Molecular marker of wheat biological clock gene tarve7-a1 and application thereof

By developing a molecular marker for the wheat circadian rhythm gene TaRVE7-A1 and using KASP technology and fluorescence detection to identify haplotypes, the problem of undeveloped TaRVE7-A1 function in wheat breeding was solved, thus improving breeding efficiency and yield improvement.

CN120519625BActive Publication Date: 2026-03-24LUDONG UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511014987.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-23
Publication Date
2026-03-24
Estimated Expiration
2045-07-23

AI Technical Summary

Technical Problem

The function and molecular markers of the wheat biological clock gene TaRVE7-A1 have not yet been developed, which affects the efficiency of wheat breeding and the effectiveness of yield improvement.

Method used

Molecular markers for the wheat circadian rhythm gene TaRVE7-A1 were developed. Specific primers were designed using KASP technology for PCR amplification. Three haplotypes of TaRVE7-A1, especially TaRVE7-A1-Hapl b and TaRVE7-A1-Hapl c, were identified by fluorescence detection and SNPviewer software analysis. These haplotypes are used to select superior haplotypes with longer spikelet and flag leaf lengths.

Benefits of technology

It improves the selection efficiency of wheat breeding, saves costs, provides excellent alleles for efficient screening of the biological clock gene TaRVE7-A1, and promotes the breeding of high-yield wheat varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519625B_ABST
    Figure CN120519625B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker of a wheat biological clock gene TaRVE7-A1 and application thereof, and belongs to the technical field of crop selection and cultivation. The molecular marker is a KASP marker, including RVE7-A1-SNP-709269692 and RVE7-A1-SNP-709269783, the former is obtained by amplification of a primer group shown in SEQ ID NO:9, SEQ ID NO:10 and SEQ ID NO:11, two forward primers are marked with FAM and HEX at the 5' end respectively, and the latter is obtained by amplification of a primer group shown in SEQ ID NO:12, SEQ ID NO:13 and SEQ ID NO:14, two forward primers are marked with FAM and HEX at the 5' end respectively. By applying the molecular marker developed in the application, excellent haplotypes can be identified in wheat line selection, cost is saved, and selection efficiency is greatly improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to molecular markers and their applications, specifically to molecular markers of the wheat biological clock gene TaRVE7-A1 and their application in assisted breeding, belonging to the field of crop selection and breeding technology. Background Technology

[0002] Wheat is one of the most important food crops, and breeding high-yielding wheat varieties is crucial to increasing yield. With the development of biogenetic technology, molecular marker-assisted selection (MMR) technology is playing an increasingly prominent role in improving breeding efficiency and reducing blind selection. Kompetitive allele-specific PCR (KASP) is a high-throughput genotyping technique based on SNPs, which has advantages such as high throughput, low cost, and ease of operation, and has great potential for application in crop trait improvement.

[0003] The biological clock is an endogenous timing mechanism developed by plants during evolution. It senses and predicts rhythmic changes in external environmental factors such as light, temperature, humidity, and nutrients, thereby ensuring that plant life activities remain synchronized with the external environment. The biological clock is closely related to many important plant characteristics, including regionality of cultivation, environmental adaptability, heterosis, and yield and quality. The core oscillator of the plant biological clock system is a complex regulatory network composed of multiple transcription-translation feedback loops. The REVEILLE (RVE) family is a key component of the biological clock system. The RVE family consists of transcription factors containing the MYB domain, similar to CCA1 / LHY, which mainly act as activators regulating the activity of genes expressed in the evening. However, the function of the wheat biological clock gene TaRVE7-A1 (SEQ ID NO: 15) and the development and utilization of its molecular markers have not been reported. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker for the wheat biological clock gene TaRVE7-A1 and its application, thereby providing genetic resources and effective methods for the genetic improvement of wheat yield traits.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] Molecular markers for the wheat circadian rhythm gene TaRVE7-A1, which comprises three haplotypes: TaRVE7-A1-Hapl a, TaRVE7-A1-Hapl b, and TaRVE7-A1-Hapl c. These molecular markers are KASP markers, including RVE7-A1-SNP-709269692 and RVE7-A1-SNP-709269783.

[0007] RVE7-A1-SNP-709269692 was obtained by amplification using two forward primers shown in SEQ ID NO: 9 and SEQ ID NO: 10, and one reverse primer shown in SEQ ID NO: 11. The 5' end of the forward primer shown in SEQ ID NO: 9 is labeled with a FAM fluorescent group, and the 5' end of the forward primer shown in SEQ ID NO: 10 is labeled with a HEX fluorescent group. The fluorescence intensity of the PCR amplification product was detected using an online fluorescence detector, and the data was analyzed and read in SNPviewer software. When the SNPviewer result is blue, the haplotype of the wheat circadian rhythm gene TaRVE7-A1 is TaRVE7-A1-Hapl b or TaRVE7-A1-Hapl c. When the SNPviewer result is red, the haplotype of the wheat circadian rhythm gene TaRVE7-A1 is TaRVE7-A1-Hapl a.

[0008] RVE7-A1-SNP-709269783 was amplified using two forward primers shown in SEQ ID NO: 12 and SEQ ID NO: 13, and one reverse primer shown in SEQ ID NO: 14. The 5' end of the forward primer shown in SEQ ID NO: 12 is labeled with a FAM fluorescent group, and the 5' end of the forward primer shown in SEQ ID NO: 13 is labeled with a HEX fluorescent group. The fluorescence intensity of the PCR amplification product was detected using an online fluorescence detector, and the data was analyzed and read in SNPviewer software. When the SNPviewer result is blue, the haplotype of the wheat circadian rhythm gene TaRVE7-A1 is TaRVE7-A1-Hapl a or TaRVE7-A1-Hapl c. When the SNPviewer result is red, the haplotype of the wheat circadian rhythm gene TaRVE7-A1 is TaRVE7-A1-Hapl b.

[0009] The aforementioned molecular marker of the wheat biological clock gene TaRVE7-A1 was used in the selection of wheat haplotype TaRVE7-A1-Hapl b. Compared with haplotype TaRVE7-A1-Hapl a, haplotype TaRVE7-A1-Hapl b has a longer spike and flag leaf length, and compared with haplotype TaRVE7-A1-Hapl c, haplotype TaRVE7-A1-Hapl b has a longer flag leaf length.

[0010] The advantages of this invention are:

[0011] (1) This invention develops a new KASP marker. The KASP marker developed in this invention is derived from the genetic variation analysis of the circadian clock gene TaRVE7-A1 in natural wheat populations, providing unique genetic information and providing a new tool for wheat breeding;

[0012] (2) By applying the KASP marker developed in this invention, superior haplotypes of wheat can be identified in wheat strain selection, which not only saves costs but also greatly improves selection efficiency and accelerates the breeding process, providing new possibilities for efficient screening of superior alleles of the biological clock gene TaRVE7-A1 and the breeding of high-yield wheat varieties. Attached Figure Description

[0013] Figure 1 This is a diagram showing the variation sites and haplotype typing results of the wheat biological clock gene TaRVE7-A1.

[0014] Figure 2 This is a KASP marker genotyping result diagram for the wheat circadian clock gene TaRVE7-7A at the SNP2 locus. In the diagram, red represents G:G, blue represents C:C, green represents heterozygote, purple represents signal but no clear genotype, and pink represents no signal or weak signal.

[0015] Figure 3 This is a KASP marker genotyping result diagram for the wheat circadian clock gene TaRVE7-7A at the SNP3 locus. In the diagram, red represents T:T, blue represents G:G, green represents heterozygotes, and pink represents no signal or weak signal. Detailed Implementation

[0016] The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0017] I. Obtaining the polymorphic site of the wheat biological clock gene TaRVE7-A1

[0018] 1. Design specific primers

[0019] Specific primers were designed based on the genomic sequence of the wheat circadian rhythm gene TaRVE7-A1 for PCR amplification and sequencing. The designed specific primers are RVE7-A1-1F and RVE7-A1-1R, RVE7-A1-2F and RVE7-A1-2R, RVE7-A1-3F and RVE7-A1-3R, and RVE7-A1-4F and RVE7-A1-4R. The nucleotide sequences of each specific primer are as follows:

[0020] RVE7-A1-1F: CGCACCACAGCTGAAATCTT (SEQ ID NO: 1);

[0021] RVE7-A1-1R: CGCTGCTTGGTTATCATGTACG (SEQ ID NO: 2);

[0022] RVE7-A1-2F: CGGCGCTTTGATCTTGAAGG (SEQ ID NO: 3);

[0023] RVE7-A1-2R: GGAATCATTGGTTGGTGGCG (SEQ ID NO: 4);

[0024] RVE7-A1-3F: GGCCGCCAGAACTGTTTTTC (SEQ ID NO: 5);

[0025] RVE7-A1-3R: GGGTACGGCACACTTCCATT (SEQ ID NO: 6);

[0026] RVE7-A1-4F:AATGGAAGTGTGCCGTACCC (SEQ ID NO: 7);

[0027] RVE7-A1-4R: AGTTGTTGAGCGAAAGAGGGT (SEQ ID NO: 8).

[0028] 2. PCR amplification

[0029] The DNA from the 30 wheat materials (all from the National Germplasm Bank) in Table 1 was amplified by PCR using the specific primers RVE7-A1-1F / 1R, RVE7-A1-2F / 2R, RVE7-A1-3F / 3R, and RVE7-A1-4F / 4R.

[0030] The PCR amplification system was 50 mL, specifically containing: 2.0 μL DNA template, 2.0 μL upstream primer, 2.0 μL downstream primer, 25 μL 2×Phanta mixing buffer, 1.0 μL dNTP mixture (each at a concentration of 2.5 μM), 1.0 mL PhantaMax ultra-fidelity DNA polymerase, and 17.0 μL ddH2O.

[0031] Amplification was performed using a standard amplification procedure, with the following steps:

[0032] (1) Denaturation at 95℃ for 3 min;

[0033] (2) 34 cycles of conventional PCR program: denaturation at 95℃ for 30s, annealing at 62℃ for 30s, extension at 72℃ for 2min;

[0034] (3) Extend at 72℃ for 10 min; stop amplification and store at 12℃.

[0035] Table 1 30 common wheat varieties

[0036]

[0037] 3. Sequence Analysis

[0038] The target fragment was gel-cleaved and recovered. The recovered products were then subjected to bidirectional first-generation sequencing using specific primers RVE7-A1-1F / 1R, RVE7-A1-2F / 2R, RVE7-A1-3F / 3R, and RVE7-A1-4F / 4R.

[0039] Sequence analysis revealed six polymorphic sites (SNP1, SNP2, SNP3, SNP4, SNP5, and SNP6) in the wheat circadian rhythm gene TaRVE7-A1. These sites are located upstream of the start codon (SNP1), in the first intron region (SNP2 and SNP3), in the second intron region (SNP4), in the third exon region (SNP5), and downstream of the stop codon (SNP6), respectively. These six SNP sites constitute three haplotypes: TaRVE7-A1-Hapl a, TaRVE7-A1-Hapl b, and TaRVE7-A1-Hapl c. Figure 1 ).

[0040] II. Development and Haplotype Identification of the Wheat Biological Clock Gene TaRVE7-A1

[0041] 1. Develop KASP markers for SNP2 loci and perform genotyping.

[0042] (1) Develop KASP markers for SNP2 sites

[0043] A KASP marker (denoted as RVE7-A1-SNP-709269692) was developed targeting the SNP2 site of the wheat circadian rhythm gene TaRVE7-A1. Primers were designed using WheatOmics (http: / / wheatomics.sdau.edu.cn / PrimerServer / ). The designed primers consist of two forward primers (RVE7-A1-SNP-709269692-C and RVE7-A1-SNP-709269692-G) and one reverse primer (RVE7-A1-SNP-709269692-Common). The specific nucleotide sequences are as follows:

[0044] RVE7-A1-SNP-709269692-C:

[0045] GAAGGTGACCAAGTTCATGCTAAAAACAGTTCTGGCGCCGTG (SEQ ID NO: 9);

[0046] RVE7-A1-SNP-709269692-G:

[0047] GAAGGTCGGAGTCAACGGATT AAAAACAGTTCTGGCGGCCGTC (SEQ ID NO: 10);

[0048] RVE7-A1-SNP-709269692-Common:

[0049] CGCTCCATCTTTGCTCAGATGTGAT (SEQ ID NO: 11).

[0050] In order to detect the PCR amplification products using an online fluorescence detector, the 5' end of the forward primer (RVE7-A1-SNP-709269692-C) shown in SEQ ID NO: 9 was labeled with a FAM fluorescent group, and the 5' end of the forward primer (RVE7-A1-SNP-709269692-G) shown in SEQ ID NO: 10 was labeled with a HEX fluorescent group.

[0051] (2) Genotyping

[0052] Twenty-six common hexaploid wheat accessions were selected to form natural populations (Tables 2-1, 2-2, 2-3, 2-4, and 2-5). Genotyping of these natural populations was performed using the aforementioned KASP marker RVE7-A1-SNP-709269692. The specific steps are as follows:

[0053] (i) Extracting genomic DNA from wheat to be tested.

[0054] (ii) PCR amplification: Using the wheat genomic DNA to be tested as a template, PCR amplification was performed using the two forward primers labeled with different fluorescent groups and one reverse primer. The PCR amplification system was 10 mL, specifically containing: 2.0 μL DNA template (concentration of 50-200 ng / μL), 0.8 μL primer set (10 μM, with a volume ratio of RVE7-A1-SNP-709269692-C, RVE7-A1-SNP-709269692-G, and RVE7-A1-SNP-709269692-Common of 1:1:2), 5.0 μL 2×MasterMix, and 2.2 μL... ddH2O; The PCR reaction program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 65℃ annealing and extension for 40 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ per cycle; 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, 30 cycles, and incubation at 10℃.

[0055] (iii) Fluorescence signal reading: Fluorescence intensity scanning was performed on an online fluorescence detector (Araya). Data was analyzed and read in SNPviewer software. When the detection result was blue, the base reading of the SNP2 site was C:C (the haplotype of the wheat circadian rhythm gene TaRVE7-A1 is TaRVE7-A1-Hapl b or TaRVE7-A1-Hapl c); when the detection result was red, the base reading of the SNP2 site was G:G (the haplotype of the wheat circadian rhythm gene TaRVE7-A1 is TaRVE7-A1-Hapl a); when the detection result was green, the base reading of the SNP2 site was heterozygous; when the detection result was purple, it represented a signal but no clear genotype; when the detection result was pink, it represented no signal or a weak signal. The detection result of the blank control group (NTC, no DNA template added to the PCR amplification system) was black.

[0056] Genotyping results of the KASP marker RVE7-A1-SNP-709269692 in some wheat varieties are shown below. Figure 2 .

[0057] 2. Develop KASP markers for SNP3 loci and perform genotyping.

[0058] (1) Develop KASP markers for SNP3 sites

[0059] A KASP marker (denoted as RVE7-A1-SNP-709269783) was developed targeting the SNP3 site of the wheat circadian rhythm gene TaRVE7-A1. Primers were designed using WheatOmics (http: / / wheatomics.sdau.edu.cn / PrimerServer / ). The designed primers consist of two forward primers (RVE7-A1-SNP-709269783-G and RVE7-A1-SNP-709269783-T) and one reverse primer (RVE7-A1-SNP-709269783-Common). The specific nucleotide sequences are as follows:

[0060] RVE7-A1-SNP-709269783-G:

[0061] GAAGGTGACCAAGTTCATGCT GTTGGAAAATATCTTTTATTTCTGCACTAG (SEQ ID NO: 12);

[0062] RVE7-A1-SNP-709269783-T:

[0063] GAAGGTCGGAGTCAACGGATT GGTTGGAAAATATCTTTTATTTCTGCACTAT (SEQ ID NO: 13);

[0064] RVE7-A1-SNP-709269783-Common:

[0065] CTTCAGGAGGAAGAAAGGAGAGGAT (SEQ ID NO: 14).

[0066] In order to detect the PCR amplification products using an online fluorescence detector, the 5' end of the forward primer (RVE7-A1-SNP-709269783-G) shown in SEQ ID NO: 12 was labeled with a FAM fluorescent group, and the 5' end of the forward primer (RVE7-A1-SNP-709269783-T) shown in SEQ ID NO: 13 was labeled with a HEX fluorescent group.

[0067] (2) Genotyping

[0068] Twenty-six common hexaploid wheat accessions were selected to form natural populations (Tables 2-1, 2-2, 2-3, 2-4, and 2-5). Genotyping of these natural populations was performed using the aforementioned KASP marker RVE7-A1-SNP-709269783. The specific steps are as follows:

[0069] (i) Extracting genomic DNA from wheat to be tested.

[0070] (ii) PCR amplification: Using the wheat genomic DNA to be tested as a template, PCR amplification was performed using the two forward primers labeled with different fluorescent groups and one reverse primer. The PCR amplification system was 10 mL, specifically containing: 2.0 μL DNA template (concentration of 50-200 ng / μL), 0.8 μL primer set (10 μM, with a volume ratio of RVE7-A1-SNP-709269783-G, RVE7-A1-SNP-709269783-T, and RVE7-A1-SNP-709269783-Common of 1:1:2), 5.0 μL 2×MasterMix, and 2.2 μL... ddH2O; The PCR reaction program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 65℃ annealing and extension for 40 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ per cycle; 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, 30 cycles, and incubation at 10℃.

[0071] (iii) Fluorescence signal reading: Fluorescence intensity scanning was performed on Araya, and the data was analyzed and read in SNPviewer software. When the detection result is blue, the base reading of SNP3 is G:G (the haplotype of wheat circadian rhythm gene TaRVE7-A1 is TaRVE7-A1-Hapl a or TaRVE7-A1-Hapl c); when the detection result is red, the base reading of SNP3 is T:T (the haplotype of wheat circadian rhythm gene TaRVE7-A1 is TaRVE7-A1-Hapl b); when the detection result is green, the base reading of SNP3 is heterozygous; when the detection result is pink, it represents no signal or a weak signal. The detection result of the blank control group (NTC, no DNA template added to the PCR amplification system) is black.

[0072] Genotyping results of the KASP marker RVE7-A1-SNP-709269783 in some wheat varieties are shown below. Figure 3 .

[0073] 3. Haplotype identification

[0074] according to Figure 1 The haplotype classification results shown are combined with the detection results of KASP markers at SNP2 and SNP3 sites in 256 natural population materials to classify the haplotypes of the above natural population materials. The classification results are shown in Tables 2-1, 2-2, 2-3, 2-4 and 2-5.

[0075] Table 2-1 Haplotype typing results of wheat TaRVE7-A1 from the 1st to the 34th samples

[0076]

[0077] Table 2-2 Haplotype typing results of wheat TaRVE7-A1 gene from the 35th to the 94th samples.

[0078]

[0079] Table 2-3 Haplotype typing results of wheat TaRVE7-A1 gene from the 95th to the 154th records.

[0080]

[0081] Table 2-4 Haplotype typing results of wheat TaRVE7-A1 from the 155th to the 214th samples.

[0082]

[0083] Table 2-5 Haplotype typing results of wheat TaRVE7-A1 gene from references 215 to 256

[0084]

[0085] III. Association Analysis between the wheat biological clock gene TaRVE7-A1 haplotype and yield traits

[0086] Association analysis was performed using the general linear model of the GAPIT package in R language, combined with haplotype data of the circadian clock gene TaRVE7-A1 from 256 natural population materials and phenotypic data of spikelet length and flag leaf length under seven environmental conditions (E1: Pula Valley, Laishan, Yantai, 2020; E2: Shijiazhuang, 2020; E3: Weifang, 2020; E4: Ludong University Experimental Base, 2021; E5: Pula Valley, Laishan, Yantai, 2021; E6: Shijiazhuang, 2021; E7: Muyu Village, Laishan, Yantai, 2023). The best linear unbiased estimate (BLUE) of each trait under the seven environmental conditions was calculated using the lme4 package in R language. The association analysis results of the wheat circadian clock gene TaRVE7-A1 haplotype and yield traits are shown in Tables 3-1 and 3-2.

[0087] Table 3-1 Results of association analysis between wheat circadian clock gene TaRVE7-7A haplotype and spikelet length

[0088]

[0089] Note: Different lowercase letters represent P <0.05 indicates a significant difference.

[0090] Table 3-2 Association analysis results between wheat circadian rhythm gene TaRVE7-7A haplotype and flag leaf length

[0091]

[0092] Note: Different lowercase letters represent P <0.05 indicates a significant difference.

[0093] From Tables 3-1 and 3-2, we can see that:

[0094] (1) Compared with the TaRVE7-A1-Hapl a type, the average spikelet length of the TaRVE7-A1-Hapl b type and the TaRVE7-A1-Hapl c type increased significantly by 58.63% and 42.64%, respectively; there was no significant difference in spikelet length between the TaRVE7-A1-Hapl b type and the TaRVE7-A1-Hapl c type.

[0095] (2) Compared with the TaRVE7-A1-Hapl a type, the flag leaf length of the TaRVE7-A1-Hapl b type and the TaRVE7-A1-Hapl c type increased significantly by 26.60% and 10.16% on average, respectively; compared with the TaRVE7-A1-Hapl c type, the flag leaf length of the TaRVE7-A1-Hapl b type increased significantly by 14.92% on average.

[0096] The above research results indicate that the KASP markers RVE7-A1-SNP-709269692 and RVE7-A1-SNP-709269783 have important application value in screening yield traits such as ear length and flag leaf length in wheat.

[0097] Based on the comprehensive performance of various traits, wheat of the TaRVE7-A1-Hapl b type exhibits superior agronomic traits and is a superior haplotype of wheat with potential value in the breeding of high-yield varieties.

[0098] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of this invention are still within the scope of protection of this invention.

Claims

1. Application of a molecular marker of a wheat clock gene TaRVE7-A1 in breeding a wheat TaRVE7-A1-Hapl b haplotype, characterized in that, The biological clock gene TaRVE7-A1 comprises three haplotypes of TaRVE7-A1-Hapla, TaRVE7-A1-Haplb and TaRVE7-A1-Haplc, and the molecular marker is a KASP marker, comprising RVE7-A1-SNP-709269692 and RVE7-A1-SNP-709269783, wherein: RVE7-A1-SNP-709269692 is amplified by two forward primers shown in SEQ ID NO: 9 and SEQ ID NO: 10 and one reverse primer shown in SEQ ID NO: 11, wherein the 5' end of the forward primer shown in SEQ ID NO: 9 is labeled with a FAM fluorescent group, the 5' end of the forward primer shown in SEQ ID NO: 10 is labeled with a HEX fluorescent group, the fluorescence intensity of the PCR amplification product is detected by using an online fluorescence detector, the data is analyzed and read in the SNPviewer software, when the result of the SNPviewer is blue, the haplotype of the wheat biological clock gene TaRVE7-A1 is TaRVE7-A1-Haplb or TaRVE7-A1-Haplc, and when the result of the SNPviewer is red, the haplotype of the wheat biological clock gene TaRVE7-A1 is TaRVE7-A1-Hapla; RVE7-A1-SNP-709269783 is amplified by two forward primers shown in SEQ ID NO: 12 and SEQ ID NO: 13 and one reverse primer shown in SEQ ID NO: 14, wherein the 5' end of the forward primer shown in SEQ ID NO: 12 is labeled with a FAM fluorescent group, the 5' end of the forward primer shown in SEQ ID NO: 13 is labeled with a HEX fluorescent group, the fluorescence intensity of the PCR amplification product is detected by using an online fluorescence detector, the data is analyzed and read in the SNPviewer software, when the result of the SNPviewer is blue, the haplotype of the wheat biological clock gene TaRVE7-A1 is TaRVE7-A1-Hapla or TaRVE7-A1-Haplc, and when the result of the SNPviewer is red, the haplotype of the wheat biological clock gene TaRVE7-A1 is TaRVE7-A1-Haplb; The TaRVE7-A1-Haplb haplotype has a longer ear stem length and flag leaf length than the TaRVE7-A1-Hapla haplotype, and a longer flag leaf length than the TaRVE7-A1-Haplc haplotype.

Citation Information

Patent Citations

  • Molecular marker of wheat biological rhythm clock gene TaPRR59-A1 and application of molecular marker

    CN118086577A

  • Molecular marker of wheat biological rhythm clock gene TaPRR59-B1 and application of molecular marker

    CN118086578A