit also includes a donor vector.

[0017] A third aspect of the present invention provides a method for constructing a lupus animal model, the method comprising constructing a lupus animal model by knocking out the MTCH2 gene.

[0018] Furthermore, the knockout is performed by knocking out the MTCH2 gene using CRISPR Cas9 technology.

[0019] Furthermore, the method specifically includes:

[0020] (1) Introduce gRNA, Cas9 mRNA and donor vector into recipient cells to obtain F0 generation animals;

[0021] (2) Positive F0 generation animals were mated with wild-type animals to obtain homozygous Mtch2. fl / fl animal;

[0022] (3) Mtch2 fl / fl Animals were hybridized with Cre animals and drugs were introduced to obtain animal models of lupus erythematosus;

[0023] Alternatively, the method may specifically include: adopting spleen cells / CD4+ T cells from BM12 animals into Mtch2. fl / fl Animal models of lupus erythematosus were established in animals obtained by hybridization of animals with Cre animals.

[0024] Furthermore, the gRNA is the gRNA described in the first aspect of this invention.

[0025] Furthermore, the animal in question is a mammal.

[0026] Furthermore, the mammal is selected from rodents.

[0027] Furthermore, the rodent is selected from mice.

[0028] Furthermore, the mice were selected from C57BL / 6J mice.

[0029] Furthermore, the Cre animals include CAGGCre-ER mice and / or Mb1-iCre mice.

[0030] Furthermore, the recipient cell mentioned in (1) is a fertilized egg.

[0031] Furthermore, the method of introduction described in (1) is microinjection.

[0032] Furthermore, the drug mentioned in (3) is a lupus erythematosus inducing drug.

[0033] Furthermore, the lupus-inducing drug is selected from Pristane or Imiquimod.

[0034] Furthermore, the method also includes using a gene knockout activator to maintain the gene knockout state.

[0035] Furthermore, the gene knockout activator is selected from tamoxifen.

[0036] The fourth aspect of the present invention provides the use of the gRNA described in the first aspect of the present invention or the product described in the second aspect of the present invention in the construction of a lupus erythematosus model.

[0037] The fifth aspect of the invention provides the application of the lupus animal model constructed by the method described in the third aspect of the invention in screening drugs for the treatment / prevention of lupus or in the study of the disease mechanism / target of lupus.

[0038] A sixth aspect of the present invention provides a method for screening candidate drugs for the treatment / prevention of lupus erythematosus, the method comprising administering a test drug to an animal model of lupus erythematosus constructed by the method described in the third aspect of the present invention, and selecting a test drug capable of improving lupus erythematosus symptoms.

[0039] The seventh aspect of the present invention provides the use of MTCH2 as a target in screening candidate drugs for the treatment of lupus erythematosus.

[0040] Furthermore, the method for screening candidate drugs for the treatment of lupus includes: testing the effect of the candidate drug on the MTCH2 level in a sample obtained from the subject, wherein an increase in the MTCH2 level after using the candidate drug indicates that the candidate drug has a therapeutic effect on lupus.

[0041] Advantages and beneficial effects of the present invention:

[0042] This application is the first to propose the use of MTCH2 knockout to construct a lupus animal model. The lupus animal model was constructed at multiple tissue levels (systemic knockout and B cell-specific knockout), and the model was used to conduct in-depth research on a series of functions of lupus B cells, including apoptosis, activation, mitochondrial membrane potential difference, oxidative stress, oxidative phosphorylation, and antibody production. This verified the important role of MTCH2 molecules in the progression of lupus disease and provided new ideas for the study of the disease mechanism of lupus and the screening of therapeutic drugs. Attached Figure Description

[0043] Figure 1This is a diagram of MTCH2 gene expression analysis. In this diagram, 1A is a cell diagram of SLE patients and healthy patients, 1B is a diagram of MTCH2 expression in SLE patients with different disease activities, and 1C is a diagram of MTCH2 analysis in B cells of SLE patients.

[0044] Figure 2 This is a PCR genotype identification diagram of F1 mice;

[0045] Figure 3 This is a Southern imprint genotype identification diagram of F1 mice;

[0046] Figure 4 It is Mtch2 fl / fl CAGG Cre / + Mouse construction strategy diagram;

[0047] Figure 5 It is Mtch2 fl / fl Mb1 Cre / + Mouse construction strategy diagram;

[0048] Figure 6 This is a mouse genotype identification diagram, where 6A represents Mtch2. fl / fl Mb1 Cre / + Agarose gel electrophoresis images of mouse genotype identification; 6A (bottom) shows the genotype identification results, and 6B (top) shows the Mtch2 results. fl / fl CAGG Cre / + Agarose gel electrophoresis image of mouse genotype identification, with the genotype identification results shown in 6B below.

[0049] Figure 7 It is Mtch2 fl / fl CAGG Cre / + Phenotypic results of lupus in mice, where 7A on the left is Mtch2 mice induced by Pristane for 6 months. fl / fl and Mtch2 fl / fl CAGG Cre / + Comparative images of the spleen in a mouse lupus model, 7A (right) is a comparison of the mandibular lymph nodes, and 7B is a comparison of Mtch2 cells induced by Pristane for 6 months. fl / fl and Mtch2 fl / fl CAGG Cre / + Comparison of urinary albumin, anti-dsDNA, and antinuclear antibody (ANA) in a mouse lupus model. The left side of 7C represents Mtch2 mice induced by imiquimod (IMQ) for 6 weeks. fl / fl and Mtch2 fl / fl CAGG Cre / + Comparative images of the spleen in a mouse lupus model; 7C (right) is a comparison of the mandibular lymph nodes; 7D is a comparison of the Mtch2 lymph nodes induced by imiquimod (IMQ) for 6 months. fl / fl and

[0050] Mtch2 fl / fl CAGG Cre / + A comparison of urinary protein, anti-dsDNA, and antinuclear antibody (ANA) in a mouse lupus model. 7E represents Mtch2 mice induced by Pristane for 6 months. fl / fl and Mtch2 fl / fl CAGG Cre / + Immunofluorescence assay of IgG and IgM in the kidneys of a mouse lupus model. 7F represents Mtch2 cells induced by Pristane for 6 months. fl / fl and Mtch2 fl / fl CAGG Cre / + Image of HE staining results of kidneys in a mouse lupus model. 7G represents Mtch2 cells induced by Pristane for 6 months. fl / fl and Mtch2 fl / fl CAGG Cre / + Flow cytometry results of germinal centers in a mouse lupus model;

[0051] Figure 8 It is Mtch2 fl / fl Mb1 Cre / + The image shows the phenotypic results of lupus in mice, where 8A represents Mtch2 mice induced by Pristane for 6 months. fl / fl and Mtch2 fl / fl Mb1 Cre / + Comparative images of spleens in a mouse lupus model, 8B is the Mtch2 spleen induced by Pristane for 6 months. fl / fl and Mtch2 fl / fl Mb1 Cre / + A comparison of urinary albumin, anti-dsDNA, and antinuclear antibody (ANA) in a mouse lupus model. 8C represents the Mtch2 mice induced 14 days prior to H2-IA BM12 / KhEgJ (BM12 mice). fl / fl and Mtch2 fl / fl Mb1 Cre / + Comparative images of spleens in a mouse lupus model, 8D is the Mtch2 in BM12 mice induced for 14 days. fl / fl and Mtch2 fl / fl Mb1 Cre / + A comparison of urinary albumin, anti-dsDNA, and antinuclear antibody (ANA) in a mouse lupus model. 8E represents Mtch2 mice induced by Pristane for 6 months. fl / fl and Mtch2 fl / fl Mb1 Cre / + The graph shows the flow cytometry results of antibody-secreting cells (ASCs) and the proportion of IgG1-expressing ASCs in the spleen of a mouse lupus model, along with a comparison of flow cytometry plots and bar graphs. 8F represents the Mtch2 cells induced in BM12 mice for 14 days. fl / fland Mtch2 fl / fl Mb1 Cre / + A comparison of the proportion of germinal centers in the spleen as detected by flow cytometry in a mouse lupus model.

[0052] Figure 9 This diagram illustrates how MTCH2 exacerbates lupus disease progression by affecting mitochondrial function. Figure 9A shows the ROS and mitochondrial ROS (mROS) of B cells in SLE patients, and figure 9B shows the effects of Pristane-induced MTCH2. fl / fl and Mtch2 fl / fl CAGG Cre / + The image shows the results of mROS and mitochondrial membrane potential difference (TMRM) detection in spleen B cells of lupus mice. 9C represents Pristane-induced TMRM. fl / fl and Mtch2 fl / fl Mb1 Cre / + A flow cytometry plot of apoptosis percentage in spleen B cells of lupus mice, with the 9D plot showing Pristane-induced Mtch2 apoptosis. fl / fl and Mtch2 fl / fl CAGG Cre / + Mitochondrial morphology of spleen B cells in lupus mice, 9D below shows Pristane-induced Mtch2. fl / fl and Mtch2 fl / fl Mb1 Cre / + Mitochondrial morphology of spleen B cells in lupus mice; the image above (9E) shows mitochondrial morphology induced by Pristane. fl / fl and Mtch2 fl / fl CAGG Cre / + The image shows the results of the Seahorse assay for mitochondrial stress in spleen B cells of lupus mice. The lower 9E image shows Pristane-induced mitochondrial stress in mitochondrial cells. fl / fl and Mtch2 fl / fl Mb1 Cre / + Figure 1. Results of Seahorse assay for mitochondrial stress in spleen B cells of lupus mice. Detailed Implementation

[0053] The following provides definitions for some of the terms used in this specification. Unless otherwise stated, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0054] The present invention provides a gRNA targeting the MTCH2 gene, the sequence of which is shown in any one of SEQ ID NO:1-4, and the gRNA further includes biological material associated with the gRNA.

[0055] The biomaterial is selected from any one of the following:

[0056] (1) A nucleic acid molecule encoding the gRNA;

[0057] (2) An expression cassette containing the nucleic acid molecule described in (1);

[0058] (3) A recombinant vector containing the nucleic acid molecule described in (1) or the expression cassette described in (2);

[0059] (4) Recombinant cells containing the nucleic acid molecule described in (1), the expression cassette described in (2), or the recombinant vector described in (3).

[0060] In some implementations, nucleic acid molecules and nucleic acids are used interchangeably. Nucleic acid molecules refer to polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). As equivalents, the term also includes DNA or RNA analogs derived from nucleotide analogs and, where applicable, single-stranded (sense or antisense) and double-stranded polynucleotides. Isolated nucleic acid molecules refer to nucleic acid molecules that are identified and separated from / from at least one contaminating nucleic acid molecule normally associated with the natural source of that nucleic acid. Isolated nucleic acid molecules differ in form and context from when they are found in nature. Therefore, isolated nucleic acid molecules are distinct from nucleic acid molecules present in natural cells. However, isolated nucleic acid molecules include nucleic acid molecules contained in cells that normally express the encoded protein, wherein, for example, the nucleic acid molecule is located at a chromosomal location different from that of the natural cell.

[0061] In some embodiments, the expression cassette refers to DNA capable of expressing the gRNA in a host cell, which may include not only a promoter that initiates transcription of the coding gene of the gRNA, but also a terminator that terminates transcription of the coding gene.

[0062] The expression box may also include an enhancer sequence.

[0063] In some implementations, nucleic acid molecules or expression cassettes can be integrated into recombinant vectors, a broad term encompassing any specific DNA segment designed to move from a carrier into target DNA. Recombinant vectors, also known as expression vectors or vector systems, are a set of components required to induce DNA insertion into the genome or other targeted DNA sequences (such as episomes, plasmids, or even viral / phage DNA segments). Vector systems used for gene delivery in animals (such as viral vectors (e.g., retroviruses, adeno-associated viruses, and integrative phages) and non-viral vectors (e.g., transposons)) have two basic components: 1) a vector composed of DNA (or RNA, which is reverse transcribed into cDNA), and 2) a transposase, recombinase, or other integrase that recognizes both the vector and the target DNA sequence and inserts the vector into the target DNA sequence. Vectors most commonly contain one or more expression cassettes containing one or more expression control sequences, which are DNA sequences that respectively control and regulate the transcription and / or translation of another DNA sequence or mRNA.

[0064] Many different types of recombinant vectors are known. For example, plasmids and viral vectors (such as retroviral vectors) are known. Mammalian expression plasmids typically have an origin of replication, a suitable promoter and optional enhancer, as well as any necessary ribosome binding site, polyadenylation site, splicing donor and acceptor sites, transcription termination sequence, and 5' flanking non-transcriptional sequences. Examples of vectors include: plasmids (which can also be carriers of other types of vectors), adenoviruses, adeno-associated viruses (AAVs), lentiviruses (e.g., modified HIV-1, SIV, or FIV), retroviruses (e.g., ASV, ALV, or MoMLV), and transposons (e.g., Sleeping Beauty, P-element, Tol-2, Frog Prince, piggyBac).

[0065] In some embodiments, the recombinant cells are transgenic non-human animal cell lines, including but not limited to transgenic non-human oocytes, sperm cells, blastocysts, embryos, fetuses, donor cells, or cell nuclei. In other embodiments, the transgenic animal cell lines include primordial germ cells, kidney cells such as PK-15 cells, pancreatic islet cells, beta cells, hepatocytes, or fibroblasts.

[0066] This invention provides a method for constructing an animal model of lupus erythematosus, the method specifically comprising:

[0067] (1) Introduce gRNA, Cas9 mRNA and donor vector into recipient cells to obtain F0 generation animals;

[0068] (2) Positive F0 generation animals were mated with wild-type animals to obtain homozygous Mtch2.fl / fl animal;

[0069] (3) Mtch2 fl / fl Animals were hybridized with Cre animals and drugs were introduced to obtain a lupus animal model.

[0070] In some implementations, the methods of introduction include, but are not limited to, microinjection, ultrasound-mediated methods, electroporation, acoustic perforation, optical perforation, magnetic transfer, thermal shock, calcium phosphate methods, liposome and polymer methods, nanoparticle methods, and viral transformation methods.

[0071] In a specific implementation, the delivery method is microinjection.

[0072] In some embodiments, the animal is selected from mammals.

[0073] In some embodiments, the mammal is a non-human mammal. The non-human mammal includes primates (such as rhesus monkeys, stump-tailed macaques, cynomolgus monkeys, etc.), rodents (such as mice, rats, hamsters, etc.), and rabbits (such as domestic rabbits, New Zealand rabbits).

[0074] In a preferred embodiment, the non-human mammal is selected from rodents.

[0075] In a specific implementation, the rodent is selected from mice.

[0076] In some embodiments, the drug described in (3) is a lupus inducing agent. Lupus inducing agents include, but are not limited to, one or more of pristane, imiquimod, peptides, lipopolysaccharides, Campylobacter jejuni, Freund's complete adjuvant, and active chromatin of lymphocytes.

[0077] In a specific implementation, the lupus-inducing drug is selected from Pristane or Imiquimod.

[0078] The method also includes using a gene knockout activator to maintain the gene knockout state.

[0079] In some embodiments, the gene knockout activator includes tamoxifen or 4-hydroxytamoxifen.

[0080] In a specific implementation, the gene knockout activator is selected from tamoxifen.

[0081] This invention provides the application of the lupus animal model constructed by the above method in screening drugs for the treatment / prevention of lupus or in the study of the disease mechanism / target of lupus.

[0082] In some embodiments, prevention and / or treatment include prevention and treatment, wherein prevention refers to completely or partially preventing or suppressing symptoms of the disease or the frequency of such symptoms, or reducing the risk of acquiring a given symptom of the disease. In embodiments of this application, the disease is lupus. Prevention includes suppressing and / or preventing lupus-related symptoms, reducing the severity of lupus-related symptoms, or improving signs and symptoms associated with lupus. Prevention includes suppressing, preventing, or reducing the severity of lupus-related symptoms, the term including such effects occurring before a patient begins to develop lupus or related conditions, i.e., delaying the onset of lupus-related symptoms, and / or suppressing or reducing the severity of lupus-related symptoms; treatment refers to reducing or eliminating the severity of lupus symptoms, the frequency of such symptoms, or both, the term including such effects occurring when a patient has lupus or related conditions, i.e., reducing the severity of one or more symptoms or effects of lupus-related symptoms.

[0083] In some implementations, the specific methods for screening candidate drugs for the treatment / prevention of lupus include: (1) applying the drug to be tested to a lupus model prepared by the above method; (2) detecting whether there are changes in lupus-related abnormal symptoms in the lupus model after the application of the drug to be tested; and (3) when the drug to be tested improves the symptoms of lupus / has a therapeutic effect, the drug to be tested is identified as a candidate drug that can treat / prevent lupus.

[0084] In some embodiments, the test drug may be a low-molecular-weight compound, a protein (e.g., an antibody), DNA, RNA, low-molecular-weight interfering RNA, or an antisense oligonucleotide. The test drug may, for example, be an agent used to treat diseases other than neutropenia. The test drug may, for example, be a mixture of one or more substances. Preferably, the test drug is a single substance.

[0085] The invention is further illustrated below with reference to specific embodiments. It should be understood that the specific embodiments described herein are by way of example and are not intended to limit the invention. The main features of the invention can be used in various embodiments without departing from the scope of the invention.

[0086] Example

[0087] 1. Experimental materials

[0088] (1) Tamoxifen (Sigma: T5648), Pristane (Sigma: P2870), Imiquimod (Aldara), and sunflower oil (Sigma). Tamoxifen preparation method: Dissolve 200 mg of tamoxifen powder in 400 μL of anhydrous ethanol and 19.6 mL of sunflower oil, protect from light at 37°C, and shake in a shaker at 220 rpm for 3 h. During this period, take out the solution every 30 min and vortex for 30 s. After the powder is completely dissolved, dispense into containers and store at -20°C.

[0089] (2) Red blood cell lysis buffer: Dilute 10×BD Pharm Lyse (555899) with ultrapure water to 1× and store at 4℃.

[0090] Trizma Hydrochloride Solution (Sigma, Cat. No. T2663); Proteinase K (Merck, Cat. No. MK539480); 2×Taq Master Mix (Dye Plus) (Vazyme, P222-C2); Agarose (BIOWESTAGAROSE, REGULAR); DNA Marker (Thermo Scientific GeneRuler 100bp DNA Ladder #SM0242).

[0091] (3) Flow cytometry antibodies: Anti-mouse CD45R / B220-FITC, Anti-mouse CD45R / B220-APC-cy7, Anti-mouse Fas-PE, Anti-mouse GL-7-Percp5.5, Anti-mouse CD138-PE, Anti-mouse IgG1-APC, Anti-mouse CD19-APC-cy7, Annexin V-PE, 7-AAD-Percp5.5 (Biolegend and BD); DCFH-DA-FITC (Thermo Fisher), MitoRed-PE (Thermo Fisher), TMRM-PE (Thermo Fisher).

[0092] (4) Agilent Technologies Seahorse XFe24 reagents and consumables: Seahorse XFe24 / XF Pro FluxPakMini, Seahorse XF Cell Mitochondrial Stress Test Kit, XF DMEM Medium, pH 7.4, 500mL, XF 1.0M mglucose Solution, 50mL, XF 100mM Pyruvate Solution, 50mL, XF 200mM Glutamine Solution, 50mL. Store at -20℃.

[0093] 2. Experimental Methods

[0094] All experiments were conducted in accordance with the regulations for the management of laboratory animals and were approved by the ethics committee (Animal Ethics No.: IOZ-IACUC-2024-280).

[0095] (1)Mtch2 fl / fl CAGG Cre / + Acquisition and rearing of gene knockout animals:

[0096] ① Design and validation of gRNA targeting the MTCH2 gene: The genomic sequence (Gene ID: 56428) and transcript (NM_019758.3) of the MTCH2 gene were obtained from the NCBI or Ensembl database. Using CRISPR Cas9 technology, loxP sites were inserted upstream of exon 6 and downstream of exon 7 of the mitochondrial vector homology 2 (MTCH2) gene in C57BL / 6 background mice. Guide RNA (gRNA) targeting MTCH2 was designed using online tools (such as CRISPR Design Tool, CHOPCHOP). The specific gRNA targeting sequences are shown in Table 1.

[0097] Table 1 gRNA Target Sequences

[0098]

[0099]

[0100] ② Microinjection and embryo transfer: C57BL / 6J female mice (superovulated) were mated with C57BL / 6J male mice, and fertilized eggs (pronuclear stage) were collected. First, a gene knockout system was designed using homologous recombination technology, i.e., designing homologous arms in a vector to guide recombination with the target region in the genome, inserting into the loxP site. The DNA sequence of the target gene MTCH2 was obtained from the NCBI genome database (see above), and exons 6-7 were identified as the region to be knocked out (see above). Figure 4 and Figure 55' and 3' homologous arms were designed 1-3 kb upstream and downstream of the target region, and loxp sites were inserted into them; the loxp sequence is ATAACTTCGTATAGCATACATTATACGAAGTTAT (SEQ ID NO:21). Multiple cloning sites (MCS) were designed in the plasmid, and the loxP site was inserted via restriction endonuclease. The loxP sequence was directly introduced during homologous arm synthesis via overlap extension PCR. Cas9 mRNA (100 ng / μL), the donor vector containing the loxP site, and gRNA (50 ng / μL each) were mixed and added to microinjection buffer. The mixture was injected into the pronucleus of fertilized eggs, and the embryos were cultured to the 2-cell stage. Viable embryos were transferred to the oviducts of pseudopregnant mice (ICR or C57BL / 6 background), with 10-15 embryos transferred from each oviduct to obtain F0 generation mice.

[0101] ③ Filter Mtch2 fl / fl Parental Mice 1: First, F0 generation mice were identified. Positive F0 generation mice were screened using PCR and sequencing analysis. These were then mated with wild-type mice to verify germline transmission and generate the F1 generation. Specifically, genomic DNA was extracted from the tails of F0 generation mice at 3 weeks of age. Primers were designed to amplify the region surrounding the gRNA target site (approximately 500-800 bp). The PCR products were directly Sanger sequenced to analyze insertion / deletion mutations. Mice carrying frameshift mutations (Exon 6 / 7 biallelic knockout) were selected and backcrossed with wild-type C57BL / 6 mice to obtain F1 generation heterozygotes (Mtch2). fl / + F1 generation heterozygous mice were mated to obtain homozygous Mtch2 mice. fl / fl Parental mice 1. Heterozygous and homozygous loxp mice were viable and fertile. The validated mice were backcrossed with C57BL / 6J mice for at least 5 generations to ensure a pure genetic background and establish a stable strain for preservation and propagation. The primers for identifying the F1 generation mice are shown in Tables 2 and 3.

[0102] Table 2 Primers for PCR identification of F1 mice

[0103]

[0104] Table 3. Southern blot primers for F1 mice

[0105]

[0106]

[0107] ④Use CAGGCre-ER TM Mice (JAX:004453) were used as parent mice 2 (C57BL / 6 background mice) to carry out Mtch2 fl / flParental mouse 1 and CAGGCre-ER TM Mice were mated to obtain the FN generation. Homozygous Cre+ mice were mated with homozygous mice to establish a stable genetic line. Homozygotes were identified by PCR amplification, DNA gel electrophoresis, and sequencing, and primers were designed to detect possible off-target sites. To verify that the target gene MTCH2 was indeed knocked out in mice, liver or spleen tissues were collected from mice, and qPCR was used to verify the transcriptional level and Western blot was used to detect the absence of MTCH2 protein expression.

[0108] ⑤ After crossing parent mouse 1 and parent mouse 2, the heterozygous Mtch2 was obtained. fl / fl Mice and Mtch2 containing the Cre gene fl / fl CAGG Cre / + In mice, the gene knockout mice are viable and fertile. They exhibit a more severe lupus phenotype after Pristane induction, which can be used to investigate the role of mitochondrial dysfunction in the pathogenesis of SLE.

[0109] (2)Mtch2 fl / fl CAGG Cre / + Genotyping of gene knockout animals:

[0110] ①Mtch2 fl / fl CAGG Cre / + The primer sequences for mouse genotyping are shown in Table 4.

[0111] Table 4 Mtch2 fl / fl CAGG Cre / + Mouse genotype identification primers

[0112]

[0113] ② Extraction of rat tail DNA (kit column extraction method):

[0114] First, add 2-5 mm of mouse tail tissue to a 1.5 ml centrifuge tube, followed by 180 μL of Buffer GL, 20 μL of Proteinase K, and 10 μL of RNase A (Note: Do not add too much mouse tail tissue). Incubate overnight at 56°C to lyse the tissue. The next day, remove the tube and centrifuge at 12,000 rpm for 2 minutes, discarding the precipitate. Add 200 μL of Buffer GB and 200 μL of anhydrous ethanol, mixing thoroughly to ensure adequate DNA binding. Transfer the mixture to an adsorption column (placed in a collection tube), centrifuge at 12,000 rpm for 2 minutes, and discard the waste liquid. Next, perform two washes. First, add 500 μL of Buffer WA, centrifuge at 12,000 rpm for 1 minute, and discard the waste liquid. Then, add 700 μL of Buffer WB (premixed with anhydrous ethanol before use), adding it along the tube wall to remove residual salts, centrifuge at 12,000 rpm for 1 minute, and discard the waste liquid. Repeat this step once. Place the adsorption column (in the collection tube) and centrifuge at 12,000 rpm for 2 minutes to completely discard the waste liquid. Finally, transfer the adsorption column to a new 1.5 mL centrifuge tube and add 50–200 μL of sterile water or elution buffer to the center of the membrane. Let it stand for 5 minutes (preheating the elution buffer to 65°C can improve the yield). Centrifuge at 12,000 rpm for 2 minutes to collect the DNA. To increase the yield, the elution liquid can be added back to the adsorption column and the elution steps repeated.

[0115] ③ Set up the PCR amplification system, conditions and procedures. The PCR amplification system is shown in Table 5, the PCR amplification conditions are shown in Table 6, and the names and manufacturers of the PCR amplification reagents are shown in Table 7.

[0116] Table 5 PCR amplification system

[0117] Component ×1 <![CDATA[ddH2O]]> 9.0μL Product primer F 1.0μL Product primer R 1.0μL Premix Taq 12.5μL DNA 1.5μL Total 25μL

[0118] Table 6 PCR Amplification Conditions

[0119]

[0120]

[0121] Table 7. PCR Amplification Reagent Names and Manufacturers

[0122]

[0123] (3) Mtch2 fl / fl Mb1 Cre / + Acquisition and rearing of gene knockout animals:

[0124] ① Mtch2 constructed using (1) fl / fl Parent mouse 1;

[0125] ② Using Mb1-iCre mice as parent mice (product number: C001552, Cyagen Biosciences), Cre recombinase was significantly expressed in B lymphocytes. This model can be used for tissue-specific studies targeting B lymphocytes, and its expression specificity is good. When Mb1-iCre mice were crossed with mice containing loxP sites, sequence recombination between loxP sites mediated by Cre recombinase occurred in the B lymphocytes of their offspring mice, resulting in specific gene knockout in B cells.

[0126] ③ The parent mouse 1 homozygous Mtch2 fl / fl The Mtch2 was obtained by crossing the parent mouse homozygous Mb1-iCre with the parent mouse. fl / fl Mb1 Cre / + Mice were used to establish stable genetic strains. These gene knockout mice were viable and fertile. Following Pristane induction, they exhibited a more severe lupus phenotype, which was used to investigate the role of mitochondrial dysfunction in the pathogenesis of SLE.

[0127] (4) Mtch2 fl / fl Mb1 Cre / + Genotyping of gene knockout animals:

[0128] ①Mtch2 fl / fl Mb1 Cre / + The primer sequences for mouse genotyping are shown in Table 8.

[0129] Table 8 Mtch2 fl / fl Mb1 Cre / + Mouse genotype identification sequence

[0130]

[0131] ② Extraction of rat tail DNA (kit column extraction method):

[0132] First, add 2-5 mm of mouse tail tissue to a 1.5 ml centrifuge tube, followed by 180 μL of Buffer GL, 20 μL of proteinase K, and 10 μL of LNase A (Note: Do not add too much mouse tail tissue). Incubate overnight at 56°C to lyse the tissue. The next day, remove the tube and centrifuge at 12,000 rpm for 2 minutes, discarding the precipitate. Add 200 μL of Buffer GB and 200 μL of anhydrous ethanol, mixing thoroughly to ensure adequate DNA binding. Transfer the mixture to an adsorption column (placed in a collection tube), centrifuge at 12,000 rpm for 2 minutes, and discard the waste liquid. Next, perform two washes. First, add 500 μL of Buffer WA, centrifuge at 12,000 rpm for 1 minute, and discard the waste liquid. Then, add 700 μL of Buffer WB (premixed with anhydrous ethanol before use) along the tube wall to remove residual salts, centrifuge at 12,000 rpm for 1 minute, and discard the waste liquid. Repeat this step once. Place the adsorption column (in the collection tube) and centrifuge at 12,000 rpm for 2 minutes to completely discard the waste liquid. Finally, transfer the adsorption column to a new 1.5 mL centrifuge tube and add 50–200 μL of sterile water or elution buffer to the center of the membrane. Let it stand for 5 minutes (preheating the elution buffer to 65°C can improve the yield). Centrifuge at 12,000 rpm for 2 minutes to collect the DNA. To increase the yield, the elution liquid can be added back to the adsorption column and the elution steps repeated.

[0133] ③ Set up PCR amplification conditions and procedures: Same as Table 5 PCR amplification system; same as Table 6 PCR amplification conditions; same as Table 7 PCR amplification reagent names and manufacturers.

[0134] (5) Construct Mtch2 fl / fl CAGG Cre / + Lupus model and phenotypic identification in gene knockout animals:

[0135] ① Constructing Pristane-induced Mtch2 fl / fl CAGG Cre / + To establish a lupus animal model and validate its phenotype, the first step is to develop a control group (Mtch2). fl / fl and knockout group Mtch2 fl / fl CAGG Cre / + Animals were intraperitoneally injected with tamoxifen (Sigma: T5648) at a dose of 0.8 mg / day for one week starting 5 weeks after birth, in 200 μL via intraperitoneal injection. After a one-week rest period, the injection was repeated weekly to maintain the gene knockout state. Pristane was used to induce a lupus-like phenotype in mice via intraperitoneal injection at a dose of 0.5 ml (Sigma: P2870) administered at 8-10 weeks of age. This method was a single-injection modeling approach.

[0136] From the first month of establishing the lupus model, tamoxifen was administered intraperitoneally once a week to maintain the gene knockout state. The dosage was 0.8 mg / kg mice, with 200 μL injected intraperitoneally. Urine (approximately 20 μL) and peripheral blood (approximately 200 μL each time) were collected monthly to prepare serum for detecting autoantibodies. Blood was drawn from the orbital rim after isoflurane anesthesia to minimize harm to the animals. Animals were typically removed for further experiments after six months of lupus model establishment. Starting in the third month of lupus model establishment, animals may develop varying degrees of ascites and skin lesions, which are clinical phenotypes observed in lupus animal models and SLE patients (skin lesions). Generally, animal experiments were conducted after six months of lupus model establishment.

[0137] ② Constructing Imiquimod-induced Mtch2 fl / fl CAGG Cre / + To establish a lupus animal model and validate its phenotype, the first step is to develop a control group (Mtch2). fl / fl and knockout group Mtch2 fl / fl CAGG Cre / + Animals were intraperitoneally injected with tamoxifen (sigma: T5648) at a dose of 0.8 mg / day for one week starting 5 weeks after birth, 200 μL intraperitoneally. After a one-week rest period, the injection was repeated weekly to maintain the gene knockout state. The Imiquimod model was established by applying Imiquimod (1.25 mg of 5% IMQ cream per mouse) to the skin on the back of the right ear of mice at 6-8 weeks of age, once every 3 days for 8 weeks (with supplemental ultraviolet irradiation for 30 minutes each time starting in week 6).

[0138] From the first month of establishing the lupus model, tamoxifen was administered intraperitoneally once a week to maintain the gene knockout state. The dosage was 0.8 mg / kg mice, with 200 μL injected intraperitoneally. Urine (approximately 20 μL) and peripheral blood (approximately 200 μL each time) were collected monthly to prepare serum for detecting autoantibodies. Blood was drawn from the orbital rim after isoflurane anesthesia to minimize harm to the animals. Animals were typically removed for further experiments after six months of lupus model establishment. Starting in the third month of lupus model establishment, animals may develop varying degrees of ascites and skin lesions, which are clinical phenotypes observed in lupus animal models and SLE patients (skin lesions). Generally, animal experiments were conducted after six months of lupus model establishment.

[0139] (6) Construct Mtch2 fl / fl Mb1 Cre / + Lupus model and phenotypic identification in gene knockout animals:

[0140] ① Constructing Pristane-induced Mtch2 fl / fl Mb1 Cre / +Lupus animal model and validation of its phenotype: Intraperitoneal injection of Pristane was used to treat the control group Mtch2. fl / fl and knockout group Mtch2 fl / fl Mb1 Cre / + To further induce a lupus-like phenotype in mice, a single injection of 0.5 ml (Sigma: P2870) was administered at 8-10 weeks of age. Starting from the first month of lupus model establishment, approximately 20 μL of urine and 200 μL of peripheral blood were collected monthly to prepare serum for autoantibody detection. Blood was drawn from the orbital rim after isoflurane anesthesia to minimize harm to the animals. Animals were typically removed for further experiments after 6 months of lupus model establishment. Starting in the third month of lupus model establishment, animals may develop varying degrees of ascites and skin lesions, a clinical phenotype observed in both lupus animal models and SLE patients (skin lesions). Generally, animal experiments were conducted after 6 months of lupus model establishment.

[0141] ②Utilize H2-Ab1 bm12 Animal spleen cells / CD4 + T cells adopted into Mtch2 fl / fl Mb1 Cre / + Establishing a lupus GVHD model in knockout animals and validating its phenotype: Due to differences in modeling time and principles, in addition to using Pristane-induced lupus mice, this rapid GVHD modeling method was also used. First, spleens from BM12 mice were harvested under sterile conditions and placed in culture dishes containing PBS. The spleen tissue was ground using a syringe plunger, filtered through a 70 μm cell sieve, and collected by centrifugation (300 × g, 5 min). Red blood cell lysis buffer (e.g., ACK buffer) was added, and after incubation at room temperature for 2 min, the cells were washed by centrifugation and analyzed using CD4+. + T-cell sorting kit (CD4) + T-cell sorting magnetic beads (STEMCELL, Catalog #19852), negative sorting was performed according to the instructions to obtain CD4+ with a purity >90%. + T cells, 5 × 10⁶ adopted 6 One recipient mouse was used to construct a GVHD model. Urine (approximately 20 μL) and peripheral blood (approximately 200 μL each time) were collected weekly to prepare serum for autoantibody detection. Blood was drawn from the orbital cavity after isoflurane anesthesia to minimize harm to the animals.

[0142] (7)Mtch2 fl / fl CAGG Cre / + and Mtch2 fl / fl Mb1 Cre / + Other phenotypic and mitochondrial function assays in several lupus models from gene knockout animals:

[0143] ① Measure the size and weight of the spleen and mesenteric lymph nodes, detect the protein content in urine using ELISA, and determine the pathological changes in the kidneys by HE staining;

[0144] ② Use flow cytometry to detect changes in the proportion of various immune cell subtypes, especially the proportion of germinal center B cells / plasma cells / plasma blasts / memory B cells;

[0145] ③ ELISA was used to detect anti-dsDNA antibodies and ANA antibodies in serum, and immunofluorescence was used to detect changes in IgG and IgM.

[0146] Enzyme-linked immunosorbent assay (ELISA): Mouse serum was diluted 1:100 with assay buffer to detect anti-dsDNA antibodies, and then...

[0147] 1000 dilutions were used to detect urinary protein. Measurements were performed using the Mouse Anti-dsDNA IgG ELISA Kit (5120, Alpha Diagnostic), Mouse ANA IgG ELISA Kit (5210, Alpha Diagnostic), and Urinary Albumin ELISA Kit (E99-134, FRTIS) according to the manufacturer's instructions.

[0148] Immunohistochemistry: Kidneys were obtained from mice, fixed in 4% paraformaldehyde, embedded in paraffin, and stained with hematoxylin and eosin (H&E), or IgG and IgM. Results showed that the MTCH2 knockout group exhibited a more severe lupus phenotype.

[0149] 3. Experimental Results

[0150] Figure 1 A shows that, in the GSE148601 public database dataset, SLE patients showed decreased MTCH2 gene expression in B cells compared to healthy individuals (HCs), and the decrease was particularly pronounced in B cells of lupus patients compared to other immune cells. Figure 1 B represents the expression of MTCH2 in SLE patients with different disease activities. It can be seen that as the severity of the disease increases, MTCH2 is significantly reduced in various B cell subsets. Figure 1 C represents the change in MTCH2 protein levels in B cells. It can be seen that compared to healthy individuals (HCs), the MTCH2 content in B cells of lupus patients is significantly lower. This indicates that MTCH2 is highly correlated with disease activity in lupus patients and is an important regulatory molecule in the pathogenesis of lupus.

[0151] F1 mice 4, 5, 7, and 9 were identified as positive by PCR screening and Southern blot analysis. Figure 2 , Figure 3 ).

[0152] Figure 4 Gene targeting for conditional knockout mice of the MTCH2 gene, and Mtch2 fl / fl CAGG Cre / + A schematic diagram of the mouse hybridization process and systemic conditional knockout.

[0153] Figure 5 Gene targeting for conditional knockout mice of the MTCH2 gene, and Mtch2 fl / fl Mb1 Cre / + A schematic diagram of B cell-specific knockout during mouse hybridization.

[0154] Figure 6 A is Mtch2 fl / fl Mb1 Cre / + Mouse genotype identification diagram, Figure 6 B is Mtch2 fl / fl CAGG Cre / + The mouse genotype identification diagram uses agarose gel electrophoresis to detect the PCR amplification products of offspring tail DNA, which is used to identify different genotypes of wild-type, heterozygous, and homozygous offspring.

[0155] Figure 7 Conditional knockout of Mtch2 throughout the body fl / fl CAGG Cre / + Mice and their control Mtch2 fl / fl Phenotypic comparison of mice after Pristane-induced lupus. Blood was collected from the eyes of mice 6 months after Pristane stimulation, and serum was extracted. The levels of anti-autologous double-stranded DNA antibodies and serum ANA antibodies were detected by ELISA. Changes in urinary albumin levels were also compared. IgM / IgG deposition in the kidneys was detected by immunofluorescence assay. It can be seen that the knockout group Mtch2... fl / fl CAGG Cre / + The mice exhibited higher levels of autoantibodies, higher levels of urinary protein, a higher proportion of germinal centers, and a greater degree of immune complex deposition, indicating that the lupus-induced phenotype was more pronounced in the MTCH2 knockout mice, suggesting that this gene influences the occurrence and development of lupus.

[0156] Figure 8 Knockout of Mtch2 specifically for B cells fl / fl Mb1 Cre / + Mice and their control Mtch2 fl / flPhenotypic comparison of mice after Pristane-induced lupus. Blood was collected from the eyeballs of mice 6 months after Pristane stimulation, and serum was extracted. The levels of anti-autologous double-stranded DNA antibodies and serum ANA antibodies were detected by ELISA. Changes in urinary albumin levels were also compared. Flow cytometry was used to detect IgG1 expression, germinal center ratio, and MHCII molecule expression levels in spleen antibody-secreting cells (ASCs). It can be seen that the knockout group Mtch2... fl / fl Mb1 Cre / + The mice exhibited higher levels of autoantibodies, higher urinary protein, a higher proportion of IgG1+ cells and germinal centers, and higher levels of MHCII molecule expression, indicating that the MTCH2 mice were specifically knocked out on B cells. fl / fl Mb1 Cre / + The lupus-induced phenotype was more pronounced in those cells, and specific knockout of this gene on B cells affected the occurrence and development of lupus.

[0157] Figure 9 Compared to HC patients, SLE patients showed a significantly increased production of ROS in B cells and mitochondrial ROS (mROS), indicating that SLE patients experience mitochondrial-dependent oxidative stress in B cells. Figure 9 Pristane-induced Mtch2 in B fl / fl CAGG Cre / + Lupus mouse spleen B cells compared to control group Mtch2 fl / fl Mice produced higher levels of mROS and decreased mitochondrial membrane potential difference (TMRM), indicating that mitochondria in B cells of the MTCH2 knockout group underwent depolarization and apoptosis. Further analysis... Figure 9 C detected Pristane-induced Mtch2 fl / fl Mb1 Cre / + Lupus mice compared to control group Mtch2 fl / fl The proportion of apoptotic B cells in the spleen of mice was increased. Figure 9 D examined the mitochondrial morphology of B cells from these four groups of animals using electron microscopy. The results showed that regardless of whether MTCH2 was knocked out systemically or specifically on B cells, mitochondria fused, resulting in elongated and slightly swollen morphology. Literature review concluded that when cells experience oxidative stress or a surge in energy demand, mitochondria actively fuse to meet greater energy needs and avoid oxidative stress damage. Finally, the Seahorse assay confirmed a significant increase in oxidative phosphorylation in B cells after MTCH2 knockout, indicating that both systemic and B-cell-specific MTCH2 knockout lead to abnormal mitochondrial function in B cells, including oxidative stress imbalance (increased ROS and mROS), increased apoptosis, increased mitochondrial fusion, and increased mitochondrial stress.

[0158] This application successfully constructed a mouse model of lupus erythematosus and used the model to verify that MTCH2 is an important regulator affecting the mitochondrial function of B cells in SLE patients. Its decrease or absence in B cells leads to abnormal mitochondrial function of B cells, which in turn leads to oxidative stress in B cells, making them prone to apoptosis and activation. Under the condition of mitochondrial fusion, more energy is generated to drive B cells to produce more autoantibodies, thereby aggravating the disease progression of lupus.

[0159] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. A method for constructing a mouse model of lupus erythematosus, characterized by, The method includes constructing a mouse model of lupus erythematosus by knocking out the MTCH2 gene; The knockout refers to the removal of the MTCH2 gene using CRISPR Cas9 technology; The method specifically includes: (1) gRNA, Cas9 mRNA and donor vector containing loxp site were introduced into fertilized eggs to obtain F0 generation mice; (2) Positive F0 mice are mated with wild type mice to obtain homozygous Mtch2 fl / fl mice; (3) Mtch2 fl / fl Mice were crossed with Cre mice and introduced into a lupus-inducing drug to obtain a lupus mouse model; Alternatively, step (3) may specifically include: adopting spleen cells / CD4+ T cells from BM12 mice into Mtch2 mice. fl / fl A mouse model of lupus erythematosus was established using mice obtained by crossing mice with Cre mice. The gRNA is shown in any one of SEQ ID NO:1-4; The Cre mice include CAGGCre-ER mice and / or Mb1-iCre mice; The lupus-inducing drug is selected from Pristane or Imiquimod.

2. The method of claim 1, wherein, The method of introduction described in (1) is microinjection.

3. The method of claim 1, wherein, The method also includes using a gene knockout activator to maintain the gene knockout state.

4. The method of claim 3, wherein, The gene knockout activator is selected from tamoxifen.

5. The use of gRNA or products containing said gRNA in the construction of lupus erythematosus models. The sequence of the gRNA is shown in any one of SEQ ID NO:1-4. The method described in any one of claims 1-4 is used to construct a lupus model.

6. Use according to claim 5, characterized in that, The product is selected from any of the following: (1) An expression cassette containing the gRNA; (2) A recombinant vector containing the gRNA or (1) the expression cassette; (3) Recombinant cells containing the gRNA or (1) the expression cassette or (2) the recombinant vector.

7. Use according to claim 5, characterized in that, The product includes a reagent kit.

8. Use according to claim 7, characterized in that, The kit also includes Cas9 mRNA.

9. Use according to claim 7, characterized in that, The kit also includes a donor vector.

10. The use of the lupus mouse model constructed by the method of any one of claims 1-4 in screening drugs for the treatment / prevention of lupus or in the study of the disease mechanism / target of lupus.

11. A method of screening a candidate drug for the treatment / prevention of lupus erythematosus, characterized by, The method includes administering the test drug to a mouse model of lupus erythematosus constructed by the method of any one of claims 1-4, and selecting the test drug that can improve lupus erythematosus symptoms.

Citation Information

Patent Citations

  • Preparation method and application of autoreactive animal model

    CN120519516A