BCAT2 gene, BCAT2 inhibitor and application

Abstract

The invention discloses a BCAT2 gene, a BCAT2 inhibitor and application, belongs to biomedical application, and provides application of the BCAT2 gene as a target spot in screening of drugs for preventing, relieving and / or treating diabetes-related diseases. The invention further provides application of the BCAT2 inhibitor in preparation or screening of drugs for preventing, relieving and / or treating diabetes-related diseases. It is found that by inhibiting expression of BCAT2, phenotype transdifferentiation of vascular smooth muscle cells can be remarkably inhibited, and then the progress of diabetes mellitus plaque internal calcification is inhibited, and by taking the gene as a target spot, innovative drugs for treating diabetes mellitus plaque internal calcification by aiming at the gene and related molecules thereof can be designed; it is further verified through experiments that after the BCAT2 inhibitor inhibits BCAT2 gene expression, the progress of diabetes related diseases can be effectively relieved, a new thought and prospect are provided for future drug development, and remarkable social value and market value are achieved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and particularly relates to a BCAT2 gene and a BCAT2 inhibitor and applications. Background Art

[0002] Vascular calcification associated with diabetes is a major cause of atherosclerotic plaque rupture, which can lead to acute cardiovascular and cerebrovascular accidents (acute myocardial infarction, stroke, etc.). However, the specific mechanisms of vascular calcification remain unclear, and effective clinical prevention and treatment options are still lacking. Therefore, it is crucial to study the occurrence, progression, and pathogenesis of vascular calcification and to identify effective prevention and treatment methods.

[0003] Branched-chain aminotransferases (BCATs) are key enzymes in the branched-chain amino acid (BCAA) catabolism pathway, reversibly breaking down BCAAs into branched-chain α-keto acids (BCKAs). BCATs catalyze the first step in the BCAA catabolism process and are primarily divided into two isoforms: BCAT1, which is primarily located in the cytoplasm, and BCAT2, which is primarily located in the mitochondria. Numerous studies have investigated BCAA1 and 2 inhibitors, including pyrazolopyrimidinone derivatives, benzimidazole compounds, and Pfizer. Furthermore, BAY-069, a compound obtained through high-throughput screening and optimization, exhibits high affinity, good cell permeability, and high cell activity. However, there are currently no reports on whether BCAT2 inhibitors, particularly BAY-069, can treat or ameliorate diabetic plaque calcification or other symptoms associated with diabetes. Summary of the Invention

[0004] The purpose of the present invention is to overcome some technical problems existing in the prior art and to provide a BCAT2 gene and a BCAT2 inhibitor and their application.

[0005] To achieve the above objectives, the present invention provides the following technical solutions:

[0006] The present invention first provides the use of BCAT2 gene as a target in screening drugs for preventing, alleviating and / or treating diabetes-related diseases.

[0007] Furthermore, the drug targets the BCAT2 gene and inhibits or silences the expression of BCAT2.

[0008] Furthermore, the related diseases include hyperglycemia, hyperlipidemia, fatty liver, diabetic nephropathy, retinopathy, diabetic atherosclerosis, diabetic plaques or calcification in diabetic plaques.

[0009] The present invention also provides a use of a BCAT2 inhibitor in the preparation or screening of drugs for preventing, alleviating and / or treating diabetes-related diseases.

[0010] Furthermore, the BCAT2 inhibitor is BAY-069.

[0011] Furthermore, the diabetes-related diseases are BCAT2-mediated diabetes-related diseases; the related diseases include hyperglycemia, hyperlipidemia, fatty liver, diabetic nephropathy, retinopathy, diabetic atherosclerosis, diabetic plaques or calcification in diabetic plaques.

[0012] The present invention also provides a drug for preventing, alleviating and / or treating diabetes-related diseases, wherein the drug or the active ingredient of the drug comprises a BCAT2 inhibitor.

[0013] Furthermore, the BCAT2 inhibitor is BAY-069.

[0014] Furthermore, the diabetes-related diseases are BCAT2-mediated diabetes-related diseases; the related diseases include hyperglycemia, hyperlipidemia, fatty liver, diabetic nephropathy, retinopathy, diabetic atherosclerosis, diabetic plaques or calcification in diabetic plaques.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] (1) The present invention proposes for the first time that BCAT2 can be used as a target gene for diabetes-related diseases, for the diagnosis and / or treatment of diabetic nephropathy, retinopathy, atherosclerosis, and calcification in atherosclerotic plaques. The present invention has experimentally demonstrated that inhibiting the expression of BCAT2 can significantly inhibit the phenotypic transdifferentiation of vascular smooth muscle cells and thus inhibit the progression of calcification in diabetic plaques. By targeting this gene, innovative drugs targeting this gene and its related molecules for the treatment of calcification in diabetic plaques can be designed.

[0017] (2) The present invention discovered through molecular docking analysis that BAY-069 can form hydrogen bonds with amino acids within the BCAT2 binding site, including ARG-143, THR-240, and TYR-141. The present invention demonstrated through experiments that, compared with the control group, blood lipid levels in the aorta of mice supplemented with BAY-069 were suppressed, and BAY-069 intervention alleviated HFD-induced fatty liver, diabetes-induced kidney and retinopathy. Compared with the control group, the entire aortic plaque of mice supplemented with BAY-069 was significantly reduced, the plaque lesion area and lipid deposition in the aortic root were significantly reduced, and osteogenic reprogramming in the aorta was significantly reduced. The calcium content and ALP activity levels in the aortic tissue of mice supplemented with BAY-069 were lower than those in the control group. Animal and cell experiments have confirmed that BAY-069 can inhibit the expression and activity of BCAT2, thereby inhibiting the formation of calcification in diabetic atherosclerotic plaques. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of BAY-069 inhibiting calcification in diabetic plaques.

[0019] Figure 2 After BAY-069 was injected into the tail vein, the diabetic ApoE - / - Mouse and non-diabetic ApoE - / - The results were affected by changes in body weight (A) and blood glucose (B) in mice. Sample size was n=6.

[0020] Figure 3 The results of Alizarin Red S staining (A) and Micro CT examination (B) of the whole mouse aorta in Example 1 are shown.

[0021] Figure 4 The mouse aortic arch tissue in Example 1 ( Figure 4 A), aortic root tissue ( Figure 4 B) H&E and Vonkossa staining results of sections, as well as relative quantitative analysis of the calcification area within the plaque (right panels of Figures A and B). Scale bar: 200 μm, n = 6, **P values ​​< 0.01.

[0022] Figure 5 Schematic diagram of the docking model of BAY-069 and BCAT2 in Example 2.

[0023] Figure 6 The ApoE levels of non-diabetic and diabetic patients after tail vein injection of BAY-069 were detected by qRT-PCR amplification and Western blot in Example 2. - / - BCAT2 gene expression in mouse aorta ( Figure 6 A) and protein expression levels ( Figure 6B), Figure 6 The left picture in B is the Western blot gel image result, and the right picture is the statistical calculation result of the relative expression level of protein expression.

[0024] Figure 7 The non-diabetic and diabetic ApoE were injected with BAY-069 in the tail vein in Example 2. - / - Results of BCAT enzyme activity detection in mouse aorta, sample size n=6; *P values<0.05, **P values<0.01, ***P values<0.001, ****P values<0.0001.

[0025] Figure 8 The effect of tail vein injection of BAY-069 on ApoE in non-diabetic and diabetic patients in Example 3 - / - Mouse serum triglycerides ( Figure 8 A) Cholesterol ( Figure 8 B), low-density lipoprotein ( Figure 8 C), high-density lipoprotein ( Figure 8 Effect results of D), n = 6, *P values ​​< 0.05, **P values ​​< 0.01, ****P values ​​< 0.0001, ns, not significant.

[0026] Figure 9 The non-diabetic and diabetic ApoE mice were injected with DMSO or BAY-069 (0.3 mg / kg) in the tail vein in Example 4. - / - H&E staining results of mouse liver, kidney, and retina tissue sections. In the figure, the scale bar for liver sections is 100 μm, and the scale bar for kidney and retina sections is 20 μm. Sample size n=6.

[0027] Figure 10 The non-diabetic and diabetic ApoE were injected with BAY-069 in the tail vein in Example 5. - / - In situ images of mouse aortic arch plaques (A), Oil Red O staining results of the entire mouse aorta and the area of ​​atherosclerotic lesions (B), H&E and Oil Red O staining results of the aortic root (C), and statistical results of lipid accumulation in the plaques. In the figures, the scale bar for H&E staining is 200 μm, and the scale bar for Oil Red O staining is 50 μm. Sample size n = 6.

[0028] Figure 11 Western blot analysis (A) and quantitative analysis (B) of Example 6 were used to detect the effects of tail vein injection of BAY-069 on ApoE expression in non-diabetic and diabetic patients. - / -Effects of the expression levels of α-SMA, SM22α, RUNX2, and BMP2 proteins in mouse aorta, sample size n=6.

[0029] Figure 12 The non-diabetic and diabetic ApoE were injected with BAY-069 in the tail vein in Example 6. - / - Alizarin red staining (A) and Micro CT results (B) of the whole mouse aorta.

[0030] Figure 13 The non-diabetic and diabetic ApoE were injected with BAY-069 in the tail vein in Example 6. - / - Mouse aorta calcium content ( Figure 13 A) and ALP activity detection ( Figure 13 B) Results.

[0031] Figure 14 The non-diabetic and diabetic ApoE were injected with BAY-069 in the tail vein in Example 6. - / - Mouse aortic arch tissue ( Figure 14 A), aortic root tissue ( Figure 14 B) Von Kossa staining results and quantitative statistical results, *P values ​​< 0.05. **P values ​​< 0.01. ***P values ​​< 0.001. ****P values ​​< 0.0001. ns, not significant.

[0032] Figure 15 The gelatin images are the results of Western blot detection of the expression levels of α-SMA, SM22α, RUNX2 and BMP2 proteins in Movas cultured in non-osteogenic medium (NM) and osteogenic medium (OM) after adding BAY-069 in Example 6 for 14 days.

[0033] Figure 16 These are the statistical results of the relative expression levels of α-SMA, SM22α, RUNX2, and BMP2 proteins detected by Western blot in Example 6 after adding BAY-069 to Movas cultured in non-osteogenic medium (NM) and osteogenic medium (OM) for 14 days.

[0034] Figure 17 The results of Alizarin Red S staining of Movas in Example 6 after 14 days of culture of NM and OM treated with BAY-069 ( Figure 17 A) and calcium content test results ( Figure 17B), sample size n=6; *P values<0.05, **P values<0.01, ***P values<0.001, ****P values<0.0001, ns, not significant. DETAILED DESCRIPTION

[0035] The technical solutions of the present invention are further described below through specific examples. It should be understood that the embodiments are preferred embodiments of the present invention and are intended to assist in understanding the technical content of the present invention, rather than to limit the scope of protection of the present invention. Without departing from the basic concept of the present invention, those skilled in the art may make various substitutions, equivalent improvements, or combined applications, all of which should be considered to fall within the scope of protection of the present invention.

[0036] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0037] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0038] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the present invention. The present description and examples are intended to be illustrative only.

[0039] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0040] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or are publicly available.

[0041] The DMEM culture medium involved in the examples was purchased from Vicente Biotechnology (Nanjing) Co., Ltd. with a product number of 319-005-CL. The osteogenic culture medium was DMEM culture medium supplemented with 2.5 mmol / L β-glycerophosphate and 50 μg / mL ascorbic acid.

[0042] High-fat feed was purchased from the Senbao Biological Products Center in Xuanwu District, Nanjing (high-fat feed contains 19% protein, 42% carbohydrates, and 24% fat).

[0043] The cell model and mouse model experimental methods involved in the embodiments of the present invention are as follows:

[0044] (1) Cell culture

[0045] Mouse aortic smooth muscle cells (Movas) were purchased from the American type culture collection (ATCC).

[0046] Movas incubated in DMEM supplemented with 10% FBS, 50 μg / mL ox-LDL, and 1% penicillin / streptomycin were designated as the normal medium (NM) group. Movas incubated in DMEM supplemented with 10% FBS, 50 μg / mL ox-LDL, 1% penicillin / streptomycin, 2.5 mmol / L β-glycerophosphate (Sigma, USA), and 50 μg / mL ascorbic acid (Solarbio, Beijing) were designated as the osteogenic medium (OM) group. Movas in the NM or OM groups were treated with 50 μM BAY-069 or DMSO on day 7 of culture. These cells were then cultured together for 14 days and designated as the BAY-069-treated NM group, the BAY-069-treated OM group, the DMSO-treated NM group, and the DMSO-treated OM group, respectively.

[0047] BAY-069: An inhibitor targeting BCAT gene expression, purchased from MedChemexpress Biotechnology Company in the United States.

[0048] (2) Animal experiments

[0049] ApoE - / - / BCAT2 ΔSMC Mouse Construction:

[0050] BCAT2 conditional knockout mice (ApoE - / - / BCAT2 fl / fl ) was constructed by Nanjing Jicui Yaokang Experimental Animal Co., Ltd., ApoE - / -Mice were purchased from Changzhou Cavens Company, Tagln Cre Mice were purchased from Nanjing Jicui Yaokang Experimental Animal Co., Ltd.

[0051] ApoE - / - / BCAT2 fl / fl The mouse construct is ApoE - / - In the mouse background, exon 4-exon 6 of the Bcat2-201 transcript (NCBI database accession number ENSMUST00000033098.16, the transcript contains 11 exons, the translation start site ATG is located in exon 1, and the translation termination site TGA is located in exon 11) was selected as the knockout region, and LoxP elements were inserted into intron 3-4 and intron 6-7; ApoE - / - / BCAT2 fl / fl In the absence of Cre recombinase, the BCAT2 gene can be expressed normally in mice.

[0052] ApoE - / - Mouse and Tagln Cre Mice acquire ApoE through mating - / - Tagln Cre Mice. Then ApoE - / - / BCAT2 fl / fl ApoE - / - Tagln Cre ApoE double knockout mice were obtained by hybridization of BCAT2 gene and ApoE double knockout mice. - / - / BCAT2 ΔSMC mouse.

[0053] Construction of calcification model in diabetic atherosclerotic plaques:

[0054] ApoE - / - / BCAT2 ΔSMC Mice (experimental group) and ApoE - / - / BCAT2 fl / fl Mice (control group) were intraperitoneally injected with streptozotocin (STZ, 40 mg / kg / day for 5 consecutive days, 200 μL per mouse each time) and then fed a high-fat diet for 24 weeks to establish a diabetic atherosclerotic plaque calcification model. Following this, the mouse aortas were harvested for further experiments.

[0055] Diabetes ApoE - / - Mouse and non-diabetic ApoE - / - Construction of atherosclerotic plaque calcification model in mice:

[0056] ApoE- / - Mice were purchased from Changzhou Cavens Company.

[0057] Diabetes ApoE - / - Mouse atherosclerotic plaque calcification model (DM group): ApoE - / - Mice were intraperitoneally injected with streptozotocin (STZ, injection requirements are the same as above) and then fed with a high-fat diet for 24 weeks.

[0058] Nondiabetic ApoE - / - Mouse atherosclerotic plaque calcification model (NC group): ApoE - / - The mice were intraperitoneally injected with normal saline and then fed with a high-fat diet for 24 weeks.

[0059] BAY-069 intervention trial:

[0060] BAY-069 was first dissolved in DMSO and then further diluted in 0.9% saline.

[0061] ApoE in diabetes - / - Mouse and non-diabetic ApoE - / - During the construction of the calcification model in atherosclerotic plaques in mice, after being fed a high-fat diet for 16 weeks, 0.3 mg / kg of BAY-069 or DMSO was injected through the tail vein every 48 hours for 8 weeks, during which time the mice continued to be fed a high-fat diet.

[0062] The groups involved in this experiment include: NC group injected with DMSO through the tail vein, DM group injected with DMSO through the tail vein, NC group injected with BAY-069 through the tail vein, and DM group injected with BAY-069 through the tail vein.

[0063] During the feeding process, the weight and blood sugar of mice were monitored. After the BAY-069 intervention experiment, the serum, aorta, liver, kidney, retina, etc. of mice were collected for the next experiment. During the experiment, it was found that BAY-069 treatment did not affect the food intake of mice. After BAY-069 intervention, it was found that BAY-069 did not affect the diabetic ApoE - / - Mouse and non-diabetic ApoE - / - Mouse body weight changes ( Figure 2 A); Diabetic ApoE treated with BAY-069 - / - Mouse and non-diabetic ApoE - / - There was no statistically significant change in the blood glucose levels of mice ( Figure 2 B).

[0064] Schematic diagram of BAY-069 inhibiting calcification in diabetic plaques Figure 1 shown.

[0065] The aorta, aortic root, and aortic arch of the mice used in the examples were obtained according to the following method:

[0066] Mice in each group were euthanized with CO2. The chest and abdominal cavities were opened, and the left ventricle was perfused with PBS to flush out the blood. The aorta was then removed and the aorta was opened along the vascular lumen under a stereomicroscope. The aorta was fixed in 4% paraformaldehyde. A black gasket was placed over the aortic arch to highlight it. The aortic arch was photographed in vivo using the microscope's built-in camera to observe aortic plaque formation. After flushing out the blood, the mouse hearts were obtained, the left and right atrial appendages were removed, and the aortic root was vertically sectioned along the transverse section. The aortic root section was embedded with the aorta facing downward in an OCT embedding cassette (Sakura Finetek, USA) and frozen in a cryostat.

[0067] Example 1: Knockout of BCAT2 inhibits calcification in diabetic atherosclerotic plaques

[0068] (1) Identification of aortic calcification by Alizarin Red S staining: ApoE - / - / BCAT2 fl / fl Mice and ApoE - / - / BCAT2 ΔSMC The whole aorta of mice was used as a sample and fixed in 95% ethanol for 24 hours, then stained with 0.003% Alizarin Red S solution in 1% potassium hydroxide overnight. The aorta was rinsed with 2% potassium hydroxide and photographed.

[0069] The calcification of the whole aorta was determined by micro computed tomography (Micro-CT): the samples were fixed in 4% paraformaldehyde for 24 h and then examined with a Micro-CT scanner (NMC-200Nemo, Pingsheng Medical, Suzhou, China) at a resolution of 10 μm. Figure 3 As shown, the results of aorta Alizarin Red S staining and Micro CT showed that ApoE - / - / BCAT2 ΔSMC ApoE - / - / BCAT2 fl / fl Calcification in mice was significantly reduced ( Figure 3 ).

[0070] (2) Take ApoE - / - / BCAT2 fl / fl Mice and ApoE - / - / BCAT2 ΔSMCThe mouse heart (for obtaining the aortic root) and aortic arch tissue were dehydrated, immersed in paraffin, and embedded; after embedding, they were cut into 6 μm thick paraffin sections.

[0071] H&E staining: After dewaxing and hydration of paraffin sections, wash three times with PBS. After washing, first stain the nucleus with hematoxylin staining solution for 4 minutes, then rinse with running water to remove the staining solution; then differentiate with differentiation solution (0.5% hydrochloric acid ethanol) for 2 minutes, wash three times with PBS; finally, stain the cytoplasm with eosin staining solution for 2 minutes, wash three times with PBS, and observe and photograph under a microscope.

[0072] Von Kossa staining: After paraffin sections were dewaxed and hydrated, they were washed three times with ddH2O, and then irradiated with solution A in the Von Kossa staining kit (Solarbio, Beijing) under UV light for 2 hours. After washing three times with ddH2O, they were stained with solution B for 5 minutes and washed three times with ddH2O. Finally, they were stained with neutral red staining solution for 5 minutes, washed three times with ddH2O, and then sealed and observed under a microscope. The results of H&E and Von Kossa staining are shown in the figure. Figure 4 As shown in A and 4B, the figure shows ApoE - / - / BCAT2 fl / fl Compared with mice, ApoE - / - / BCAT2 ΔSMC The mice had reduced calcification formation in the lesioned areas of the aortic root and aortic arch.

[0073] Example 2: Validation Experiment of BAY-069 Targeting BCAT2 Specific Inhibitor

[0074] (1) Molecular docking experiment:

[0075] First, we used the Protein Data Bank (https: / / www.rcsb.org / ) to search for the protein structure of BCAT2, whose PDB ID is 5MPR, and downloaded its protein structure. Next, we searched for the molecular structure of BAY-069 from the PubChem database (https: / / pubchem.ncbi.nlm.nih.gov / ), whose PubChem CID is 155555842, and downloaded its molecular structure. We imported the BCAT2 PDB and BAY-069 PubChem CID into AutoDock software to predict their potential binding sites. Finally, we imported the BCAT2 protein structure, BAY-069 molecular structure, and the AutoDock predictions into Pymol software to visualize their specific binding sites.

[0076] The results are as follows Figure 5As shown, molecular docking results showed that BAY-069 could form hydrogen bonds with ARG-143, THR-240, and TYR-141, which are located within the BCAT2 binding site.

[0077] (2) qRT-PCR detection of BCAT2 gene expression:

[0078] RNA was extracted from aortic tissues of mice injected with DMSO (NC), DM (DM), BAY-069 (NC), and BAY-069 (DM) in the tail vein. RNA was reverse-transcribed into cDNA using a reverse transcription kit (purchased from Nanjing Novezan Biotechnology Co., Ltd.). qRT-PCR was then performed using an RNase-free centrifuge tube. The mixture was prepared as follows: 2 μL of cDNA was supplemented with 10 μM forward primer (BCAT2-F) and rear primer (BCAF2-R) and 10 μL of SYBR Green Mix, and the total volume was made up to 20 μL with DEPC water. qPCR reactions were performed using the following conditions: a first step of denaturation at 95°C for 5 minutes; a second step of cycling at 95°C for 10 seconds, followed by 60°C for 30 seconds; and a third step of melting curve analysis at 95°C for 15 seconds, 60°C for 60 seconds, and 95°C for 15 seconds. Relative mRNA levels were calculated using the ΔΔCt method using GAPDH as a control.

[0079] Primer sequences:

[0080] BCAT2-F(SEQ ID No:1):CTCAACATGGACAGGATGCTA,

[0081] BCAT2-R(SEQ ID No:2):GGAACCCAGTCTTTGTCTACTT,

[0082] GAPDH-F (SEQ ID No: 3): GGTTGTCTCCGACTTCA,

[0083] GAPDH-R (SEQ ID No: 4): TGGTCCAGGGTTTCTTACTCC.

[0084] Western Blot assay to detect BCAT2 protein expression:

[0085] A mixture of lysis buffer (purchased from Shanghai Beyotime Biotechnology Co., Ltd., Catalog No. P0013B) and protease inhibitors (purchased from solarbio, Catalog No. P0100) was prepared (1 mL of lysis buffer and 10 μL of protease inhibitors per 100 mg of aorta). Protein was extracted from aortic tissues of mice injected with DMSO (NC), DM (DM), BAY-069 (NC), and BAY-069 (DM) via the tail vein. Protein quantification was performed using a BCA protein quantification kit (Shanghai Beyotime Biotechnology Co., Ltd.). Proteins were separated on SDS-PAGE gels and transferred to polyvinylidene fluoride (PVDF) membranes. The membrane was incubated in 5% skim milk at 37°C for 1 hour and then incubated with a primary antibody at a 1:2000 ratio overnight at 4°C (BCAT2 antibody or β-actin antibody; BCAT2 antibody was purchased from Proteintech, China, 16417-1-AP; β-actin antibody was purchased from Proteintech, China, 66009-1-Ig). The membrane was then incubated with a secondary antibody at a 1:200 ratio for 1 hour at 37°C (Goat Anti-Rabbit IgG (HRP) or Goat Anti-Mouse IgG (HRP); Goat Anti-Rabbit IgG (HRP) was purchased from Abways, China, ab0101; Goat Anti-Mouse IgG (HRP) was purchased from Abways, China, ab0102). The membrane was visualized using a chemiluminescence system (Amersham Imager 600, General Electric Company, Boston, USA). Image J software was used to quantify band intensity.

[0086] qRT-PCR( Figure 6 A) and western blot( Figure 6 B) The results showed that BAY-069 could significantly inhibit the expression of BCAT2 gene and protein levels.

[0087] (3) BCAT enzyme activity detection: The extract of the BCAT activity assay kit (ADS-W-N026, Aidisheng) was added to the aorta of mice in the tail vein injection of DMSO NC group, tail vein injection of DMSO DM group, tail vein injection of BAY-069 NC group, and tail vein injection of BAY-069 DM group, respectively. The extract was ultrasonically crushed and centrifuged at 12000 rpm at 4°C for 10 min. The supernatant was collected for detection. The experiment was performed using the BCAT activity assay kit.

[0088] Specifically, the operation process is as follows:

[0089] Add 20 μL of reagent 1, 20 μL of reagent 2, 10 μL of reagent 3, 150 μL of reagent 4, and 100 μL of the supernatant extracted from the above-mentioned tissues in the EP tube in sequence to serve as the assay tube; add 20 μL of reagent 1, 10 μL of reagent 3, 170 μL of reagent 4, and 100 μL of the supernatant extracted from the above-mentioned tissues to the control tube, mix all tubes, react at 37°C for 60 min (accurate time), immediately place in a 95°C boiling water bath for 2 min, shake up and down a few times to mix, centrifuge at 12,000 rpm at room temperature for 5 minutes, and take the supernatant for testing. Next, add 100 μL of the extract from the BCAT activity assay kit, 20 μL of reagent 5, 10 μL of reagent 6, 10 μL of reagent 7, and 60 μL of the supernatant to be tested to a 96-well plate, mix well, react at 30°C for 15 minutes, and immediately read the absorbance value A at 450 nm. ΔA = A determination - A control. Count the number of cells for standardization. The test results are shown in Figure 2. Figure 7 As shown. Figure 7 It can be seen that BAY-069 significantly inhibits BCAT enzyme activity ( Figure 7 ).

[0090] Combined with the results of qRT-PCR and Western blot, it can be seen that BAY-069 can be used as an inhibitor targeting BCAT2.

[0091] Example 3: BAY-069 against ApoE - / - Effects on blood glucose and blood lipid function in mice

[0092] Eyeball blood was collected from the mice in the NC group (DMSO-injected), the DM group (DMSO-injected), the NC group (BAY-069-injected), and the DM group (BAY-069-injected). After standing at 4°C for 24 hours, the blood was centrifuged at 3000 rpm for 10 minutes, and serum was collected for detection.

[0093] A blank well, a standard well, and a sample well were set up in a 96-well plate. 2.5 μL of distilled water, the standard substance in the HDL / LDL assay kit, and the sample, mouse eye blood, were added, respectively. The assay was then performed according to the HDL / LDL assay kit (purchased from Nanjing Jiancheng Bioengineering Institute). 180 μL of reagent 1 from the kit was added, the plate was gently shaken to mix, and the plate was incubated at 37°C for 5 minutes with a wavelength of 600 nm. The absorbance value A1 of each well was measured by a microplate reader. Next, 60 μL of reagent 2 from the kit was added, the plate was gently shaken to mix, and the plate was incubated at 37°C for 5-10 minutes with a wavelength of 600 nm. The absorbance value A2 of each well was measured by a microplate reader, and ΔA = A2 - A1 was calculated. Finally, the levels of high-density lipoprotein (HDL) and low-density lipoprotein (LDL) in mouse serum were calculated according to the formula in the kit instructions (HDL / LDL content (mmol / L) = (ΔA sample - ΔA blank) / (ΔA standard - ΔA blank) * standard concentration (specific values ​​are shown on the product label)).

[0094] Separately, blank, standard, and sample wells were set up in a 96-well plate. 2.5 μL of distilled water, the standard from the TG / TC assay kit (purchased from Nanjing Jiancheng Bioengineering Institute), and the sample (mouse eye blood) were added, respectively. Then, 250 μL of the working solution from the TG / TC assay kit was added. The plate was gently shaken to mix thoroughly, and the plates were incubated at 37°C for 10 minutes with shaking. The absorbance (A) of each well was measured on a microplate reader at a wavelength of 500 nm. TC and TG levels in mouse serum were calculated according to the formula (TG / TC content (mmol / L) = (A sample - A blank) / (A standard - A blank) * standard concentration (see product label for specific values)).

[0095] The experimental results showed that the serum levels of cholesterol (TC), triglycerides (TG) and low-density lipoprotein (LDL) in diabetic mice treated with BAY-069 were significantly reduced, while the serum level of high-density lipoprotein (HDL) was increased. - / - In mice, BAY-069 also had the same effect ( Figure 8 AD).

[0096] Example 4: BAY-069 against ApoE - / - Effects on the liver, kidney, and retina of mice

[0097] The liver, kidney, and retina tissues of mice in the NC group injected with DMSO, the DM group injected with DMSO, the NC group injected with BAY-069, and the DM group injected with BAY-069 were dehydrated, immersed in paraffin, and embedded. The embedded paraffin sections were cut into 6 μm thick paraffin sections, then dewaxed and hydrated and washed three times with PBS. H&E staining was performed using the same method as in Example 1.

[0098] H&E staining results showed that diabetes mellitus promoted the expression of ApoE induced by high-fat diet - / - The mice showed fatty degeneration and hepatocyte edema in the liver, and inflammatory cell infiltration, which were improved after BAY-069 intervention. Diabetes can easily lead to nephropathy (pathological changes are manifested as glomerular hypertrophy, cystic stenosis and cyst wall thickening, thickening of the glomerular mesangium and basement membrane, dilation of renal tubules, degeneration and necrosis of renal tubular epithelial cells, local infiltration of inflammatory cells and fibrous tissue proliferation in the renal interstitium, etc.) and retinopathy (pathological changes are manifested as a significant decrease and loss of retinal ganglion cells and inner nuclear layer cells, disordered arrangement of inner nuclear layer and outer plexiform layer cells, and capillary dilation and microthrombosis in all layers of the retina). The results of this example show that BAY-069 intervention can improve both renal and retinopathy in mice ( Figure 9 ), indicating that BAY-069 can improve diabetic ApoE - / - Pathological changes in the liver, kidney and retina of mice.

[0099] Example 5: BAY-069 can inhibit diabetic ApoE - / - Atherosclerosis formation in mice

[0100] Whole-aorta Oil Red O staining: Mice in the tail vein-injected DMSO (NC), DM (DM), BAY-069 (NC), and BAY-069 (DM) groups were euthanized with CO2. The chest and abdominal cavities were opened, and the left ventricle was perfused with PBS to flush out blood. Periaortic adipose tissue and connective tissue were dissected cleanly under a stereomicroscope. The aorta was removed and opened along the vascular lumen under a stereomicroscope. The aorta was fixed in 4% paraformaldehyde for 20 minutes. Oil Red O working solution was prepared by mixing 3 parts Oil Red O stock solution (Solebol, Beijing) with 2 parts double-distilled water. The mixture was then filtered through filter paper in the dark. The fixed aorta was washed three times with PBS and stained in the filtered Oil Red O working solution for 2 hours in the dark. The aorta was then destained twice with 75% ethanol and washed with PBS after complete destaining. The aorta was mounted flat on a glass slide and photographed on a black background. Image J software was used to count the red plaque area.

[0101] Oil Red O staining of tissue sections: After the above treatment, the mouse heart was flushed of blood, the left and right atrial appendages were removed, and the aortic root was vertically sectioned along the transverse section. The aortic root section was embedded in an OCT (Sakura Finetek, USA) cassette with the aorta facing downward and frozen in a cryostat. Tissue sections were sliced ​​at a thickness of 5 μM, preferably cutting into the aortic valve region. After thawing, the frozen sections were washed three times with PBS, and the OCT gel was removed. The sections were then fixed with 4% paraformaldehyde for 20 minutes and washed three times with PBS. After rinsing with 60% isopropanol for 5 seconds, the sections were stained in filtered Oil Red working solution in the dark for 20 minutes. After staining, the sections were washed with 60% isopropanol for 2 minutes. Finally, the nuclei were stained with hematoxylin. Lipid accumulation within the plaques was observed under a microscope and photographed.

[0102] H&E staining: The heart and aortic arch tissues of the mouse were dehydrated, immersed in paraffin and embedded. The embedded paraffin sections were cut into 6 μm thick paraffin sections, then dewaxed, hydrated and washed three times with PBS. H&E staining was performed using the same method as in Example 1.

[0103] In situ images show that BAY-069 reduces ApoE in diabetes - / - Plaques in the mouse aortic arch ( Figure 10 A), Oil red O staining of the entire aorta surface showed that the area of ​​atherosclerotic lesions in mice treated with BAY-069 was reduced compared with that in the control group ( Figure 10 B) After BAY-069 intervention, the aortic root lesion area and lipid content in the atherosclerotic lesion area of ​​mice were reduced ( Figure 10 C).

[0104] Example 6: BAY-069 can inhibit calcification formation in diabetic atherosclerotic plaques

[0105] (1) Western Blot experiment: The same method as in Example 2 was used to extract proteins from the aorta tissues of mice in the NC group injected with DMSO, the DM group injected with DMSO, the NC group injected with BAY-069, and the DM group injected with BAY-069. Protein quantification was performed using a BCA protein quantification kit. The sample loading amount was unified, and the proteins were separated on an SDS-PAGE gel and transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was incubated in 5% skim milk at 37°C for 1 hour, and then the membrane was incubated with the primary antibody at a ratio of 1:2000 at 4°C overnight. The membrane was then incubated with the secondary antibody at a ratio of 1:200 at 37°C for 1 hour and developed using a chemiluminescence system (Amersham Imager 600, General Electric Company, Boston, USA).

[0106] The primary antibodies used in this example were α-SMA antibody (BM0002, boster, China), SM22α (A6760, ABclonal, China), RUNX2 antibody (ab192256 / 76956, Abcam, USA), BMP2 antibody (68383-1-Ig, Proteintech, China) or β-actin antibody (66009-1-Ig, Proteintech, China); the secondary antibodies were Goat Anti-Rabbit IgG (HRP) (ab0101, abways, China) or Goat Anti-Mouse IgG (HRP) (ab0102, abways, China).

[0107] Image J software was used to quantify band intensities.

[0108] Western Blot analysis of the changes in contraction / osteogenesis-related proteins in the mouse aorta showed that BAY-069 intervention increased the expression of diabetic ApoE - / - The levels of α-SMA and SM22α were increased, and the expression of RUNX2 and BMP2 was reduced in the mouse aorta, indicating that the contractile phenotype was partially restored after BAY-069 intervention, and osteogenic transdifferentiation was impaired ( Figure 11 ).

[0109] (2) Identification of calcified whole aorta by Alizarin Red S staining: The whole aortas of mice in the NC group (DMSO-injected), the DM group (DMSO-injected), the NC group (BAY-069-injected), and the DM group (BAY-069-injected) were fixed in 95% ethanol for 24 hours and then stained with 0.003% Alizarin Red S solution in 1% potassium hydroxide overnight. The aortas were rinsed with 2% potassium hydroxide and photographed.

[0110] The results showed that alizarin red staining of the aorta and MicroCT showed that BAY-069 intervention significantly reduced aortic calcification in mice ( Figure 12 ).

[0111] (3) Calcium content in the aorta of mice in the NC group injected with DMSO, the DM group injected with DMSO, the NC group injected with BAY-069, and the DM group injected with BAY-069 was quantified using a calcium assay kit (Biyuntian, Shanghai): Tissue samples (aorta) were cut into small pieces, added to the lysis buffer in the calcium assay kit, and homogenized with a handheld tissue grinder until fully lysed. After full lysis, centrifuge at 10,000-14,000g for 3-5 minutes at 4°C, remove the supernatant, and place on ice for testing. 50 μL of sample and 150 μL of detection working solution (detection buffer: color development solution = 1:1) were added to each well of a 96-well plate and mixed. Incubate at room temperature in the dark for 5-10 minutes, and measure the absorbance at 575 nm with an enzyme-linked microplate reader. Standard curve preparation: Prepare standards at concentrations of 0, 0.1, 0.2, 0.4, 0.6, 0.8, and 1.0 mM and their corresponding absorbance values. Protein concentration was determined in the centrifuged tissue supernatant using the BCA protein assay kit (Biyuntian, P0009). Calcium content was calculated based on the standard curve and calibrated using protein concentration.

[0112] Aortic calcium levels were quantified using an alkaline phosphatase (ALP) assay kit (Beyotime, Shanghai) in mice injected with DMSO (NC), DM (DM), BAY-069 (NC), and BAY-069 (DM) via the tail vein. Tissue samples (aorta) were lysed with lysis buffer, centrifuged, and the supernatant was used for alkaline phosphatase assay. To prepare the chromogenic substrate solution, dissolve one tube of chromogenic substrate in assay buffer, mix thoroughly, and store on ice. Freshly prepared chromogenic substrate solution should be used within 6 hours. A 96-well plate was set up with blank, standard, and sample wells. 50 μL of assay buffer and 50 μL of chromogenic substrate were added to the blank wells. Standards were added to the standard wells and the remaining volume was adjusted to 100 μL with assay buffer. 50 μL of sample and 50 μL of chromogenic substrate were added to the sample wells. Gently mix with a pipette tip, incubate at 37°C for 5-10 minutes, and terminate the reaction by adding 100 μL of stop solution to each well. Measure the absorbance at 405 nm. A standard curve is generated by adding 4, 8, 16, 24, 32, and 40 μL of the standard (0.5 mM p-nitrophenol solution) and measuring the absorbance. Based on the standard curve and the absorbance of the sample to be tested, the amount of p-nitrophenol generated in the sample can be calculated. Based on the definition of enzyme activity, the alkaline phosphatase activity in the sample can be calculated by dividing the molar amount of p-nitrophenol generated by the incubation time.

[0113] The experimental results showed that after BAY-069 intervention, diabetic and non-diabetic ApoE - / -The calcium content and ALP activity of mice were significantly downregulated ( Figure 13 A and Figure 13 B).

[0114] (4) The aorta of mice in the NC group (DMSO-injected), the DM group (DMSO-injected), the NC group (BAY-069-injected), and the DM group (BAY-069-injected) were collected, dehydrated, immersed in paraffin, and embedded. The embedded paraffin sections were cut into 6 μm paraffin sections. After dewaxing and hydration, the paraffin sections were washed three times with ddH2O. Then, solution A in the Von Kossa staining kit was added and irradiated under UV light for 2 hours. After washing three times with ddH2O, solution B was stained for 5 minutes, and then washed three times with ddH2O. Finally, the sections were stained with neutral red staining solution for 5 minutes, washed three times with ddH2O, sealed, and observed under a microscope.

[0115] Von Kossa staining revealed that compared with the control group, BAY-069-treated mice had less calcification in the lesion area of ​​the aortic root and aortic arch ( Figure 14 ).

[0116] (5) Western Blot experiment: Lysis buffer and protease inhibitor mixture (according to 10 5 100 μl of lysis buffer and 1 μl of protease inhibitor cocktail were added to the cells, and proteins were extracted from the BAY-069-treated NM group, BAY-069-treated OM group, DMSO-treated NM group, and DMSO-treated OM group, respectively, and protein quantification was performed using a BCA protein quantification kit. The sample load was uniform, and the proteins were separated on SDS-PAGE gels and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were incubated in 5% skim milk at 37°C for 1 hour, and then incubated with the primary antibody at a ratio of 1:2000 at 4°C overnight. The membranes were then incubated with the secondary antibody at a ratio of 1:200 at 37°C for 1 hour and developed using a chemiluminescence system (Amersham Imager 600, General Electric Company, Boston, USA). Image J software was used to quantify the band intensity.

[0117] In this example, the primary antibody was α-SMA antibody (BM0002, boster, China), SM22α (A6760, ABclonal, China), RUNX2 antibody (ab192256 / 76956, Abcam, USA), BMP2 antibody (68383-1-Ig, Proteintech, China) or β-actin antibody (66009-1-Ig, Proteintech, China), and the secondary antibody was Goat Anti-Rabbit IgG (HRP) (ab0101, abways, China) or Goat Anti-Mouse IgG (HRP) (ab0102, abways, China).

[0118] For Alizarin Red staining, the culture medium was removed from the cells in the BAY-069-treated NM group, the BAY-069-treated OM group, the DMSO-treated NM group, and the DMSO-treated OM group. The cells were then washed three times with ddH2O and fixed in 4% paraformaldehyde for 30 minutes. The cells were then stained in 2% Alizarin Red S solution (pH 4.2) at room temperature for 15 minutes. Finally, the cells were observed and photographed.

[0119] Calcium content was quantified using a calcium assay kit (Beyondtime, Shanghai) in cells treated with BAY-069 in the NM group, BAY-069 in the OM group, DMSO in the NM group, and DMSO in the OM group. The cells were dehydrated by removing the culture medium, washed three times with PBS, and then lysed with lysis buffer. After complete lysis, the cells were centrifuged at 10,000–14,000 g for 3–5 minutes at 4°C. The supernatant was removed and placed on ice for analysis. To each well of a 96-well plate, 50 μL of sample and 150 μL of assay working solution (assay buffer: colorimetric solution = 1:1) were added and mixed. The cells were incubated at room temperature in the dark for 5–10 minutes, and the absorbance at 575 nm was measured using a microplate reader. A standard curve was prepared using standard concentrations of 0, 0.1, 0.2, 0.4, 0.6, 0.8, and 1.0 mM, along with their corresponding absorbance values. Protein concentration was determined by measuring the protein concentration in the supernatant of the centrifuged cells using the BCA protein concentration assay kit (Biyuntian, P0009). Calcium content was calculated using a standard curve and calibrated using protein concentration.

[0120] To verify the effect of BAY-069 on calcification in mouse aortic smooth muscle cells (purchased from the American Model Culture Collection) under a high-glucose, high-fat microenvironment, in this example, Movas cultured in DMEM medium supplemented with 10% FBS, 50 μg / mL ox-LDL, and 1% penicillin / streptomycin were designated as the NM (normal medium) group; Movas cultured in DMEM medium supplemented with 10% FBS, 50 μg / mL ox-LDL, 1% penicillin / streptomycin, 2.5 mmol / L β-glycerophosphate (Sigma, USA), and 50 μg / mL ascorbic acid (solarbio, Beijing) were designated as the OM (osteogenic medium) group. Movas in the NM or OM group were treated with 50 μM BAY-069 or DMSO on day 7 of culture, and the cells were co-cultured for 14 days and designated as the BAY-069-treated NM group, the BAY-069-treated OM group, the DMSO-treated NM group, and the DMSO-treated OM group, respectively.

[0121] Western blot results showed that after BAY-069 intervention, the expression of α-SMA and SM22α in Movas increased, while the expression of RUNX2 and BMP2 decreased, indicating that BAY-069 can effectively inhibit the osteogenic transdifferentiation of smooth muscle cells ( Figure 15 and Figure 16 Alizarin red S staining showed that BAY-069 intervention could significantly inhibit Movas calcification, and the calcium content detection was consistent with the results of alizarin red staining ( Figure 17 ).

[0122] The above experimental results demonstrate that BAY-069, a specific inhibitor targeting BCAT2, effectively inhibits BCAT2 expression and enzymatic activity. Further animal and cell-based experiments demonstrate that BAY-069 inhibits osteogenic transdifferentiation of vascular smooth muscle cells and calcification within diabetic atherosclerotic plaques. Furthermore, the present invention demonstrates that BAY-069 can effectively reduce the area of ​​diabetic atherosclerotic plaques and lipid accumulation within these plaques. Furthermore, it is revealed that BAY-069 can effectively improve diabetic microangiopathy, including diabetic nephropathy and retinopathy. Finally, H&E staining revealed that BAY-069 can also improve hyperlipidemia and diabetes-induced fatty liver. These results suggest that BAY-069 may be an effective treatment for calcification within diabetic atherosclerotic plaques in the future, and may also have ameliorative effects on other diabetic complications.

[0123] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of the BCAT2 gene as a target in screening drugs for preventing, alleviating and / or treating diabetes-related diseases.

2. The use according to claim 1, characterized in that The drug targets the BCAT2 gene and inhibits or silences the expression of BCAT2.

3. The use according to claim 1, characterized in that The related diseases include hyperglycemia, hyperlipidemia, fatty liver, diabetic nephropathy, retinopathy, diabetic atherosclerosis, diabetic plaque or calcification in diabetic plaque.

4. Use of a BCAT2 inhibitor in the preparation or screening of drugs for preventing, alleviating and / or treating diabetes-related diseases.

5. The use according to claim 4, characterized in that The BCAT2 inhibitor is BAY-069.

6. The use according to claim 4, characterized in that The diabetes-related diseases are BCAT2-mediated diabetes-related diseases; the related diseases include hyperglycemia, hyperlipidemia, fatty liver, diabetic nephropathy, retinopathy, diabetic atherosclerosis, diabetic plaques or calcification in diabetic plaques.

7. A drug for preventing, alleviating and / or treating diabetes-related diseases, characterized in that: The medicament or active ingredient of the medicament comprises a BCAT2 inhibitor.

8. The drug according to claim 7, characterized in that The BCAT2 inhibitor is BAY-069.

9. The drug according to claim 7, characterized in that The diabetes-related diseases are BCAT2-mediated diabetes-related diseases; the related diseases include hyperglycemia, hyperlipidemia, fatty liver, diabetic nephropathy, retinopathy, diabetic atherosclerosis, diabetic plaques or calcification in diabetic plaques.

Images