InDel molecular marker for identifying population of Yunnan gold-veined maple and its application

Abstract

The application belongs to the technical field of species identification, and particularly relates to an InDel molecular marker for identifying a lophatherum gracile population and application. The application provides three InDel molecular markers MLP, LZ and WS for identifying the lophatherum gracile population for the first time. The molecular marker MLP is used for identifying the Malipu population of the lophatherum gracile, the molecular marker LZ is used for identifying the Laozhai population of the lophatherum gracile, and the molecular marker WS is used for identifying the Wenshan population of the lophatherum gracile. Primers for amplifying the molecular markers MLP, LZ and WS are designed, and a lophatherum gracile population identification method is developed. The method can not only accurately and effectively distinguish the plant material from the lophatherum gracile from the material of its close relative species, but also can simply and efficiently identify the geographical population type of the lophatherum gracile sample, and distinguish the Malipu population, the Laozhai population and the Wenshan population of the lophatherum gracile.

Description

Technical Field

[0001] The present invention belongs to the technical field of species identification, and in particular relates to an InDel molecular marker for identifying populations of Dalbergia yunnanensis and its application. Background Art

[0002] Yunnan maple ( Dipteronia dyeriana Henry is a deciduous tree of the genus Acer in the Sapindaceae family, and is a Class II protected plant in China. Its beautiful shape and coin-shaped fruit make it highly ornamental and suitable for urban landscaping. Its seeds are rich in oil, which can be extracted for both edible and industrial use. The current population of the Yunnan maple is limited to a few areas in Wenshan Prefecture and Honghe Prefecture in Yunnan Province, China.

[0003] Extant populations of the Yunnan maple (Dry Acer yunnanensis) can be classified into three genetic lineages: the Wenshan, Laozhai, and Malipo lineages. Studies have found that while phenotypic differentiation of the Yunnan maple has a genetic basis, environmental stress and plasticity play a greater role in its morphological variation. Traditional identification methods that rely solely on external morphology to distinguish Yunnan maple populations are time-consuming, susceptible to environmental and subjective factors, and yield low reliability. Therefore, developing molecular markers to distinguish different Yunnan maple populations is crucial for species conservation.

[0004] Although existing technologies have developed SNP molecular markers for identifying populations of D. difficile (D. chinensis) in Yunnan, using SNP markers requires resequencing of samples, resulting in large amounts of data and high demands on computing resources. Therefore, the development of a simple and efficient molecular marker for identifying populations of D. difficile (D. chinensis) in Yunnan is urgent. Summary of the Invention

[0005] In order to solve the above problems, the present invention provides an InDel molecular marker and application for identifying the population of Yunnan Golden Acer. The present invention provides three InDel molecular markers MLP, LZ and WS for identifying the population of Yunnan Golden Acer for the first time, then designs primer sets for amplifying the molecular markers MLP, LZ and WS, and develops a method for identifying the population of Yunnan Golden Acer. This method can not only accurately and effectively distinguish plant materials from Yunnan Golden Acer from materials of its closely related species, but also can simply and efficiently identify the population type of the Yunnan Golden Acer sample to be tested, which helps to better provide a basis for species protection and genetic diversity improvement of the rare and endangered plant Yunnan Golden Acer.

[0006] To achieve the above purpose, the specific technical solutions of the present invention are as follows:

[0007] In a first aspect, the present invention provides an InDel molecular marker for identifying a population of Dalbergia yunnanensis, wherein the molecular marker is at least one of the molecular markers MLP, LZ, and WS. The nucleotide sequence of the molecular marker MLP is shown in SEQ ID NO.3, the nucleotide sequence of the molecular marker LZ is shown in SEQ ID NO.4, and the nucleotide sequence of the molecular marker WS is shown in SEQ ID NO.5.

[0008] The molecular marker MLP was used to identify the Malipo population of Dalbergia chinensis in Yunnan, the molecular marker LZ was used to identify the Laozhai population of Dalbergia chinensis in Yunnan, and the molecular marker WS was used to identify the Wenshan population of Dalbergia chinensis in Yunnan.

[0009] The second aspect of the present invention provides a primer set for amplifying the InDel molecular marker for identifying the Yunnan maple population, the primer set consisting of a forward primer and a reverse primer;

[0010] The nucleotide sequence of the forward primer for amplifying MLP is shown in SEQ ID NO.6, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.7;

[0011] The nucleotide sequence of the forward primer for amplifying LZ is shown in SEQ ID NO.8, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.9;

[0012] The nucleotide sequence of the forward primer for amplifying WS is shown in SEQ ID NO.10, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.11.

[0013] The third aspect of the present invention provides a kit, which comprises any one or more of the primer set for amplifying MLP, the primer set for amplifying LZ, and the primer set for amplifying WS.

[0014] A fourth aspect of the present invention provides an application of the molecular marker or primer set in identifying populations of Acer yunnanensis.

[0015] A fifth aspect of the present invention provides an application of the molecular marker or primer set in distinguishing populations of Acer yunnanensis.

[0016] A sixth aspect of the present invention provides a method for identifying a population of Dalmatian yunnanensis, comprising the following steps:

[0017] The ITS sequence of the sample to be tested was compared with the ITS sequence of Dalmatian maple and the ITS sequence of Dalmatian maple related species to construct a phylogenetic tree;

[0018] According to the ITS sequence of the sample to be tested and the species clustering relationship on the phylogenetic tree, it is judged whether the sample to be tested is a Yunnan maple sample;

[0019] When the sample to be tested is a Yunnan maple sample, extracting DNA from the sample to be tested;

[0020] Performing PCR amplification on the extracted DNA of the sample to be tested using any one of the primer sets for amplifying MLP, the primer sets for amplifying LZ, or the primer sets for amplifying WS to obtain a PCR product;

[0021] The PCR products were analyzed by agarose gel electrophoresis, and the population type of the sample to be tested was determined according to the following judgment rules:

[0022] When using the primer set for MLP amplification, if a 263 bp band is shown on the agarose gel, the sample to be tested is the Malipo population of D. chinensis; or

[0023] When using the primer set for amplifying LZ, if a 457 bp band is shown on the agarose gel, the sample to be tested is the Laozhai population of D. chinensis; or

[0024] When the primer set for amplifying WS is used, if a 409 bp band is shown on the agarose gel, the sample to be tested is the Wenshan population of Acer truncatum in Yunnan.

[0025] Furthermore, the closely related species of the Yunnan maple are Acer yunnanensis, Acer sanguinea, Acer jianshii, Acer miaoshanensis, Acer ashleaf, Acer japonici, Acer jinsha, Acer tataricus, Acer jinsha and Acer mukorossi.

[0026] Furthermore, each 25 μL PCR amplification reaction system includes: 1 μL DNA template, 0.5 μL each of 10 μmol / L upstream primer and downstream primer, 2 μL 10× EasyTag® Buffer, 2.5 μL 2.5 mM dNTPs, 0.5 μL EasyTag" DNA Polymerase, and Nuclease-free water to make up.

[0027] Furthermore, the reaction procedure of the PCR amplification is as follows: (1) pre-denaturation; (2) denaturation at 95°C for 30s, annealing at 58°C-62°C for 30s, and extension at 72°C for 1min; 34 cycles; (3) extension at 72°C for 5min.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] Based on the genome of Yunnan maple and resequencing data of Yunnan maple populations from different geographical origins, the present invention provides for the first time three InDel molecular markers MLP, LZ and WS for identifying Yunnan maple populations. The molecular marker MLP is used to identify the Malipo population of Yunnan maple, the molecular marker LZ is used to identify the Laozhai population of Yunnan maple, and the molecular marker WS is used to identify the Wenshan population of Yunnan maple. Then, specific primer sets for amplifying the molecular markers MLP, LZ and WS are designed, and a method for identifying Yunnan maple populations is developed. This method can not only accurately and effectively distinguish plant materials from Yunnan maple from materials of closely related species, but also can simply and efficiently identify the geographical population type of Yunnan maple of the sample to be tested, and distinguish the Malipo population, Laozhai population and Wenshan population of Yunnan maple, providing strong support for studying the population distribution and genetic diversity of Yunnan maple.

[0030] (1) Efficiency and accuracy of species identification: The present invention uses ITS sequences to construct a phylogenetic tree of D. yunnanensis and its closely related species. By analyzing the position of the sample to be tested in the phylogenetic tree, the plant materials from D. yunnanensis and its closely related species can be accurately and effectively distinguished, thereby improving the efficiency and accuracy of species identification and providing a reliable basis for species identification of D. yunnanensis.

[0031] (2) Simplicity and practicality of operation: The identification method established in the present invention is simple, convenient and highly practical. By using a primer set that amplifies InDel molecular markers for PCR amplification and performing electrophoresis after amplification, the affiliation and origin of the Yunnan maple population can be accurately determined based on the band size in the electrophoresis pattern. The operation process is easy to master and implement, and does not require complex instruments and tedious operating steps. It is easy to promote in practical applications and provides a simple and efficient technical means for the protection and research of Yunnan maple.

[0032] (3) Positive significance for species protection: The molecular markers, primer sets and identification methods provided by the present invention are helpful for the species identification and population type identification of the national second-level protected plant, and provide a scientific basis for the species protection and genetic diversity improvement of the Yunnan maple. It can better understand the distribution range, population size and genetic structure of the Yunnan maple, so as to formulate more effective protection strategies, strengthen the protection of this rare species, and promote the recovery and growth of its population, which has important positive significance for maintaining biodiversity and ecological balance. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0034] 图1 Phylogenetic tree constructed for ITS sequences of Dalbergia yunnanensis and its closely related species.

[0035] 图2 Agarose gel electrophoresis diagram. 图2 Panel A is an agarose gel electrophoresis diagram of PCR using a primer set for amplifying MLP; 图2 Panel B is an agarose gel electrophoresis diagram of PCR using the primer set for amplifying LZ; 图2 Figure C is an agarose gel electrophoresis diagram of PCR using the primer set for amplifying WS; lane M is a DNA marker, and the samples in lanes 1 to 3 are from the Laozhai population of Yunnan maple, the Wenshan population of Yunnan maple, and the Malipo population of Yunnan maple, respectively. DETAILED DESCRIPTION

[0036] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0037] In the present invention, the Malipo population is marked as MLP, the Laozhai population is marked as LZ, and the Wenshan population is marked as WS.

[0038] The Yunnan maple is a national second-class protected plant. In recent years, its population has shrunk rapidly due to climate change and human deforestation. The existing populations of the Yunnan maple can be divided into three genetic lineages: Wenshan, Laozhai, and Malipo. Studies have found that although the phenotypic differentiation of the Yunnan maple has a certain genetic basis, environmental pressure and plasticity have a greater impact on its morphological variation. The traditional identification method that relies solely on external morphology to distinguish the Yunnan maple populations has a long cycle, is easily affected by environmental and subjective factors, and the reliability of the identification results is low. Therefore, the development of molecular markers for distinguishing different Yunnan maple populations is very necessary for the protection of the Yunnan maple species. Although the existing technology has developed SNP molecular markers for identifying Yunnan maple populations, the use of SNP markers requires resequencing of samples, which results in a huge amount of data and high requirements for computing resources. Therefore, it is urgent to develop a simple and efficient molecular marker for the identification of Yunnan maple populations.

[0039] The present invention provides an InDel molecular marker for identifying populations of Yunnan Golden Acer truncatum and its applications. The method first uses ITS sequence markers to construct a phylogenetic tree of Yunnan Golden Acer truncatum and its closely related species. By analyzing the position of the test sample in the phylogenetic tree, the method determines whether the test sample is Yunnan Golden Acer truncatum. This method can accurately and effectively distinguish plant materials from Yunnan Golden Acer truncatum from materials of closely related species. Simultaneously, based on the Yunnan Golden Acer truncatum genome and resequencing data from populations of different geographical origins, three InDel molecular markers, MLP, LZ, and WS, for identifying Yunnan Golden Acer truncatum populations were developed. The molecular marker MLP was used to identify the Malipo population of Yunnan Golden Acer truncatum, the molecular marker LZ was used to identify the Laozhai population of Yunnan Golden Acer truncatum, and the molecular marker WS was used to identify the Wenshan population of Yunnan Golden Acer truncatum. Primer sets were then designed to amplify the molecular markers MLP, LZ, and WS, and a simple and efficient method for identifying Yunnan Golden Acer truncatum populations was developed.

[0040] Example 1: Construction of a phylogenetic tree of Dalbergia yunnanensis and its related species based on ITS sequences

[0041] Using the genomic DNA of the sample to be tested as a template, PCR amplification was performed using a universal primer set for the entire plant ITS sequence. The ITS sequence of the sample to be tested obtained by PCR amplification was sent to Google Bio for ITS sequence determination.

[0042] The universal primer set includes an upstream primer ITS5 and a downstream primer ITS4. The nucleotide sequence of ITS5 is shown in SEQ ID NO.1, and the nucleotide sequence of ITS4 is shown in SEQ ID NO.2:

[0043] SEQ ID NO.1: 5'-GGAAGTAAAAGTCGTAACAAGG-3';

[0044] SEQ ID NO. 2: 5'-TCCTCCGCTTATTGATATGC-3'.

[0045] Each 20 μL PCR reaction system contained 0.3 μL of 5 U / μL Ampli Taq enzyme, 0.4 μL each of 10 μmol / L primers ITS5 and ITS4, 30 ng of DNA template, 3.2 μL of 2.5 mmol / L dNTP, and ddH2O.

[0046] The PCR amplification program was as follows: pre-denaturation at 97°C for 2 min; denaturation at 94°C for 1 min, gradient annealing at 55°C for 1 min, extension at 72°C for 1 min, for 30 cycles; and extension at 72°C for 20 min.

[0047] The ITS sequences of related species of Acer yunnanensis within the maple branch of the Sapindaceae family were searched in the GeneBank database with December 2024 as the cutoff date and the search terms "Dipteronia / Acer internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer2, complete sequence; and 26S ribosomal RNA gene, partial sequence". Eleven data sequences of 10 closely related species and 3 data sequences of Acer yunnanensis were obtained. Table 1 shows the ITS sequences of Acer yunnanensis and its related species downloaded from the GeneBank database. The ITS sequences obtained by sequencing the test samples and the ITS sequences searched in the GeneBank database were merged into a single dataset.

[0048] Table 1 ITS sequences of Acer yunnanensis and its related species in the Genebank database

[0049]

[0050] A phylogenetic tree of ITS sequences of closely related species of the Yunnan maple was constructed. The above-mentioned merged ITS sequence dataset was aligned using the clustalW module of the MEGA11 software. The aligned sequences were imported into the phylogenetic analysis module of the same software, and the phylogenetic tree was constructed using the maximum parsimony method. 1000 bootstrap tests were set as the support rate of each branch to ensure the reliability of the phylogenetic tree branches. The phylogenetic tree is shown in 图1 .

[0051] 图1 In the specific embodiment, according to the result of the phylogenetic tree containing the ITS sequence of the sample to be tested, whether the sample to be tested is Pterospermum yunnanense is determined by the clustering characteristics of the sample to be tested. In the example, the ITS sequences of two test samples are clustered in the same branch with the Pterospermum yunnanense sample sequence publicly disclosed on Genebank in the phylogenetic tree, and the branch support rate is close to 100%, so it can be judged that the two samples to be tested in the embodiment are from Pterospermum yunnanense plants.

[0052] Example 2: Development of InDel molecular markers for identifying Pterospermum yunnanense populations

[0053] The molecular marker MLP is used for identifying the Malipu population of Pterospermum yunnanense, the molecular marker LZ is used for identifying the Laozhai population of Pterospermum yunnanense, and the molecular marker WS is used for identifying the Wenshan population of Pterospermum yunnanense; the nucleotide sequence of the molecular marker MLP is shown in SEQ ID NO. 3, the nucleotide sequence of the molecular marker LZ is shown in SEQ ID NO. 4, and the nucleotide sequence of the molecular marker WS is shown in SEQ ID NO. 5.

[0054] SEQ ID NO. 3:

[0055] TAGCTTGCTGTTGTGTAATTTGTATTTTTTGTTATGGTCTAAGACGTATTAGTTTAGTTAAGTTGCAACTTAGTTCAATGATTAGTGGTGTTACGTAAGATTTGATGGTTTACACTTTATACACCGTCAGATATAGGCTGCTGTACTCGATGTTTTGACAGCTCTA TTTAGCTGTTTTACACCTTGTAACTGATGTATATATTGCCAAAATGAAAGATGA ATATTTAATTCAAAAAAAAAAAAAAAAAAAAAAGCAAGGGAAATTGTCTCTCTCT GTTATGCATATTGCTCTCAAAACCCAGAGATTCATGCTAGCTGTTTCAATGGTTTTATGTCTGTGTAATTTTTAAGTTTATGGTATGTTGATGTGCTG, the nucleotide sequence in the underlined sequence of SEQ ID NO. 3 of the Malipu population of Pterospermum yunnanense has a unique deletion.

[0056] SEQ ID NO. 4:

[0057] GTCATGCCACACCGATTTGTAATAAAAATGGATTGATATCTAATATAGGTGTCGAGATAAAATGGATTGATATCTAATTTAAATATCATATATATTACTTTTTTTAATCCTTATATCTAGTTATGAACTCTATCAATAAATAAAATATTTTTTTCATATATAAGAGAATTATTCTCTAGACTGAAAATTTCTTAATCCCTTATAC AATCTCGTTTTACAT CATCTCTTTCATAAGACTCCTATATTTGAAACATTTTCAAATTCCACAAGTAAATTGAACTATTATTACAAGATTA TTGGTTCAAAAAAAAAACTTAAT AATCATTTTAAAGAGTTTCTATTTTTTCCCAAATTATGACAATAACAAAAATAAAATAAATTTTTTTAGAATAATCTATATTAAATAAAAAGACCTAAAATTTCTTAACTCCTATATATCCATATTTCTCAAAAAATAATATACAAAATATTATCGTCATTAAAAAAATCAACTTAACATTACAACTGTTTGAATTTCTCTAAAAGAGTTTTTTTTTTTTTTTATGGACTTACTCCTTCAAACTGCCAAACCT,云南金钱槭老寨种群的SEQ IDNO.4所示序列中下划线上的核苷酸序列存在特有缺失。

[0058] SEQ ID NO.5:

[0059] GTTGCTCTAGGAACACGACATACAACAAGATTTAATGCTCGTTGATAACAATTAATAAAACCAACTTTTTCACCAAAACTAAATGGTAAGTATTCTACTGCAACCATTATAGCTAATTCTTCCCTATTTTTTTTCATCACTATATTTAAATAATTATTGGTTAGAAGTACACTACAAAAAGAAGGTCTTTTCCGACGGCTAAATGCCTTCGAAAATACCCTTTTCTGACGAGAAAAGGTTGTCGGAGGCCTTCACAAATACGCTCGTCGTAAATAACAATTTACCGACGAGCCGTCACAAATATGACCATTTTCGACGGTCAA GGCCGTCGGAAAAAAGAAACATGTCGTCGGTAATAGTAAATAGAGGTGG TCAAAATTATTAGTATTTCCAACAATTTACCTTTATTTCCGACGTGGATT GGCCGTCGGAAAAAGTTTAATGAAAATAAAAATCGTTATGCTGCCCAGCTAATTCTATGCACTTCATGTGGCTTGAAATCGTGACCT, the underlined nucleotide sequence in the sequence shown in SEQ ID NO. 5 of the Wenshan population of Dalbergia chinensis in Yunnan has a unique deletion.

[0060] Example 3: Design of Molecular Marker Primer Set

[0061] The present invention further designs a primer set for amplifying InDel molecular markers for identifying populations of D. yunnanensis, wherein the primer set consists of a forward primer and a reverse primer;

[0062] The nucleotide sequence of the forward primer for amplifying MLP is shown in SEQ ID NO.6, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.7;

[0063] The nucleotide sequence of the forward primer for amplifying LZ is shown in SEQ ID NO.8, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.9;

[0064] The nucleotide sequence of the forward primer for amplifying WS is shown in SEQ ID NO.10, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.11;

[0065] SEQ ID NO.6: 5'-TAGCTTGCTGTTGTGTAATTTGT-3';

[0066] SEQ ID NO.7: 5'-CAGCACATCAACATACCATAAACT-3';

[0067] SEQ ID NO.8: 5'-GTCATGCCACACCGATTTGT-3';

[0068] SEQ ID NO.9: 5'-AGGTTTGGCAGTTTGAAGGA-3';

[0069] SEQ ID NO.10: 5'-GTTGCTCTAGGAACACGACA-3';

[0070] SEQ ID NO. 11: 5'-AGGTCACGATTTCAAGCCAC-3'.

[0071] Example 4: Validation and application of molecular markers

[0072] Extract genomic DNA from the leaves of a Yunnan maple sample; perform PCR amplification on the extracted DNA using the primer set described in Example 3 to obtain a PCR product; determine the size of the PCR product by electrophoresis on a 3% w / v agarose gel, and determine the geographic population type of the Yunnan maple sample based on the size of the PCR product. The specific steps are as follows:

[0073] (1) Sample selection: Collect young, undegraded, and uneaten leaves of the Yunnan maple.

[0074] (2) Genomic DNA extraction: Use a plant sample DNA extraction kit to extract the total DNA of the sample to be tested.

[0075] (3) PCR amplification: The extracted DNA was subjected to PCR amplification using the primer set for amplifying MLP, the primer set for amplifying LZ, and the primer set for amplifying WS in Example 3, respectively, to obtain PCR amplification products.

[0076] Each 25 μL PCR amplification reaction system includes: 1 μL DNA template, 0.5 μL each of 10 μmol / L upstream and downstream primers, 2 μL 10× EasyTag® Buffer, 2.5 μL 2.5 mM dNTPs, 0.5 μL EasyTag® DNA Polymerase, and Nuclease-free water to make up.

[0077] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min; 34 cycles of denaturation at 95°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 1 min; and extension at 72°C for 5 min. The system temperature was lowered to 4°C to terminate the PCR amplification.

[0078] (4) Detection of amplified products: The amplified products were detected by 3w / v% agarose gel electrophoresis, and the geographical population type of the Yunnan maple to be tested was determined according to the following judgment rules.

[0079] The criteria are:

[0080] When using the primer set for MLP amplification, if a 263 bp band is shown on the agarose gel, the sample to be tested is the Malipo population of D. chinensis; or

[0081] When using the primer set for amplifying LZ, if a 457 bp band is shown on the agarose gel, the sample to be tested is the Laozhai population of D. chinensis; or

[0082] When the primer set for amplifying WS is used, if a 409 bp band is shown on the agarose gel, the sample to be tested is the Wenshan population of Acer truncatum in Yunnan.

[0083] (5) The test results are shown in Table 2 and 图2 shown.

[0084] Table 2 Test results

[0085]

[0086] From Table 2 and 图2 It can be seen that when the primer set for amplifying MLP was used, the PCR product size of the sample from the Malipo population of Yunnan golden maple was 263 bp, and the PCR product sizes of the samples from the Laozhai population of Yunnan golden maple and the Wenshan population of Yunnan golden maple were both 373 bp; when the primer set for amplifying LZ was used, the PCR product size of the sample from the Laozhai population of Yunnan golden maple was 457 bp, and the PCR product sizes of the samples from the Malipo population of Yunnan golden maple and the Wenshan population of Yunnan golden maple were both 572 bp; when the primer set for amplifying WS was used, the PCR product size of the sample from the Wenshan population of Yunnan golden maple was 409 bp, and the PCR product sizes of the samples from the Malipo population of Yunnan golden maple and the Laozhai population of Yunnan golden maple were both 509 bp.

[0087] It should be noted that when numerical ranges are mentioned in the present invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints may be selected. Since the steps and methods used are the same as those in the embodiments, in order to avoid redundancy, the present invention describes preferred embodiments. Although preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they understand the basic inventive concepts. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0088] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. An InDel molecular marker for identifying populations of Dalbergia yunnanensis, characterized in that: The molecular marker is at least one of the molecular markers MLP, LZ, and WS. The nucleotide sequence of the molecular marker MLP is shown in SEQ ID NO.3, and there is a deletion polymorphism in the 167 bp to 275 bp of the sequence shown in SEQ ID NO.3; the nucleotide sequence of the molecular marker LZ is shown in SEQ ID NO.4, and there is a deletion polymorphism in the 206 bp to 319 bp of the sequence shown in SEQ ID NO.4; the nucleotide sequence of the molecular marker WS is shown in SEQ ID NO.5, and there is a deletion polymorphism in the 324 bp to 422 bp of the sequence shown in SEQ ID NO.5; The molecular marker MLP was used to identify the Malipo population of Dalbergia chinensis in Yunnan, the molecular marker LZ was used to identify the Laozhai population of Dalbergia chinensis in Yunnan, and the molecular marker WS was used to identify the Wenshan population of Dalbergia chinensis in Yunnan.

2. A primer set for amplifying the InDel molecular marker for identifying the Yunnan maple population according to claim 1, characterized in that: The primer set consists of a forward primer and a reverse primer; The nucleotide sequence of the forward primer for amplifying MLP is shown in SEQ ID NO.6, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.7; The nucleotide sequence of the forward primer for amplifying LZ is shown in SEQ ID NO.8, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.9; The nucleotide sequence of the forward primer for amplifying WS is shown in SEQ ID NO.10, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

11.

3. A kit, characterized in that The kit comprises any one or more of the primer set for amplifying MLP, the primer set for amplifying LZ, and the primer set for amplifying WS described in claim 2.

4. Use of the primer set according to claim 2 or the kit according to claim 3 in identifying populations of Acer yunnanensis.

5. Use of the primer set according to claim 2 or the kit according to claim 3 in differentiating populations of Acer yunnanensis.

6. A method for identifying a population of Dalbergia yunnanensis, characterized in that: The following steps are involved: The ITS sequence of the sample to be tested was compared with the ITS sequence of Dalmatian maple and the ITS sequence of Dalmatian maple related species to construct a phylogenetic tree; According to the ITS sequence of the sample to be tested and the species clustering relationship on the phylogenetic tree, it is judged whether the sample to be tested is a Yunnan maple sample; When the sample to be tested is a Yunnan maple sample, extracting DNA from the sample to be tested; Performing PCR amplification on the extracted DNA of the sample to be tested using any one of the primer set for amplifying MLP, the primer set for amplifying LZ, or the primer set for amplifying WS in claim 2 to obtain a PCR product; The PCR products were analyzed by agarose gel electrophoresis, and the population type of the sample to be tested was determined according to the following judgment rules: When using the primer set for MLP amplification, if a 264 bp band is shown on the agarose gel, the sample to be tested is the Malipo population of D. chinensis; or When using the primer set for amplifying LZ, if a 458 bp band is shown on the agarose gel, the sample to be tested is the Laozhai population of D. chinensis; or When the primer set for amplifying WS is used, if a 410 bp band is shown on the agarose gel, the sample to be tested is the Wenshan population of Acer dactylum in Yunnan.

7. The method for identifying the population of Dalbergia yunnanensis according to claim 6, characterized in that: The closely related species of the Yunnan maple are Acer yunnanensis, Acer sanguinea, Acer jianshii, Acer miaoshanensis, Acer ashleaf, Acer japonici, Acer jinsha, Acer tataricus, Acer jinmoi and Acer mukorossi.

8. The method for identifying the population of Dalbergia yunnanensis according to claim 6, characterized in that: Each 25 μL PCR amplification reaction system includes: 1 μL DNA template, 0.5 μL each of 10 μmol / L upstream primer and downstream primer, Buffer 2μL, 2.5mM dNTPs 2.5μL, EasyTag"DNA Polymerase 0.5μL, add Nuclease-free Water.

9. The method for identifying the population of Dalbergia yunnanensis according to claim 6, characterized in that: The reaction procedure of the PCR amplification was as follows: (1) pre-denaturation; (2) denaturation at 95°C for 30s, annealing at 58°C to 62°C for 30s, and extension at 72°C for 1min; 34 cycles; (3) extension at 72°C for 5min.

Images