DNA probe for hybridizing with bacterial ribosome RNA as well as preparation method and application of DNA probe

Abstract

The invention provides a DNA probe for hybridizing with ribosome RNA and a preparation method and application thereof. The ribosome RNA in a bacterial RNA sample is removed by designing the DNA probe capable of hybridizing with the ribosome RNA, and the DNA probe is derived from a bacterial genome, can cover a plurality of sites of the ribosome RNA, has the characteristics of high efficiency, high specificity, low cost and the like, and can be used for analyzing mRNA or other non-coding RNA.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a DNA probe for hybridizing with bacterial ribosomal RNA, and a preparation method and application thereof. Background Art

[0002] The transcriptome is the collection of all RNA transcribed by a specific tissue or cell at a specific developmental stage or functional state. Transcriptome sequencing (RNA-Seq) is currently the most widely used high-throughput sequencing method. It can study gene function and structure at a global level, revealing the molecular mechanisms of specific biological processes and disease progression. Thanks to the gradually decreasing cost of high-throughput sequencing and the continuous innovation of RNA library construction technology, transcriptome sequencing has become the most time-saving, labor-saving, and cost-effective research method.

[0003] The total RNA in an organism is composed of approximately 90% ribosomal RNA (rRNA), approximately 1-2% mRNA, and approximately 8-9% other RNAs (such as microRNA and long-non-coding RNA). Ribosomal RNA accounts for the largest proportion of RNA. Because ribosomal RNA does not encode proteins, it is unnecessary in the data analysis process. These non-protein-encoding ribosomal RNAs significantly reduce the detection of low-abundance RNA and increase sequencing costs.

[0004] Existing methods for enriching mRNA or depleting rRNA primarily fall into the following categories: 1. Oligo d(T) magnetic bead-based "capture" of mRNA: Eukaryotic mRNA has a poly(A) structure, so oligo d(T) magnetic beads can be used to enrich mRNA. In this process, the RNA is first denatured to remove secondary structure and the poly(A) tail is hybridized with oligo(dT) molecules modified on the surface of the magnetic beads. After hybridization, RNA without polyadenylation is removed. The beads are then washed, and the mRNA is eluted by increasing the temperature. This method is only suitable for RNA with good integrity and species with a poly(A) tail structure. When the starting material comes from formalin-fixed paraffin-embedded (FFPE) samples, the FFPE RNA is degraded into smaller nucleic acid fragments, resulting in a significant loss of effective information during sequencing. 2. Removal of rRNA based on probe capture hybridization; The first method is RNase H enzyme-mediated rRNA depletion; This removal method uses a specific DNA probe to hybridize with rRNA under appropriate conditions to form an rRNA-DNA complex, and then uses RNase H enzyme (ribonuclease) to specifically cut the rRNA in the rRNA-DNA complex to achieve the purpose of removing rRNA. The second method is to hybridize a biotin-modified DNA probe with total cellular RNA to a specific area, and then streptavidin-coupled magnetic beads are combined with the biotin probe-rRNA complex, and the supernatant that does not contain ribosomal RNA is adsorbed by a magnetic stand. This method has high requirements for the starting amount of the sample, and the residual rRNA is higher than the first method. 3. Removal of rRNA based on double-stranded DNA nuclease (DSN), this method does not rely on probe synthesis. DSN can cut double-stranded DNA and DNA in DNA-RNA hybrids. Because cDNA-rRNA hybrids form earlier in the renaturation process, the addition of DSN can be timed to cleave the cDNA of highly abundant ribosomal RNAs, before less abundant mRNAs and other RNAs have formed double-stranded hybrids. The main disadvantage of this approach is that the removal is nonspecific and targets any highly abundant sequence. If the transcript of interest belongs to a higher copy number class, it may also be subject to DSN-mediated degradation.

[0005] Based on the RNase H-mediated rRNA depletion method described above, current methods for synthesizing DNA probes primarily include the following three approaches: The first is chemical synthesis: Probes are designed as single-stranded nucleotides (so-called oligomers) obtained through chemical synthesis, with lengths ranging from 6 to 100 bases. Most oligomers are 19-25 nucleotides in length. The most common chemical synthesis method is phosphoramidite synthesis, in which individual nucleotides bearing reactive groups react spontaneously, one base after another, in a predetermined sequence. The second is PCR: PCR is used to synthesize large quantities of specific double-stranded DNA fragments in vitro for use as double-stranded or single-stranded probes. PCR probes can be labeled during PCR by incorporating labeled DNA nucleotides or labeled primers. Alternatively, tags can be added post-PCR using nick translation or random priming. The third is recombinant DNA technology: Recombinant DNA technology is used to develop probes capable of hybridizing to targets larger than 150 nucleotides and is used when other probes or probe mixtures are not preferred. The desired probe is inserted as a DNA fragment into a specific vector, typically a plasmid or DNA phage. These constructs are transferred into qualified bacterial strains and can be propagated in large quantities during bacterial culture. Afterwards, double-stranded DNA fragments can be harvested from the DNA of the vector using molecular biology techniques. Artificial chromosomes that can be propagated in bacteria (BAC) or yeast (YAC) have been constructed using recombinant DNA technology. Single-stranded RNA or riboprobes with the desired polarity (sense or antisense) can be prepared using special recombinant plasmids. From the promoter of DNA-dependent RNA polymerase (from bacteriophage SP6 to T7), DNA-dependent RNA polymerase will synthesize single-stranded RNA probes. This technology is only used when oligonucleotides and / or PCR probes are not suitable.

[0006] How to provide a new method for synthesizing DNA probes and improve the efficiency of ribosomal RNA removal is one of the hot topics of concern to those skilled in the art. Summary of the Invention

[0007] The present invention provides a DNA probe for hybridizing with bacterial ribosomal RNA, a preparation method thereof, and application of the probe in preparing RNA libraries and sequencing.

[0008] The present invention also provides a method for removing ribosomal RNA from a bacterial RNA sample and application of the method in preparing an RNA library and sequencing.

[0009] In a first aspect, the present invention provides a method for preparing a DNA probe for hybridizing with bacterial ribosomal RNA, comprising:

[0010] A1) using the bacterial genomic DNA as a template, amplifying 16s rDNA and 23s rDNA, respectively, to obtain 16s rDNA amplification products and 23s rDNA amplification products, respectively;

[0011] A2) constructing a transposome, the transposome comprising a first DNA molecule, a second DNA molecule, and a transposase, wherein the first DNA molecule is formed by a first single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 5 and a third single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 7 according to the principle of complementary base pairing, and the second DNA molecule is formed by a second single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 6 and a third single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 7 according to the principle of complementary base pairing;

[0012] A3) mixing the transposome with the 16s rDNA amplification product and the 23s rDNA amplification product, respectively, and reacting them to obtain 16s rDNA fragmentation products and 23s rDNA fragmentation products;

[0013] A4) using the 16S rDNA fragmentation product and the 23S rDNA fragmentation product as templates, performing PCR amplification using a fourth single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 8 and a phosphorylation modification introduced at the 5' end and a second single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 6 to obtain a 16S rDNA fragmentation amplification product and a 23S rDNA fragmentation amplification product;

[0014] A5) digesting the 16s rDNA fragmentation amplification product and the 23s rDNA fragmentation amplification product using Lambda exonuclease to obtain 16s rDNA digestion products and 23s rDNA digestion products; collecting 300-500 nt 16s single-stranded DNA fragments and 300-500 nt 23s single-stranded DNA fragments from the 16s rDNA digestion products and the 23s rDNA digestion products, respectively;

[0015] A6) mixing the 16s single-stranded DNA fragment and the 23s single-stranded DNA fragment to obtain the DNA probe.

[0016] In one specific embodiment, in step A1), the bacterial genomic DNA can be extracted from the bacteria using a DNA extraction kit, and 16s rDNA and 23s rDNA can be amplified from the bacterial genomic DNA by PCR. Furthermore, the primer pair used to amplify 16s rDNA includes primer 16S_8F and primer 16S_1541R, wherein primer 16S_8F is a single-stranded DNA with a nucleotide sequence as set forth in SEQ ID NO: 1, and primer 16S_1541R is a single-stranded DNA with a nucleotide sequence as set forth in SEQ ID NO: 2; and the primer pair used to amplify 23s rDNA includes primer 23S_10F and primer 23S_2756R, wherein primer 23S_10F is a single-stranded DNA with a nucleotide sequence as set forth in SEQ ID NO: 3, and primer 23S_2756R is a single-stranded DNA with a nucleotide sequence as set forth in SEQ ID NO: 4.

[0017] The single-stranded DNA represented by SEQ ID NO: 1 consists of 20 nucleotides, and its nucleotide sequence is 5'-AGAGTTTGATCCTGGCTCAG-3'. The single-stranded DNA represented by SEQ ID NO: 2 consists of 20 nucleotides, and its nucleotide sequence is 5'-AAGGAGGTGATCCAGCCGCA-3'.

[0018] The single-stranded DNA shown in SEQ ID NO: 3 consists of 16 nucleotides, and its nucleotide sequence is 5'-YGGTGGATGCCTTGGC-3'; the single-stranded DNA shown in SEQ ID NO: 4 consists of 25 nucleotides, and its nucleotide sequence is 5'-YRCTTAGATGCTTTCAGCRBTTATC-3'; wherein Y represents either C or T base, and R represents either A or G base.

[0019] It is understood that in order to ensure the quality of the DNA probe prepared subsequently, in step A1), the mass of the 16s rDNA amplification product is not less than 10 μg, and the mass of the 23s rDNA amplification product is not less than 10 μg; if the mass of the PCR product obtained by the first round of PCR using the bacterial genomic DNA as a template is less than 10 μg, a second round of PCR amplification is required, and the amplification system and conditions are the same as those of the first round until the mass of the amplified product is not less than 10 μg.

[0020] In step A2), the transposase refers to an enzyme that can recognize specific sequences at both ends of a DNA fragment (transposon), detach or copy the DNA fragment (transposon) from its original site, and then insert it into a new DNA target site; further, the transposase used in the present invention can be Tn5 transposase.

[0021] In the present invention, the first DNA molecule and the second DNA molecule both include an ME sequence (transposase binding site), and the first DNA molecule, the second DNA molecule, and the transposase form a transposome. The transposome fragments the 16s rDNA amplification product and the 23s rDNA amplification product obtained in step A1) and adds adapter sequences (adaptor) at both ends to obtain 16s rDNA fragmentation modification products and 23s rDNA fragmentation modification products.

[0022] Furthermore, the first DNA molecule is formed by a first single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 5 and a third single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 7 according to the principle of base complementary pairing; the double-stranded DNA portion formed by the nucleotide sequence at positions 15-33 of the first single-stranded DNA molecule of SEQ ID NO: 5 and the third single-stranded DNA molecule of SEQ ID NO: 7 according to the principle of base complementary pairing is the ME sequence; the single-stranded DNA portion composed of nucleotides at positions 1-14 of SEQ ID NO: 5 is the first linker; under the action of transposase, the first linker can be connected to the 5' end of the 16s rDNA fragmentation product.

[0023] Furthermore, the second DNA molecule is formed by a second single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 6 and a third single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 7 according to the principle of base complementary pairing; the double-stranded DNA portion formed by the nucleotide sequence at positions 16-34 of the second single-stranded DNA molecule of SEQ ID NO: 6 and the third single-stranded DNA molecule of SEQ ID NO: 7 according to the principle of base complementary pairing is the ME sequence; the single-stranded DNA portion composed of nucleotides at positions 1-15 of SEQ ID NO: 6 is the second linker; under the action of transposase, the second linker is connected to the 3' end of the 16s rDNA fragmentation product.

[0024] Specifically, the first single-stranded DNA molecule shown in SEQ ID NO:5 consists of 33 nucleotides, and its nucleotide sequence is 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3', and is named Tn5ME-A; the second single-stranded DNA molecule shown in SEQ ID NO:6 consists of 34 nucleotides, and its nucleotide sequence is 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3', and is named Tn5ME-B; the third single-stranded DNA molecule shown in SEQ ID NO:7 consists of 19 nucleotides, and its nucleotide sequence is 5'-CTGTCTCTTATACACATCT-3', and is named Tn5MErev.

[0025] In the process of preparing the transposome, Tn5ME-A and Tn5MErev are first annealed to form a DNA molecule as the first DNA molecule, and Tn5ME-B and Tn5MErev are annealed to form a DNA molecule as the second DNA molecule. The first DNA molecule, the second DNA molecule and the transposase are mixed, mixed evenly and reacted at 25°C for 30 minutes to form the transposome.

[0026] Furthermore, the molar ratio of the first DNA molecule to the second DNA molecule is 1:1.

[0027] In step A3), the 16s rDNA amplification product and the 23s rDNA amplification product obtained in step A1) are respectively mixed with the transposome constructed in step A2), and the mixture is reacted at 55° C. for 15 minutes. After the reaction, the transposase is removed, and the DNA sample is collected to obtain fragmentation products of the 16s rDNA amplification product and fragmentation products of the 23s rDNA amplification product.

[0028] Furthermore, 20-30 ng of 16s rDNA amplification products and 23s rDNA amplification products were mixed with transposomes.

[0029] In step A4), PCR amplification is performed using the 16s rDNA fragmentation product and the 23s rDNA fragmentation product obtained in step A3) as templates, the fourth single-stranded DNA molecule shown in SEQ ID NO: 8 as a forward primer, and the second single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 6 as a reverse primer to obtain 16s rDNA fragmentation amplification products and 23s rDNA fragmentation amplification products.

[0030] Specifically, the fourth single-stranded DNA molecule shown in SEQ ID NO: 8 consists of 20 nucleotides, the nucleotide sequence of which is 5'-TCGTCGGCAGCGTCAGATGT-3', and the first nucleotide (T) at its 5' end is phosphorylated and named Tn5-AP.

[0031] In step A5), Lambda exonuclease digests double-stranded DNA phosphorylated at the 5' end in a 5' to 3' direction, producing single-stranded DNA. During the reaction, the 16S rDNA fragmented amplification product and the 23S rDNA fragmented amplification product obtained in step A4) are mixed with Lambda exonuclease, respectively, and reacted at 37°C for 30 minutes. After completion of the reaction, 16S rDNA digestion products and 23S rDNA digestion products are obtained.

[0032] Further, the 16s rDNA digestion product and the 23s rDNA digestion product are purified. Specifically, the ethanol precipitation method can be used, including the following steps: Step 1. Add 2 times the volume of pre-cooled anhydrous ethanol to the digestion product and mix well. Step 2. Continue to add 1 / 10 the volume of DNA sodium acetate and mix well. Step 3. Place the above solution in an ultra-low temperature refrigerator (-80 degrees Celsius) for 1 hour. Step 4. After taking out the solution, place it in a 4-degree Celsius refrigerated centrifuge, centrifuge at 13000rpm for 30 minutes, discard the supernatant, and do not discard the precipitate. Step 5. Add 500μL of pre-cooled 75% ethanol, centrifuge at 13000rpm for 10 minutes, and discard the supernatant. Step 6. Place it in a fume hood to dry, and add 10μl of nuclease-free water to dissolve it.

[0033] In step A6), 16S single-stranded DNA and 23S single-stranded DNA are mixed at a mass ratio of 1:1 to obtain the DNA probe.

[0034] In a second aspect, the present invention provides a DNA probe for hybridizing with bacterial ribosomal RNA, wherein the DNA probe is prepared according to the above method.

[0035] In a third aspect, the present invention provides use of the DNA probe prepared according to the above method in removing ribosomal RNA from a bacterial RNA sample.

[0036] In a fourth aspect, the present invention provides use of the DNA probe prepared according to the above method in preparing an RNA library.

[0037] In a fifth aspect, the present invention provides the use of the DNA probe prepared according to the above method in RNA sequencing.

[0038] In a sixth aspect, the present invention provides a method for removing ribosomal RNA from a bacterial RNA sample, comprising:

[0039] The bacterial RNA sample is mixed with the DNA probe prepared by the preparation method provided by the first aspect of the present invention, and the DNA probe is hybridized with the ribosomal RNA in the bacterial RNA sample to form a ribosomal RNA-DNA probe complex. After removing the ribosomal RNA hybridized with the DNA probe and the DNA probe, the ribosomal RNA in the bacterial RNA sample is removed.

[0040] In a specific embodiment, the mass ratio of the DNA probe to the bacterial RNA sample is 5:1; in addition, the mass of the bacterial RNA sample is generally not less than 100 ng.

[0041] During the hybridization process, the DNA probe, bacterial RNA sample, NaCl solution and Tris-HCl buffer were mixed, and the mixed system was placed at 95°C for 2 minutes, then gradually lowered to 45°C at a rate of 0.1°C per second, and then maintained at 45°C for 5 minutes. Finally, the temperature was lowered to 4°C and maintained to obtain a mixed system including a ribosomal RNA-DNA probe complex.

[0042] Ribonuclease H (RNase H) is added to the mixed system including the ribosomal RNA-DNA probe complex to digest the ribosomal RNA in the ribosomal RNA-DNA probe complex. The digestion reaction system includes ribonuclease H (RNase H), Tris-HCl buffer, NaCl solution, MgCl2 solution and nuclease-free water. The digestion reaction system is started at 60°C and reacted at 45°C for 30 minutes to obtain an RNase H digestion product.

[0043] Deoxyribonuclease I (DNaseI) was added to the above RNaseH digestion product to digest the DNA probe. The digestion reaction system included RNaseH digestion product, deoxyribonuclease I (DNaseI), buffer, and nuclease-free water. The digestion reaction system was started at 45°C, reacted at 37°C for 30 minutes, and maintained at 4°C to obtain a DNaseI digestion product.

[0044] The DNaseI digestion product is purified to obtain a bacterial RNA sample after the ribosomal RNA is removed.

[0045] In a seventh aspect, the present invention provides a method for preparing a bacterial RNA library, comprising: obtaining a bacterial RNA sample, removing ribosomal RNA from the bacterial RNA sample according to the method provided in the sixth aspect of the present invention, and constructing a bacterial RNA library using the bacterial RNA sample after removing the ribosomal RNA.

[0046] In one embodiment, the RNA library can be constructed as a strand-specific library.

[0047] In an eighth aspect, the present invention provides a method for sequencing bacterial RNA, comprising: obtaining a bacterial RNA sample, removing ribosomal RNA from the bacterial RNA sample according to the method provided in the sixth aspect of the present invention, and performing RNA sequencing on the bacterial RNA sample after the ribosomal RNA is removed.

[0048] In a ninth aspect, the present invention provides a kit for preparing a DNA probe that hybridizes with bacterial ribosomal RNA, comprising a first single-stranded DNA molecule, a second single-stranded DNA molecule, a third single-stranded DNA molecule, a fourth single-stranded DNA molecule, and a transposase;

[0049] The first single-stranded DNA molecule is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 5;

[0050] The second single-stranded DNA molecule is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 6;

[0051] The third single-stranded DNA molecule is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 7;

[0052] The fourth single-stranded DNA molecule is a single-stranded DNA having a nucleotide sequence as described in SEQ ID NO: 8, and a phosphorylation modification is introduced into the 5' end of the fourth single-stranded DNA molecule.

[0053] In a specific embodiment, the kit may further include Lambda exonuclease, reagents required for PCR amplification, buffer, etc.

[0054] In a tenth aspect, the present invention provides the following applications of the above-mentioned kit:

[0055] B1) Application in the preparation of DNA probes for hybridization with ribosomal RNA in bacterial RNA samples;

[0056] B2) Application in removing ribosomal RNA from bacterial RNA samples;

[0057] B3) Application in preparation of RNA libraries;

[0058] B4) Application in RNA sequencing.

[0059] The RNA provided herein is bacterial RNA, specifically Gram-positive or Gram-negative bacteria. For example, the Gram-negative bacteria may be Escherichia coli, and the Gram-positive bacteria may be Bacillus. The RNA sample may be total bacterial RNA, or an mRNA sample including ribosomal RNA, or other non-coding RNA samples.

[0060] The present invention provides a method for removing ribosomal RNA from bacterial RNA samples. The removal of ribosomal RNA from bacterial RNA samples is achieved by designing probes that can hybridize with ribosomal RNA. Since the probes are derived from the bacterial genome, they can cover multiple sites of ribosomal RNA and have the characteristics of high efficiency, high specificity, and low cost. The RNA sample obtained after the removal of ribosomal RNA can be used for the analysis of mRNA or other non-coding RNA (such as lncRNA). BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 A schematic diagram of a process for preparing a DNA probe according to an embodiment of the present invention;

[0062] Figure 2 The electrophoresis diagram of the amplified product of 16s rDNA and the amplified product of 23s rDNA in the method provided in one embodiment of the present invention;

[0063] Figure 3 This is an electrophoresis diagram of the product after rRNA removal obtained by the method provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0064] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the embodiments described are part of the embodiments of the present invention, not all of the embodiments, and they should not be understood as limitations on the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0065] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0066] The nucleotide sequences of the primers used in the following examples are shown in Table 1.

[0067] Table 1 Nucleotide sequences of primers involved in the examples

[0068] Primer name serial number Primer sequence (5'-3') 16S_8F SEQ ID NO: 1 AGAGTTTGATCCTGGCTCAG 16S_1541R SEQ ID NO:2 AAGGAGGTGATCCAGCCGCA 23S_10F SEQ ID NO:3 YGGTGGATGCCTTGGC 23S_2756R SEQ ID NO:4 YRCTTAGATGCTTTCAGCRBTTATC Tn5ME-A SEQ ID NO:5 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Tn5ME-B SEQ ID NO:6 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG Tn5MErev SEQ ID NO:7 CTGTCTCTTATACACATCT Tn5-AP SEQ ID NO:8 TCGTCGGCAGCGTCAGATGT

[0069] Note: In Table 1, Y represents either C or T, and R represents either A or G. Tn5-AP is a 5'-phosphorylated primer, meaning it has a phosphorylation modification at the 5' end and a phosphate group at the 5' end.

[0070] Example 1: Removal of ribosomal RNA from an RNA sample of Bacillus licheniformis strain CSL2 bacteria (genome accession number: GenBank: CP041154.1).

[0071] like Figure 1 As shown, the above method includes the following steps:

[0072] Step 1: Amplification of bacterial 16s rDNA and 23s rDNA

[0073] Total bacterial genomic DNA was extracted, and PCR amplification was performed using the bacterial genomic DNA as a template with the forward primer 16S_8F and the reverse primer 16S_1541R. The PCR amplification system is shown in Table 2, and the reaction conditions are shown in Table 3. The amplified product of bacterial 16s rDNA was obtained. The PCR amplification system is shown in Table 4, and the reaction conditions are shown in Table 5. The amplified product of bacterial 23s rDNA was obtained. The electrophoretic patterns of the amplified products of 16s rDNA and 23s rDNA are shown in Table 2. Figure 2 shown.

[0074] Table 2 16s rDNA PCR amplification system

[0075] Components Dosage Bacterial genomic DNA template 50ng 2x Taq Plus Master Mix (Nanjing Novozymes Biotechnology Co., Ltd. P212) 25 μl 10 μM 16S_8F 1 μl 10 μM 16S_1541R 1 μl Replenishment volume to 50 μl

[0076] Table 3 PCR amplification conditions for 16s rDNA

[0077]

[0078] Table 4 23s rDNA PCR amplification system

[0079] Components Dosage Bacterial genomic DNA template 50ng 2x Phanta Master Mix (Nanjing Novozymes Biotechnology Co., Ltd. P515) 25 μl 10 μM 23S_10F 1 μl 10 μM 23S_2756R 1 μl Replenishment volume to 50 μl

[0080] Table 5 PCR amplification conditions for 23s rDNA

[0081]

[0082] Step 2: Agarose gel electrophoresis band recovery

[0083] Prepare 2% agarose gel, electrophoresis at 150V for 20 minutes, and recover the target fragments, i.e., 1500bp of 16S rDNA amplification product, and 2800bp of 23S rDNA amplification product, to obtain 23S rDNA amplification product.

[0084] Step 3: Tn5 transposase cleavage

[0085] Step 3-1. Preparation of transposomes

[0086] Tn5ME-A, Tn5ME-B and Tn5MErev shown in Table 1 were synthesized. Tn5ME-A and Tn5MErev were mixed and annealed to obtain a first DNA molecule. Tn5ME-B and Tn5MErev were mixed and annealed to obtain a second DNA molecule.

[0087] According to the system shown in Table 6, Roubst Tn5 transposase, the first DNA molecule (concentration of 10 pmol / μL) and the second DNA molecule (concentration of 10 pmol / μL) were mixed, pipetted to mix, reacted at 25°C for 30 min to obtain transposomes, and stored at -20°C until use.

[0088] Table 6 Transposome construction

[0089] name Dosage first DNA molecule and second DNA molecule Total 4 μl 10x TPS buffer (purchased from Tianjin Qiangwei Biotechnology Co., Ltd.) 2 μl Roubst Tn5 transposase 4 μl <![CDATA[H2O]]> to 20 μl

[0090] Step 3-2: 16s rDNA and 23s rDNA ligation adapters

[0091] The 16S rDNA amplification product and the 23S rDNA amplification product recovered in Step 2 were mixed with the transposomes listed in Table 6, respectively. The mixed system is shown in Table 7. The mixed system was reacted at 55°C for 15 minutes. After the reaction, SDS was added to a concentration of 0.1% to separate the transposomes and DNA. DNA was collected by centrifugation and purified by adding 1x VAHTS DNA Clean Beads (purchased from Nanjing Novozymes Biotechnology Co., Ltd., Cat. No. N411). The specific steps are as follows: After adding an equal volume of magnetic beads, pipette to mix thoroughly and incubate at room temperature for 5 minutes. The sample was placed on a magnetic rack until the solution became clear. The supernatant was discarded and the beads were washed twice with 80% anhydrous ethanol. The beads were dried at room temperature, and the product was eluted with 22 μl of nuclease-free water and incubated at room temperature for 2 minutes. The sample was placed on a magnetic rack until the solution became clear. 20 μl of the product was transferred to a new PCR tube to obtain the 16S rDNA fragmentation product and the 23S rDNA fragmentation product, respectively.

[0092] Table 7 Reaction system of 16s rDNA and 23s rDNA adapter

[0093]

[0094]

[0095] Step 3-3: Introducing phosphorylation modification at the 5' end of the 16s rDNA fragmentation product and the 23s rDNA fragmentation product

[0096] PCR amplification was performed using Tn5-AP and Tn5ME-B as forward and reverse primers, and the 16s rDNA fragmentation product and 23s rDNA fragmentation product obtained in step 3-2 as templates. The PCR amplification system and reaction conditions are shown in Table 8-9.

[0097] Table 8 PCR amplification system with introduction of phosphorylation groups

[0098] Components Dosage 16s rDNA fragmentation products / 23s rDNA fragmentation products 50ng 2x Phanta Master Mix (Nanjing Novozymes Biotechnology Co., Ltd. P515) 25 μl Tn5-AP (concentration of 10 μM) 1 μl Tn5ME-B (concentration: 10 μM) 1 μl Replenishment volume to 50 μl

[0099] Table 9 PCR amplification conditions for introducing phosphorylation groups

[0100]

[0101] After PCR is completed, collect the PCR amplification products and add 1x VAHTSDNA Clean Beads to purify the DNA to obtain 16s rDNA fragmentation amplification products and 23s rDNA fragmentation amplification products; the specific implementation steps are as follows: 1. After adding an equal volume of magnetic beads, pipette to mix and place at room temperature for 5 minutes. 2. Place the sample on a magnetic stand until the solution becomes clear. 3. Discard the supernatant solution and add 80% anhydrous ethanol. 4. Repeat the above steps twice. 5. Dry the magnetic beads at room temperature, add 22μl nuclease-free water to elute the product, and place at room temperature for 2 minutes. 6. Place the sample on a magnetic stand until the solution becomes clear, and pipette 20μl of the product into a new PCR tube.

[0102] Step 3-4: Digestion of single-stranded DNA with Lambda exonuclease

[0103] Lambda exonuclease was added to the purified DNA product obtained in step 3-3 to digest the double-stranded DNA purified product obtained in step 3-3 into single-stranded DNA. The Lambda exonuclease digestion reaction system is shown in Table 10. The reaction system was pipetted and mixed with a pipette. The mixed system was instantaneously centrifuged, and the centrifuged product was reacted at 37°C for 30 minutes to obtain 16s rDNA digestion products and 23s rDNA digestion products.

[0104] Table 10 Lambda exonuclease digestion reaction system

[0105] Components volume 16s rDNA fragmentation amplification product / 23s rDNA fragmentation amplification product 5 μg Lambda Exonuclease Reaction Buffer(10x) 5μL Lambda exonuclease(ThermoFisher EN0562) 5μL (50U) Nuclease-free water Make up to 50 μL

[0106] The 16s rDNA digestion product and the 23s rDNA digestion product are subjected to a purification step, including: step 1, adding 2 times the volume of pre-cooled anhydrous ethanol to the digestion product and mixing; step 2, adding 1 / 10 the volume of DNA sodium acetate and mixing. Step 3, placing the above solution in an ultra-low temperature refrigerator (-80 degrees Celsius) for 1 hour. Step 4, after taking out the solution, place it in a 4 degrees Celsius refrigerated centrifuge, centrifuge at 13000rpm for 30 minutes, discard the supernatant, and do not discard the precipitate. Step 5, add 500μL of pre-cooled 75% ethanol, centrifuge at 13000rpm for 10 minutes, and discard the supernatant. Step 6, place it in a fume hood to dry, and add 10μl of nuclease-free water to dissolve. 300-500nt of 16s single-stranded DNA and 23s single-stranded DNA are obtained.

[0107] Step 4: Mix equal amounts of 300-500 nt 16s single-stranded DNA and 23s single-stranded DNA to obtain a DNA probe for hybridization with ribosomal RNA.

[0108] Step 5: Removal of ribosomal RNA (rRNA) from total bacterial RNA

[0109] Step 5-1. Hybridization of rRNA and DNA probes in bacterial total RNA samples

[0110] Total RNA samples of bacteria were extracted, and the total RNA samples were mixed with the DNA probe for hybridization with ribosomal RNA prepared in step 4 at a mass ratio of 5:1 according to the hybridization reaction system shown in Table 11. The mixed system shown in Table 11 was placed at 95°C for 2 minutes, then gradually lowered to 45°C at a rate of 0.1°C per second, and then maintained at 45°C for 5 minutes. Finally, the temperature was lowered to 4°C and maintained.

[0111] Table 11 Hybridization reaction system of rRNA and DNA probes in bacterial total RNA samples

[0112]

[0113]

[0114] Step 5-2: Digestion of rRNA with RNase H

[0115] To the reaction system in step 5-1, 3 μL of Hybridase Thermostable RNase H, 0.5 μL of 1 M Tris-HCl buffer, pH 7.5, 0.2 μL of NaCl solution (NaCl concentration is 5 M), 0.4 μL of MgCl2 solution (MgCl2 concentration is 1 M), and 0.9 μL of nuclease-free water were added to obtain a digestion reaction system with a total volume of 20 μL. The specific composition is shown in Table 12.

[0116] Table 12 Digestion reaction system

[0117] Components volume Product of step 5-1 15 μL Hybridase Thermostable RNaseH 3μL 1M Tris-HCl (pH 7.5) 0.5μL 5M NaCl 0.2μL <![CDATA[1M MgCl2]]> 0.4μL Nuclease-free water 0.9μL Total 20 μL

[0118] The digestion reaction system shown in Table 12 was mixed by pipetting, centrifuged briefly, and started at 60°C and reacted at 45°C for 30 min.

[0119] Step 5-3: Digestion of DNA probe with deoxyribonuclease I (DNase I)

[0120] To the reaction product of step 5-2, 6 μL of deoxyribonuclease I (DNase I) and 5 μL of 10X Reaction Buffer (both purchased from Nanjing Novozymes Biotechnology Co., Ltd., catalog number: EN401) and 19 μL of nuclease-free water were added to obtain a DNA probe digestion reaction system with a total volume of 50 μL. The specific composition is shown in Table 13.

[0121] Table 13 DNA probe digestion reaction system

[0122] Components volume Product of step 5-2 20 μL DNaseI 6μL 10X Reaction Buffer 5μL Nuclease-free water 19 μL Total 50 μL

[0123] The digestion reaction system shown in Table 13 was mixed by pipetting, centrifuged instantaneously, started at 45°C, and reacted at 37°C for 30 minutes. After the reaction, it was stored at 4°C.

[0124] Step 5-4, purification

[0125] Add 1.8 times the volume of VAHTS RNA Clean Beads (purchased from Nanjing Novozymes Biotechnology Co., Ltd., catalog number N412-02) to the reaction system obtained in step 5-3, pipette to mix, and place at room temperature for 5 minutes. Place the mixed system on a magnetic stand until the solution becomes clear. Discard the supernatant solution, add 80% anhydrous ethanol, and repeat this step twice. Dry the magnetic beads at room temperature, add 22μl nuclease-free water to elute the product, and place at room temperature for 2 minutes. Place the sample on a magnetic stand until the solution becomes clear, and draw 20μl of the product into a new PCR tube.

[0126] Step 5-5, quality inspection

[0127] The RNA sample concentration was measured to evaluate the rRNA removal efficiency. Figure 3 As shown, the rRNA removal efficiency reached 98.23%.

[0128] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A method for preparing a DNA probe for hybridization with bacterial ribosomal RNA, characterized in that: include: A1) using the bacterial genomic DNA as a template, amplifying 16s rDNA and 23s rDNA, respectively, to obtain 16s rDNA amplification products and 23s rDNA amplification products, respectively; A2) constructing a transposome, the transposome comprising a first DNA molecule, a second DNA molecule, and a transposase, wherein the first DNA molecule is formed by a first single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 5 and a third single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 7 according to the principle of complementary base pairing, and the second DNA molecule is formed by a second single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 6 and a third single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 7 according to the principle of complementary base pairing; A3) mixing the transposome with the 16s rDNA amplification product and the 23s rDNA amplification product, respectively, and reacting them to obtain 16s rDNA fragmentation products and 23s rDNA fragmentation products; A4) using the 16S rDNA fragmentation product and the 23S rDNA fragmentation product as templates, performing PCR amplification using a fourth single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 8 and a phosphorylation modification introduced at the 5' end and a second single-stranded DNA molecule having a nucleotide sequence of SEQ ID NO: 6 to obtain a 16S rDNA fragmentation amplification product and a 23S rDNA fragmentation amplification product; A5) digesting the 16s rDNA fragmentation amplification product and the 23s rDNA fragmentation amplification product using Lambda exonuclease to obtain 16s rDNA digestion products and 23s rDNA digestion products; collecting 300-500 nt 16s single-stranded DNA fragments and 300-500 nt 23s single-stranded DNA fragments from the 16s rDNA digestion products and the 23s rDNA digestion products, respectively; A6) mixing the 16s single-stranded DNA fragment and the 23s single-stranded DNA fragment to obtain the DNA probe.

2. A DNA probe for hybridization with bacterial ribosomal RNA, characterized in that: The DNA probe is prepared according to the method of claim 1.

3. Use of the DNA probe prepared by the preparation method according to claim 1 in removing ribosomal RNA from bacterial RNA samples.

4. Use of the DNA probe prepared by the preparation method according to claim 1 in preparing an RNA library.

5. Use of the DNA probe prepared by the preparation method according to claim 1 in RNA sequencing.

6. A method for removing ribosomal RNA from a bacterial RNA sample, characterized in that: include: The bacterial RNA sample and the DNA probe prepared by the preparation method according to claim 1 are mixed, and the DNA probe is hybridized with the ribosomal RNA in the bacterial RNA sample to form a ribosomal RNA-DNA probe complex. After removing the ribosomal RNA hybridized with the DNA probe and the DNA probe, the ribosomal RNA in the bacterial RNA sample is removed.

7. A method for preparing a bacterial RNA library, characterized in that A bacterial RNA sample is obtained, and ribosomal RNA in the bacterial RNA sample is removed according to the method of claim 6, and a bacterial RNA library is constructed using the bacterial RNA sample after the ribosomal RNA is removed.

8. A method for sequencing bacterial RNA, characterized in that A bacterial RNA sample is obtained, and ribosomal RNA is removed from the bacterial RNA sample according to the method of claim 6, and RNA sequencing is performed on the bacterial RNA sample after the ribosomal RNA is removed.

9. A kit for preparing a DNA probe for hybridization with bacterial ribosomal RNA, characterized in that: comprising a first single-stranded DNA molecule, a second single-stranded DNA molecule, a third single-stranded DNA molecule, a fourth single-stranded DNA molecule, and a transposase; The first single-stranded DNA molecule is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 5; The second single-stranded DNA molecule is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 6; The third single-stranded DNA molecule is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 7; The fourth single-stranded DNA molecule is a single-stranded DNA having a nucleotide sequence as described in SEQ ID NO: 8, and a phosphorylation modification is introduced into the 5' end of the fourth single-stranded DNA molecule.

10. Use of the kit according to claim 9 in the following aspects: B1) Application in the preparation of DNA probes for hybridization with ribosomal RNA in bacterial RNA samples; B2) Application in removing ribosomal RNA from bacterial RNA samples; B3) Application in preparation of RNA libraries; B4) Application in RNA sequencing.

Images