Plasmodium falciparum detection composition based on RPA-PfAgo detection method, kit, detection method and application

Abstract

The invention provides a plasmodium falciparum detection composition based on an RPA-PfAgo detection method, a kit, a detection method and application, and belongs to the technical field of gene detection. According to the invention, a nucleic acid isothermal amplification technology RPA and a PfAgo technology are combined, a novel visual rapid detection method is developed, the method is used for detecting plasmodium falciparum, and the high-specificity nucleic acid cutting capability of the gene editing enzyme PfAgo technology and the isothermal rapid amplification advantage of the nucleic acid isothermal amplification technology are fully fused. The detection method disclosed by the invention is strong in specificity and high in sensitivity, the detection sensitivity reaches the level of 1 * 10 < 2 > copies / mu L, and target nucleic acid with extremely low concentration can be detected; and the detection can be completed within 60 minutes, so that the detection efficiency is improved, the detection result is intuitive and readable, the detection system conforms to the development trend of rapid and field detection, a detection system suitable for a resource limited environment is developed, and the innovation and development of a nucleic acid detection technology are promoted.

Description

Technical Field

[0001] The present invention relates to the field of gene detection technology, and in particular to a Plasmodium falciparum detection composition, kit, detection method and application based on the RPA-PfAgo detection method. Background Art

[0002] Malaria is a parasitic disease caused by Plasmodium that seriously endangers human health. It is listed as one of the three major global public health problems along with AIDS and tuberculosis. Plasmodium falciparum (Pf) is the most deadly malaria parasite and is most prevalent on the African continent. If not diagnosed and treated in time, Plasmodium falciparum malaria may develop into severe malaria within 24 hours and even cause death. According to statistics from the World Health Organization (WHO), 263 million cases of malaria and 597,000 deaths were reported worldwide in 2023, with Africa bearing the heaviest burden. The number of cases (246 million) and deaths (569,000) in the region accounted for 94% and 95% of the global total, respectively, and children under five years old accounted for 76% of malaria deaths in Africa. It is worth noting that malaria remains a major public health problem in Equatorial Guinea. In 2021, it was one of the five leading causes of death in the country, with a national infection rate of 23.5%. These data indicate that targeted interventions are urgently needed for high-risk populations to reduce transmission and mortality, and that early differential diagnosis of Plasmodium falciparum and timely and accurate treatment are key links in malaria prevention and control.

[0003] Currently, microscopic detection of Plasmodium parasites on blood smears and polymerase chain reaction (PCR) are commonly used methods for malaria diagnosis. However, a major challenge in malaria diagnosis and treatment is that many high-risk groups who require Plasmodium falciparum species identification and malaria resistance gene typing live in underdeveloped and remote areas, which often lack medical support or local medical institutions struggle to provide sufficient medical resources. These methods, due to their high dependence on professional expertise, time-consuming nature, and the need for large and expensive instruments, cannot meet the needs of point-of-care testing (POCT).

[0004] In this context, point-of-care (POCT) rapid testing (POCT) is particularly important: it can be performed directly at the patient's site, without the need for specialized equipment or complex technical training, enabling rapid and convenient point-of-care testing. The development of isothermal amplification technologies such as loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) has made POCT possible. These technologies eliminate the need for thermal cycling, significantly simplifying the testing process and accelerating nucleic acid amplification. LAMP is a rapid, efficient, and highly sensitive isothermal amplification technology that operates under isothermal conditions (60°C-65°C). However, the complexity of LAMP primer design and its high target sequence requirements make it impractical for universal application, especially for shorter target sequences with a high A:T ratio, as seen with malaria. Furthermore, the ultrahigh sensitivity of LAMP poses a significant challenge due to the risk of contamination from uncapping. RPA / RAA is currently the most commonly used isothermal amplification technology. Under conditions of 35°C-42°C, it only takes 30 minutes to produce a good amplification product and exhibits high sensitivity. The emergence of gene-editing enzymes such as the CRISPR / Cas system and Argonaute has also introduced new inspiration for the development of POCT. They all possess nuclease activity in vitro and can specifically cleave nucleotides through recognition, thereby enabling molecular detection. However, current technologies based on the CRISPR / Cas system or Argonaute do not yet have the ultra-high sensitivity required to directly detect ultra-low levels of nucleic acids extracted from biological samples, and require the use of nucleic acid amplification to achieve these detection requirements.

[0005] Therefore, there is an urgent need to develop a lower-cost diagnostic technology for Plasmodium falciparum that is both highly sensitive and does not require expensive equipment. Summary of the Invention

[0006] The present invention aims to provide a Plasmodium falciparum detection composition, kit, detection method, and application based on the RPA-PfAgo detection method. This method has strong detection specificity and high sensitivity, can be completed within 60 minutes, improves detection efficiency, makes the test results intuitive and easy to read, conforms to the development trend of rapid, on-site detection, and develops a detection system suitable for resource-limited environments, which is of great significance for the prevention and control of malaria.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a Plasmodium falciparum detection composition based on the RPA-PfAgo detection method, wherein the composition comprises the following sequence:

[0009] RPA upstream primer - SEQ ID NO. 3: ATTAAGTGTTCATAACAGACGGGTAGTCAT;

[0010] RPA downstream primer-SEQ ID NO.4: CCTCTGACATCTGAATACGAATGCCCCCAAA;

[0011] Probe—SEQ ID NO. 11: FAM-TTTTGATATTCTTATTAGCTTAGTT-BHQ1;

[0012] gDNA1-SEQ ID NO.15: P-CTAGCTTAGTTACGAT;

[0013] gDNA2-SEQ ID NO. 14: P-CTTTTTGATATTCTTA.

[0014] The present invention also provides an application of the Plasmodium falciparum detection composition based on the RPA-PfAgo detection method in the detection of Plasmodium falciparum.

[0015] The present invention also provides a Plasmodium falciparum detection kit based on the RPA-PfAgo detection method, wherein the Plasmodium falciparum detection kit comprises the above-mentioned Plasmodium falciparum detection composition based on the RPA-PfAgo detection method.

[0016] The present invention also provides an application of the Plasmodium falciparum detection kit in detecting Plasmodium falciparum.

[0017] The present invention also provides a method for visual detection of Plasmodium falciparum based on RPA-PfAgo, comprising the following steps:

[0018] (1)RPA reaction:

[0019] Prepare the RPA reaction system and incubate the reaction system at 37-42°C for 20-40 minutes;

[0020] (2) PfAgo reaction

[0021] Prepare the PfAgo reaction system and place the reaction system at 95°C for 20 to 40 minutes.

[0022] Preferably, in step (1), the RPA reaction system comprises the following components:

[0023] 29-30 μL ABuffer, 2-5 μL magnesium acetate, 2-3 μL forward primer, 2-3 μL reverse primer, 4-6 μL genomic DNA.

[0024] Preferably, in step (2), the PfAgo reaction system comprises the following components:

[0025] 10× Buffer 2~4μL, 40mM Mn 2+ 1~6μL, 10μM gDNA11~3μL, 10μM gDNA21~3μL, 200U / μLPfAgo 2~6μL, 10μM Reporter 0.5~1.5μL, DNA amplification product 2~6μL.

[0026] Preferably, the visualization includes a fluorescence detection method based on reading a fluorescence curve with a fluorescence reader or a naked eye observation method using an ultraviolet lamp to assist in observing a fluorescent tube signal.

[0027] The present invention also provides an application of the above-mentioned RPA-PfAgo-based Plasmodium falciparum detection method in Plasmodium falciparum detection.

[0028] The beneficial effects of the present invention compared with the prior art are:

[0029] (1) The present invention combines the nucleic acid isothermal amplification technology RPA and PfAgo technology to develop a robust, rapid and highly accurate RPA-PfAgo-based visualization detection method for Plasmodium falciparum. This method fully integrates the high specificity of nucleic acid cutting ability of the gene editing enzyme PfAgo technology and the isothermal rapid amplification advantage of nucleic acid isothermal amplification technology. PfAgo technology uses more stable DNA as a guide instead of RNA. It guides PfAgo to the target site through a short DNA guide chain for high-temperature cleavage. It can recognize and cut DNA sequences at almost any arbitrary site, achieving efficient detection of target nucleic acids and expanding the application range of gene editing PfAgo technology in the construction of biosensor platforms. The detection has strong specificity and high sensitivity, with a detection sensitivity of 1×10 2 The detection method is fast, with results as low as 1000 copies / μL, and can detect extremely low concentrations of target nucleic acids. Furthermore, the method is quick to complete, within 60 minutes, improving efficiency and making results intuitive and easy to read. This approach, in line with the trend toward rapid, on-site testing, allows for the development of a detection system suitable for resource-limited environments. This is of great significance for malaria prevention and control, and promotes innovation and development in nucleic acid testing technology.

[0030] (2) The present invention integrates the isothermal amplification (RPA) technology of nucleic acids and the PfAgo detection technology into a single-tube reaction, achieving highly sensitive, highly specific, and rapid detection of Plasmodium falciparum. The operation is simple, requiring no complex equipment or specialized personnel, and is suitable for rapid detection in resource-limited field environments. The present invention utilizes two visualization methods, FBDA (fluorescence detection based on fluorescence curves read by a fluorescence reader) and NEO (naked-eye observation using ultraviolet light to assist in observing fluorescent tube signals), developed based on the RPA-PfAgo detection method, to improve detection efficiency and lower the detection threshold. Compared with the gold standard optical microscopy (LM) examination method, the present invention has very good consistency. The accuracy of the RPA-PfAgo FBDA method is 98.08%, the sensitivity is 96.15%, the specificity is 100%, and the Kappa value is 0.962; the accuracy of the RPA-PfAgo NEO method is 93.27%, the sensitivity is 92.13%, the specificity is 94.23%, and the Kappa value is 0.865. It has good application prospects in the identification and monitoring of Plasmodium falciparum infection and in clinical environments with limited resources. It is of great significance for the prevention and control of malaria and the improvement of the scientificity and effectiveness of global public health governance. It provides strong support for responding to global public health challenges and better protecting human health. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0032] Figure 1 This is an operational flow chart of the RPA-PfAgo-based Plasmodium falciparum detection method in Example 1 of the present invention;

[0033] Figure 2 This is a diagram showing the RPA primer screening results of the RPA-PfAgo Plasmodium falciparum identification platform in Example 1 of the present invention;

[0034] Figure 3 Graph showing the gDNA screening results of the RPA-PfAgo Plasmodium falciparum identification platform in Example 1 of the present invention, wherein A is the enzyme cleavage fluorescence signal curve of two groups of gDNAs using the first probe; B is the enzyme cleavage fluorescence signal curve of two groups of gDNAs using the second probe;

[0035] Figure 4Graph showing the probe screening results of the RPA-PfAgo Plasmodium falciparum identification platform in Example 1 of the present invention; wherein A is the enzyme cleavage fluorescence signal amplification curve of the optimal gDNA combination of the two probes; B is the original enzyme cleavage fluorescence signal curve and the UV fluorescence tube signal graph of the optimal gDNA combination of the two probes;

[0036] Figure 5 Graph showing the specific detection results of the RPA-PfAgo Plasmodium falciparum identification platform in Example 1 of the present invention; wherein A is the enzyme cleavage fluorescence signal amplification curve for specific detection by the RPA-PfAgo Plasmodium falciparum identification platform; B is the reaction endpoint fluorescence value for specific detection by the RPA-PfAgo Plasmodium falciparum identification platform; C is the agarose gel electrophoresis result of the RPA amplification product; and D is the fluorescence tube signal under ultraviolet light for specific detection by the RPA-PfAgo Plasmodium falciparum identification platform.

[0037] Figure 6 Graph showing the optimization results of the RPA primer addition amount of the RPA-PfAgo Plasmodium falciparum identification platform in Example 1 of the present invention; wherein A is the enzyme cleavage fluorescence signal amplification curve for different RPA primer addition amounts; and B is the fluorescence value at the end point of the enzyme cleavage fluorescence signal reaction and a fluorescence tube signal graph under ultraviolet light for different RPA primer addition amounts.

[0038] Figure 7 Graph showing the optimization results of the RPA amplification temperature of the RPA-PfAgo Plasmodium falciparum identification platform in Example 1 of the present invention; wherein A is the enzyme cleavage fluorescence signal amplification curve for the optimized RPA amplification temperature; and B is the fluorescence value at the end point of the enzyme cleavage fluorescence signal reaction and the fluorescence tube signal under ultraviolet light for the optimized RPA amplification temperature;

[0039] Figure 8 Graph showing the optimization results of the amount of MgAc added to the RPA amplification of the RPA-PfAgo Plasmodium falciparum identification platform in Example 1 of the present invention; wherein A is the enzyme cleavage fluorescence signal amplification curve for the optimized MgAc addition amount; and B is the fluorescence value at the end point of the enzyme cleavage fluorescence signal reaction and the fluorescence tube signal graph under ultraviolet light for the optimized MgAc addition amount;

[0040] Figure 9 Graph showing the optimization results of the RPA amplification time of the RPA-PfAgo Plasmodium falciparum identification platform in Example 1 of the present invention; wherein A is the enzyme cleavage fluorescence signal amplification curve for the optimized RPA amplification time; and B is the fluorescence value at the end point of the enzyme cleavage fluorescence signal reaction and the fluorescence tube signal graph under ultraviolet light for the optimized RPA amplification time;

[0041] Figure 10Graph showing the optimization results of the probe addition amount of the RPA-PfAgo Plasmodium falciparum identification platform in Example 1 of the present invention; wherein A is the enzyme cleavage fluorescence signal amplification curve for the optimized probe addition amount of the PfAgo reaction system; and B is the enzyme cleavage fluorescence signal reaction endpoint fluorescence value and ultraviolet fluorescence tube signal graph for the optimized probe addition amount of the PfAgo reaction system;

[0042] Figure 11 Graph showing the optimization results of the gDNA addition amount in Example 1 of the present invention; wherein A is the enzyme cleavage fluorescence signal amplification curve for the optimized gDNA addition amount in the PfAgo reaction system; and B is the enzyme cleavage fluorescence signal reaction endpoint fluorescence value and the fluorescence tube signal graph under ultraviolet light for the optimized gDNA addition amount in the PfAgo reaction system;

[0043] Figure 12 Graph showing the optimization results of the amount of MnCl2 added in Example 1 of the present invention; wherein A is the enzyme cleavage fluorescence signal amplification curve for the optimized amount of MnCl2 added to the PfAgo reaction system; and B is the enzyme cleavage fluorescence signal reaction endpoint fluorescence value and the fluorescence tube signal graph under ultraviolet light for the optimized amount of MnCl2 added to the PfAgo reaction system.

[0044] Figure 13 Graph showing the optimization results of the amount of PfAgo enzyme added in Example 1 of the present invention; wherein A is the enzyme cleavage fluorescence signal amplification curve for the optimized amount of PfAgo enzyme added in the PfAgo reaction system; and B is the enzyme cleavage fluorescence signal reaction endpoint fluorescence value and ultraviolet fluorescence tube signal graph for the optimized amount of PfAgo enzyme added in the PfAgo reaction system;

[0045] Figure 14 Graph showing the sensitivity results in Example 1 of the present invention; wherein A is the enzyme cleavage fluorescence signal amplification curve of the sensitivity of the RPA-PfAgo Plasmodium falciparum identification platform; and B is the enzyme cleavage fluorescence signal reaction endpoint fluorescence value and ultraviolet fluorescence tube signal graph of the sensitivity of the RPA-PfAgo Plasmodium falciparum identification platform;

[0046] Figure 15 Graph showing the repeatability test results of the RPA-PfAgo Plasmodium falciparum identification platform in Example 1 of the present invention; wherein A is the original curve of the enzyme cleavage fluorescence signal of the repeatability test of the RPA-PfAgo Plasmodium falciparum identification platform; and B is the endpoint fluorescence value of the enzyme cleavage fluorescence signal reaction of the repeatability test of the RPA-PfAgo Plasmodium falciparum identification platform.

[0047] Figure 16 Graph showing the calculation method for specificity, sensitivity, and accuracy in Example 2 of the present invention. DETAILED DESCRIPTION

[0048] The following are detailed descriptions of the embodiments of the present invention. The embodiments are intended to explain the present invention and are not to be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, the techniques or conditions described in the literature within the art or the product specifications are used. Reagents or instruments used without manufacturer's indication are commercially available conventional products.

[0049] Example 1

[0050] Example 1 of the present invention provides a method for rapid visualization detection of Plasmodium falciparum based on RPA-PfAgo technology ( Figure 1 ), the specific steps are as follows:

[0051] 1. Sample Source

[0052] The standard blood spots of Plasmodium from imported malaria patients collected from the Wuhan Center for Disease Control and Prevention in Hubei Province from January 2022 to December 2023, and the standard blood spots of Plasmodium collected from blood samples of Plasmodium patients in the Malabo area of ​​Bioko Island, Equatorial Guinea from January 2011 to December 2022 by the Guangdong Provincial Medical Team to Aid Equatorial Guinea, donated by Dr. Li Jian from the Institute of Parasitology of Hubei University of Medicine, are presented. The present invention has been approved by the Ethics Committee of Hubei University of Medicine, the Ethics Committee of Wuhan Center for Disease Control and Prevention, the Ethics Committee of Malabo Regional Hospital, and the Ethics Committee of the Guangdong Provincial Medical Team to Aid Equatorial Guinea, with the ethics number 20221001268. In the process of clinical diagnosis and treatment, for patients suspected of Plasmodium infection, 3-5 mL of peripheral venous blood is collected from the patient after obtaining informed consent from the patient or his family, which is used to make thick and thin blood films, and confirmed by microscopic examination to form a clinical diagnosis report.

[0053] Light microscopy (LM) is known as the gold standard for malarial parasite detection. Blood samples from patients diagnosed with malarial parasite infection were prepared into dried blood spot samples using Whatman 903 filter paper and retained for this study. After the dried blood spots were naturally dried, they were sealed and packaged in vacuum ziplock bags to ensure one bag per person to avoid cross-contamination. After the samples were delivered to this laboratory, they were stored in an ultra-low temperature freezer at -80°C. Samples in the stored sample library were randomly selected. From the above samples, 52 samples that were positive for Plasmodium falciparum microscopy were randomly selected as the case group; at the same time, 52 dried blood spot samples prepared from normal human blood were selected as the control group for this experimental study.

[0054] 2. Extraction of Plasmodium genomic DNA

[0055] Use the Chelex 100 method to extract Plasmodium genomic DNA. First, prepare a 5% Chelex 100 suspension with Chelex 100 chelating resin. Weigh 5 g of Chelex-100 using an electronic balance, dilute to 100 mL with ddH2O, and store in a refrigerator at 4°C until ready to use.

[0056] Remove the samples and number them. Prepare a corresponding number of 1.5mL EP tubes and label each tube with the corresponding sample number. Use a hole punch to punch each dried blood spot into 3-5 small, 3mm diameter discs. Place these into the corresponding numbered 1.5mL EP tubes. Add 1mL of ddH2O to each tube, vortex the sample for 1 minute, and then place in a 4°C refrigerator to soak overnight.

[0057] The next day, remove it from the refrigerator, centrifuge it at 13,000 rpm for 3 minutes, and remove the supernatant. Add 200 μL of the prepared 5% Chelex-100 suspension to the EP tube and use a vortex shaker to oscillate the sample to mix it thoroughly. When aspirating the Chelex100 suspension, continue to mix it to ensure that the resin particles are evenly distributed in the solution. Use a 1000 μL pipette tip to ensure that the working solution contains 5% Chelex 100 resin when the tissue is lysed. Place the EP tube in a metal bath and heat it at 56°C for 2 hours. Take it out every half an hour and mix it once with a vortex shaker. After heating at 56°C, immediately raise the temperature to 98°C and continue heating for 10 minutes. After heating is complete, centrifuge it at 12,000 rpm for 3 minutes. The supernatant is the extracted genomic DNA. Place the extracted genomic DNA in an ultra-low temperature freezer for storage.

[0058] Sample selection

[0059] In the early stages of the project, microscopic examination results were recorded and blood spot samples were collected. From these blood spots, 52 clinical samples that were positive for Plasmodium falciparum microscopy were randomly selected as the case group, while 52 blood spot samples that were negative for Plasmodium falciparum were selected as the control group, for a total of 104 samples enrolled in the study. Genomic DNA was extracted from the clinical blood spots using the method described above.

[0060] 3. Design and screening of RPA primers

[0061] The 18S rRNA gene sequences of five Plasmodium species (P. falciparum, P. ovale, P. vivax, P. malariae, and P. knowlesi) were downloaded from the NCBI database (GenBank accessions M19173.1, AB182490.1, U07367.1, AF487999.1, and U83876.1, respectively). Sequence alignment was performed using MAGE 11 software. Based on the alignment, a region of sequence with high P. falciparum specificity was selected as the target region for amplification. Primer Premier 6 software was used to design P. falciparum-specific RPA primers within this region. Primer design followed the five principles outlined in the RPA Experimental Design Manual from TwistDx (UK). Three P. falciparum-specific RPA upstream primers and two P. falciparum-specific RPA downstream primers were obtained. Details are shown in Table 1. The designed upstream and downstream primers were arranged and combined to obtain 6 sets of RPA primers. The primer specificity was verified by primer-BLAST on the NCBI website, and then the primers were commissioned to GENEWIZ for synthesis.

[0062] Table 1 RPA primer sequences of Pf-18S rRNA gene

[0063]

[0064] After receiving the synthesized primer lyophilized powder, place the primer tube in a centrifuge according to the information marked on the primer tube and centrifuge at 12,000 rpm for 3 minutes. Then use ddH2O to dissolve the primer to a concentration of 10 μM. Use the basic RPA kit of Anpu Future (Changzhou) Biotechnology Co., Ltd. for amplification reaction. The preparation of the RPA pre-amplification system is carried out according to the instructions of the kit. The specific composition of the RPA pre-reaction system is shown in Table 2. Among them, B Buffer (magnesium acetate solution) is added last as a reaction catalyst. After completing the addition of the system components and tightening the reaction tube lid, turn the reaction tube upside down 8-10 times to fully mix all the components in the reaction system. Then perform instantaneous centrifugation, and finally place the reaction tube in a PCR instrument or thermostat and react at 37°C for 30 minutes.

[0065] Table 2 RPA pre-reaction system

[0066]

[0067] After the reaction, purify the RPA amplification product using a DNA purification and recovery kit, following the kit instructions. Then, detect the purified RPA amplification product by agarose gel electrophoresis. Take 5 μL of the purified supernatant and add it to a 2% agarose gel. Run the gel at a constant voltage of 120 V for 25 minutes. Finally, image the gel using a gel imager for analysis.

[0068] Image J software was used to quantify the intensity of the bands in the electrophoresis results and perform grayscale value analysis. Among the 6 pairs of Plasmodium falciparum specific primers composed of 3 upstream primers and 2 downstream primers, the best set of primers was selected for the following experiments. The results are as follows Figure 2 shown.

[0069] Figure 2 The results showed that F1R1, F3R1, F1R2, and F3R2 all produced single, bright, and clear expected bands. According to the grayscale analysis of the bands using ImageJ, the amplified product of F3R1 had the highest grayscale value, and therefore was selected as the optimal primer for the RPA-PfAgo method to identify Plasmodium falciparum.

[0070] 4. Design of probes and gDNA

[0071] RPA amplification enriches the target sequence, which is then identified by the PfAgo enzyme cleavage system. PfAgo can bind to gDNA to form a PfAgo-gDNA binary complex. Under the guidance of gDNA, the PfAgo-gDNA binary complex specifically recognizes the complementary target chain to form a ternary complex, activating the endonuclease activity of PfAgo, cutting the phosphodiester bond between the 6th and 7th nucleotides in the complementary region of the gDNA on the target chain, and completing the targeted cutting of the DNA substrate. After the PfAgo guide chain complex cuts the target sequence, the generated ssDNA product can serve as a new guide sequence cutting molecular beacon for PfAgo, resulting in a change in fluorescence intensity.

[0072] Based on the property that the PfAgo protein recognizes the target sequence under the guidance of gDNA, binds to the target sequence and activates PfAgo for cleavage, the present invention designed two fluorescent probes for the Plasmodium falciparum-specific region on the RPA amplification sequence of Plasmodium falciparum 18S rRNA, and designed two sets of gDNA for each probe, as shown in Table 3.

[0073] Table 3 Plasmodium falciparum specific probe sequences and gDNA sequences

[0074]

[0075]

[0076] When a sample contains Plasmodium falciparum, P. falciparum-specific fragments are amplified by the RPA reaction and enriched in the RPA amplification product. Guided by gDNA2 and gDNA1, PfAgo specifically cleaves the DNA template strand complementary to the gDNA2 and gDNA1 sequences, constituting the first round of enzyme cleavage. This cleavage generates a new 5′-phosphorylated single-stranded DNA (ssDNA) fragment, which then serves as a new guide DNA (gDNA) for PfAgo to initiate the second round of cleavage. The substrate for this second cleavage is a fluorescent probe, the ssDNA reporter, labeled with both a FAM fluorophore and a BHQ1 quencher. The fluorescent reporter is designed to confirm the occurrence of the first cleavage. Specific cleavage of the fluorescent reporter by PfAgo releases FAM, which is quenched by BHQ1, generating a fluorescent signal. When Plasmodium falciparum is absent from the sample, the RPA amplification product lacks DNA strands complementary to gDNA2 and gDNA1, preventing the first cleavage and generating no fluorescent signal.

[0077] 5. Screening of probes and gDNA

[0078] All probes and gDNA were synthesized by GENEWIZ. Place the probe and gDNA tubes in a centrifuge and centrifuge at 12,000 rpm for 3 minutes. Then, dissolve the probes and gDNA in ddH2O to a concentration of 10 μM according to the label on the tube and store the solution in a refrigerator at 4°C until use.

[0079] First, gDNA screening was performed on the two probes separately, and the best gDNA group was screened out for each probe. Then, the two probes were subjected to enzyme digestion reaction simultaneously using the best gDNA group obtained above. According to the fluorescence curve and fluorescent tube signal generated by the enzyme digestion reaction, a probe with better enzyme digestion effect was obtained. The pre-reaction system of the PfAgo fluorescence experiment is shown in Table 4. The reaction tube was reacted at 95°C for 30 minutes, and the fluorescence intensity was detected using a fluorescent PCR instrument. The instrument was set to read the fluorescence intensity every 60 seconds (excitation wavelength: 470-510nm). After the experiment, the data file was exported, and the data was statistically analyzed and plotted using Excel 2019 to obtain the best probe and gDNA.

[0080] Table 4 Pre-reaction system of PfAgo reaction

[0081]

[0082] gDNA guides PfAgo to recognize the target sequence, and then activates PfAgo to cut, which is a key factor in PfAgo cutting. In order to efficiently and accurately identify Plasmodium falciparum and guide PfAgo to effectively cut, the present invention designed two different fluorescent probes, and set two groups of gDNA for each probe. The amplification product of the best primer F3R1 screened out above was purified, and then the PfAgo enzyme digestion reaction was carried out. The gDNA was screened for each probe based on the enzyme digestion efficiency shown by the fluorescence curve. The enzyme digestion reaction of the two groups of probes was carried out successively, and the enzyme digestion efficiency of the two groups of gDNA under the same probe was observed. The results showed that for the first probe, the first group of gDNA had better cutting efficiency ( Figure 3 For the second probe, the second set of gDNA has better cutting efficiency ( Figure 3 Middle B).

[0083] In order to select the best probe from the two probes, the two probes were subjected to enzyme digestion reactions using the best gDNA combination obtained above. The enzyme digestion efficiency and enzyme digestion status of the two probes and their best gDNA combination were observed under exactly the same conditions. The results showed that the fluorescence curve obtained by probe 2 and its best gDNA combination had better enzyme digestion efficiency than that of probe 1 and its best gDNA combination ( Figure 4 A), and the background fluorescence signal is lower ( Figure 4 B) Probe 2 and its optimal gDNA combination showed better digestion efficiency.

[0084] 6. Specificity Verification

[0085] Through these studies, the optimal specific RPA primers, probes, and gDNA have been identified, and the RPA-PfAgo method for identifying Plasmodium falciparum has been preliminarily established. Before optimizing the method, its specificity must be verified. The optimal RPA primers were used to amplify positive control samples of four common human malarial parasites: P. falciparum, P. ovale, P. vivax, and P. malariae. After purification, the amplified products were analyzed by agarose gel electrophoresis, and the specificity of the RPA primers was verified by the banding patterns of the RPA amplified products.

[0086] The RPA amplified product was then subjected to a PfAgo enzyme digestion reaction, and the specificity of the probe and gDNA was verified based on the fluorescence results of the reaction. If no detection signal appeared in any of the Plasmodium samples except the Plasmodium falciparum sample, the next step of the experiment could be performed. The specificity experiment was repeated three times and performed on different days. The results were as follows: Figure 5 shown.

[0087] Figure 5The results showed that the RPA-PfAgo method for identifying Plasmodium falciparum was highly specific and no cross-reaction signals were observed when detecting other Plasmodium infections.

[0088] 7. Optimization of the amount of RPA amplification primers added

[0089] Insufficient primer dosage will limit the generation of RPA amplification products, while an appropriate increase in primer dosage can improve the amplification yield. However, excessive primers may lead to mismatches and non-specific amplification, increasing the risk of primer dimer formation. In order to determine the optimal primer addition amount for the RPA reaction, the present invention uses the DNA of the same Plasmodium falciparum positive sample as a template and adopts an RPA pre-reaction system to optimize the primer addition amount. A primer solution with a concentration of 10 μM was used in the experiment, and three different primer addition amounts of 1.0 μL, 2.0 μL, and 3.0 μL were set, and the RPA amplification reaction was carried out at 37°C for 30 minutes. The fluorescence signal was detected by the PfAgo fluorescence system to determine the optimal primer addition amount. Three sets of repeated experiments were designed for all optimization experiments to ensure the reliability of the results. The results are as follows: Figure 6 shown.

[0090] Figure 6 The results showed that the optimal fluorescence signal and the highest signal-to-noise ratio were obtained when the primer addition amount was 2.0 μL. Therefore, 2.0 μL was selected as the optimal primer addition amount for the RPA reaction.

[0091] 8. Optimization of RPA amplification temperature

[0092] According to the description in the kit manual, the suitable reaction temperature of RPA is between 37-42°C. According to reports, amplification can be achieved within one hour at a temperature as low as 25°C. Therefore, based on the optimal primer addition amount obtained above, in order to screen the optimal temperature for the RPA amplification reaction of the RPA-PfAgo falciparum Plasmodium identification method, the present invention sets five different amplification temperatures of 34°C, 36°C, 38°C, 40°C, and 42°C, amplifies for 30 minutes, and determines the optimal amplification temperature by detecting the fluorescence signal intensity through the PfAgo fluorescence system. The results are as follows: Figure 7 shown.

[0093] Figure 7 The results showed that the system could obtain the best fluorescence signal when the amplification temperature was 38°C. Therefore, 38°C was selected as the optimal amplification temperature in the RPA reaction.

[0094] 9. Optimization of MgAc addition for RPA amplification

[0095] MgAc (magnesium acetate) plays the role of an activator in the recombinase polymerase amplification (RPA) reaction, and its addition amount has a significant effect on the amplification efficiency. Therefore, based on the optimal primer addition amount and amplification temperature obtained above, in order to optimize the RPA amplification system and obtain the ideal amplification efficiency, it is necessary to optimize the addition amount of MgAc. In order to determine the optimal MgAc addition amount for the RPA amplification reaction, the present invention designed five groups of different MgAc addition amounts, namely 1.0μL, 2.0μL, 3.0μL, 4.0μL and 5.0μL. At the same time, a group of negative control groups with ddH2O as the template was set up, and the results are as follows: Figure 8 shown.

[0096] Figure 8 The results showed that when the amount of MgAc added was 3.0 μL, the enzyme digestion system achieved the best digestion efficiency and fluorescence signal. Therefore, 3.0 μL was selected as the optimal amount of MgAc added in the RPA amplification reaction.

[0097] 10. Optimization of RPA amplification time

[0098] In order to adapt to the fast, convenient and efficient characteristics of POCT, it is necessary to complete the detection in the shortest time and ensure the detection quality. This requires the RPA amplification reaction to obtain the best amplification product in the shortest time so that the subsequent enzyme cleavage reaction can obtain the best reaction effect. In order to screen the optimal amplification time of the RPA amplification reaction, the present invention sets five amplification times of 20min, 25min, 30min, 35min and 40min. Amplification is performed based on the optimal primer addition amount, optimal amplification temperature and optimal MgAc addition amount obtained above. The fluorescence signal intensity is detected by the PfAgo fluorescence system for analysis and judgment to obtain the optimal amplification time. The results are as follows: Figure 9 shown.

[0099] Figure 9 The results showed that when the RPA amplification time reached 25 minutes, the RPA amplification product could achieve the best enzymatic digestion efficiency and fluorescence signal of the PfAgo enzyme digestion system. Therefore, 25 minutes was set as the optimal amplification time for the RPA amplification reaction.

[0100] 11. Optimization of probe addition amount in PfAgo reaction system

[0101] The fluorescent probe acts as a reporter in the PfAgo reaction system. The higher the amount of probe, the higher the fluorescence value at the reaction endpoint, and the stronger the fluorescence emitted by the positive reaction tube under UV light. However, since the probe in the enzyme cleavage reaction reaches a certain length, the negative fluorescent reaction system with the addition of the fluorescent probe will also have a certain degree of fluorescence background, which gives the system a certain signal-to-noise ratio. Therefore, the fluorescence background of the fluorescent reaction system will also increase with the increase in the amount of probe added. If the amount of probe added is too high, the background is too high, the signal-to-noise ratio of the enzyme cleavage reaction system is high, the naked eye cannot distinguish the positive and negative reaction tubes under UV light, and the reaction results can only be interpreted by a fluorescent PCR instrument, which runs counter to the principle of convenience of POCT.

[0102] In order to obtain the best reaction performance of the RPA-PfAgo Plasmodium falciparum identification method, the present invention first optimizes the probe addition amount of the PfAgo reaction system. The present invention uses a pre-reaction system of the PfAgo enzyme cleavage reaction and sets four groups of different probe addition amounts, namely 0.5μL, 1.0μL, 1.5μL and 2.0μL. The fluorescence signal and fluorescence signal-to-noise ratio of the reaction endpoints of the four groups of different probe addition amounts are observed by the original fluorescence curve of the reaction and the fluorescent tube signal under ultraviolet light. The optimal probe addition amount of the PfAgo reaction system is determined by analysis and judgment. The results are as follows: Figure 10 shown.

[0103] Figure 10 The results showed that when the probe addition volume was 1.0 μL, the system could generate a sufficiently strong fluorescence signal while maintaining a low background signal, allowing the naked eye to clearly distinguish between positive and negative results. This relatively low probe dosage well met the requirements of clinical POCT. Therefore, 1.0 μL was selected as the optimal probe addition volume for the PfAgo reaction system.

[0104] 12. Optimization of gDNA addition amount in PfAgo reaction system

[0105] gDNA plays a vital role in guiding PfAgo to recognize target sequences and trigger its cutting activity, which is a key link in achieving the PfAgo cutting effect. In order to efficiently and accurately identify Plasmodium falciparum, guide PfAgo to perform effective shearing, and obtain the best reaction performance of the RPA-PfAgo Plasmodium falciparum identification method, the present invention optimizes the amount of gDNA added to the PfAgo reaction system. Based on the use of the above-mentioned optimal probe addition amount, the present invention dissolves the optimal gDNA group screened out in the previous article into a 10μM solution and sets four different groups of gDNA addition amounts, namely 1μL, 2μL, 3μL and 4μL, and observes the fluorescence signal at the reaction end point and the reaction rate of the fluorescence curve to obtain the optimal gDNA addition amount of the system. The results are as follows. Figure 11 shown.

[0106] Figure 11 According to the fluorescence signal at the reaction endpoint and the reaction rate of the fluorescence curve, it was concluded that 2 μL is the optimal gDNA addition amount for the PfAgo reaction system of the RPA-PfAgo Plasmodium falciparum identification method.

[0107] 13. Optimization of MnCl2 addition amount in PfAgo reaction system

[0108] MnCl2 acts as an activator in the cleavage reaction of PfAgo. In order to obtain the best reaction performance of the RPA-PfAgo Plasmodium falciparum identification method, the present invention optimizes the MnCl2 concentration of the PfAgo reaction system. Based on the optimal probe addition amount and the optimal gDNA addition amount obtained above, the present invention sets four groups of MnCl2 concentrations, namely 1mM, 2mM, 4mM and 8mM, that is, 0.75μL, 1.5μL, 3μL and 6μL of a 40mM MnCl2 solution are added to the system respectively. According to the fluorescence signal at the reaction end point and the reaction rate of the fluorescence curve, the fluorescence curve and the fluorescent tube signal are obtained to obtain the optimal MnCl2 concentration of the system, and the results are as follows. Figure 12 shown.

[0109] Figure 12 According to the fluorescence signal at the reaction endpoint and the reaction rate of the fluorescence curve, the fluorescence curve and the fluorescence tube signal showed that 4mM is the optimal MnCl2 concentration of the PfAgo reaction system in the RPA-PfAgo Plasmodium falciparum identification method.

[0110] 14. Optimization of PfAgo enzyme addition amount in PfAgo reaction system

[0111] PfAgo enzyme is the core element of the PfAgo enzyme cleavage reaction. In order to obtain the best reaction performance of the RPA-PfAgo falciparum Plasmodium identification method, the present invention optimizes the amount of PfAgo enzyme added to the PfAgo reaction system. Based on the optimal probe addition amount, optimal gDNA addition amount and optimal MnCl2 concentration obtained above, the present invention sets six groups of different PfAgo enzyme addition amounts, namely 3μL, 4μL, 5μL, 6μL, 7μL and 8μL. The optimal PfAgo enzyme addition amount is obtained based on the fluorescence signal at the reaction end point and the reaction rate of the fluorescence curve. The results are as follows: Figure 13 shown.

[0112] Figure 13 Based on the fluorescence signal at the reaction endpoint and the reaction rate of the fluorescence curve, the fluorescence curve and the fluorescence tube signal indicate that when the PfAgo enzyme is added in an amount of 5 μL, the enzyme digestion rate and the best digestion effect are achieved. Therefore, 5 μL is used as the amount of PfAgo enzyme added to the PfAgo reaction system.

[0113] 15. Sensitivity test

[0114] (1) Construction of recombinant plasmid

[0115] A plasmid containing the RPA-amplified target fragment was constructed for sensitivity testing of the RPA-PfAgo Plasmodium falciparum species identification method. Appropriate regions upstream and downstream of the target fragment were extended. A 554-bp sequence containing the RPA-amplified target fragment (see SEQ ID NO. 16) was synthesized by GENEWIZ and cloned into the 2626-bp pUC-GW-Kan vector with kanamycin resistance to generate the recombinant plasmid Plasmid-Pf. The synthesized gene was then verified by Sanger sequencing.

[0116] (2) Sensitivity detection

[0117] The plasmid constructed in step (1) was dissolved in ddH2O to 10 10 The plasmid solution was diluted to obtain 1×10 9 copies / μL, 1×10 8 copies / μL, 1×10 7 copies / μL, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL and 1×10 1 Based on the optimal reaction system and reaction conditions obtained in the previous study, the 10 different concentrations of plasmid solutions obtained by gradient dilution were used as templates. The detection threshold of the optimized RPA-PfAgo Plasmodium falciparum identification method was determined by the fluorescence curve of the reaction and the fluorescent tube signal under ultraviolet light. Three experiments were performed on different days, and each experiment was repeated three times for each sample. The results are shown in the figure. Figure 14 shown.

[0118] Figure 14 The results show that the detection sensitivity of the RPA-PfAgo Plasmodium falciparum identification method of the present invention can reach 1.0×10 2 copies / μL

[0119] 16. Repeatable Experiments

[0120] Repeatability experiment is a key step to ensure the reliability, versatility and repeatability of research results. In order to show that the results of this experiment are reliable and repeatable, a repeatability experiment was carried out on the RPA-PfAgo Plasmodium falciparum identification method based on the optimal parameters obtained based on the previous study (the systems shown in Tables 5 and 6) and the reaction conditions of each system below Tables 5 and 6. Using exactly the same reaction system and reaction conditions, two negative and positive groups were designed and four repetitions were performed respectively. Each group used the same DNA sample as a template, and the original fluorescence curve of the reaction was observed to obtain the endpoint fluorescence value of the reaction. Based on the formula CV = (σ / μ) × 100%, that is, the coefficient of variation = (mean / standard deviation) × 100%, the coefficient of variation of the negative and positive groups of repeatability experiments was calculated respectively by the endpoint fluorescence value of the reaction, and the repeatability of the experiment was quantified. The repeatability of the RPA-PfAgo Plasmodium falciparum identification experiment was judged according to the consistency and coefficient of variation of the fluorescence curves of the samples in the same group. When the coefficient of variation is less than 10%, the data is considered to be relatively stable. It can be considered that the method has good repeatability and stability, the experimental operation is controlled, and the data stability is high. The results are as follows. Figure 15 shown.

[0121] Table 5 RPA reaction system

[0122]

[0123] RPA amplification conditions: reaction temperature 38°C, amplification time 25 min.

[0124] Table 6 Reaction system of PfAgo reaction

[0125]

[0126] PfAgo reaction conditions: 95°C for 30 minutes.

[0127] Figure 15 Based on the endpoint fluorescence values, the coefficient of variation for the repeatability test for this positive reaction was 1.7%, and the coefficient of variation for the repeatability test for this negative reaction was 2.6%. The repeatability test showed that the coefficient of variation (CV) of the RPA-PfAgo Plasmodium falciparum identification method was less than 5%, and the original fluorescence curves within the same group were highly homogeneous, with minimal data fluctuation. This demonstrates that the method has good repeatability and stability, the experimental operation is well controlled, and the data is highly stable.

[0128] Example 2

[0129] Example 2 of the present invention is based on the systems shown in Tables 5 and 6 of Example 1, and the reaction conditions of each system below Tables 5 and 6. The RPA-PfAgo Plasmodium falciparum identification method was used to perform a clinical evaluation on 104 clinical blood spot samples. The specific steps are as follows:

[0130] The results of the RPA-PfAgo method for identifying Plasmodium falciparum were analyzed against the results of the gold standard identification. By comparing the consistency between the RPA-PfAgo detection method and the gold standard detection results, the accuracy and reliability of this method were evaluated. The results are shown in Table 7 (the calculation method is shown in Figure 16 ).

[0131] The RPA-PfAgo amplification results were detected by the following methods:

[0132] Fluorescence detection method based on fluorescence reader reading fluorescence curve (FBDA): The PfAgo digestion reaction was carried out in an amplifier integrated with fluorescence reading function, and the fluorescence curve was generated in real time to judge the detection results.

[0133] Naked eye observation method (NEO) of ultraviolet lamp-assisted observation of fluorescence tube signal: After the RPA-PfAgo amplification was completed, the centrifuge tube was directly placed under the ultraviolet lamp and observed with the naked eye.

[0134] Table 7 Results of identifying Plasmodium falciparum in 104 clinical samples by the RPA-PfAgo method

[0135]

[0136] Compared with the identification results of the gold standard microscopy method in Table 7, the correct rate of the RPA-PfAgo FBDA method was 98.08%, the sensitivity was 96.15%, the specificity was 100%, and the Kappa value was 0.962. The consistency between the two methods was very good. The correct rate of the RPA-PfAgo NEO method was 93.27%, the sensitivity was 92.31%, the specificity was 94.23%, and the Kappa value was 0.865. The consistency between the two methods was very good.

[0137] Statistical analysis:

[0138] Data entry was completed using Microsoft Excel 2019, and then statistical analysis was performed using SPSS 27.0 software. To evaluate the differences between different detection methods and the gold standard, the detection results of each method were compared with the gold standard results to generate a contingency table. To quantify the consistency between methods, the Kappa value was introduced as an evaluation index. The specific classification criteria are as follows: (1) Kappa value ≤ 0.2: Poor consistency; (2) 0.2 < Kappa value ≤ 0.4: General consistency; (2) 0.4 < Kappa value ≤ 0.6: Moderate consistency; (3) 0.6 < Kappa value ≤ 0.8: Good consistency; (4) Kappa value > 0.8: Very good consistency. At the same time, the following indicators were calculated to evaluate the performance of the detection method:

[0139] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A Plasmodium falciparum detection composition based on the RPA-PfAgo detection method, characterized in that: The composition comprises the following sequence: RPA upstream primer-SEQ ID NO.3: ATTAAGTGTTCATAACAGACGGGTAGTCAT; RPA downstream primer-SEQ ID NO.4: CCTCTGACATCTGAATACGAATGCCCCCAAA; Probe—SEQ ID NO. 11: FAM-TTTTGATATTCTTATTAGCTTAGTT-BHQ1; gDNA1-SEQ ID NO.15: P-CTAGCTTAGTTACGAT; gDNA2-SEQ ID NO. 14: P-CTTTTTGATATTCTTA.

2. Use of the Plasmodium falciparum detection composition based on the RPA-PfAgo detection method as claimed in claim 1 in the detection of Plasmodium falciparum.

3. A Plasmodium falciparum detection kit based on the RPA-PfAgo detection method, characterized in that: The Plasmodium falciparum detection kit comprises the Plasmodium falciparum detection composition based on the RPA-PfAgo detection method according to claim 1.

4. Use of the Plasmodium falciparum detection kit according to claim 3 in detecting Plasmodium falciparum.

5. A method for visual detection of Plasmodium falciparum based on RPA-PfAgo, characterized in that: The steps include: (1) RPA reaction: Prepare the RPA reaction system and incubate the reaction system at 37-42°C for 20-40 minutes; (2) PfAgo reaction: Prepare the PfAgo reaction system and place the reaction system at 95°C for 20-40 minutes.

6. The method for visual detection of Plasmodium falciparum based on RPA-PfAgo according to claim 5, characterized in that: In step (1), the RPA reaction system includes the following components: 29-30 μL A Buffer, 2-5 μL magnesium acetate, 2-3 μL forward primer, 2-3 μL reverse primer, 4-6 μL genomic DNA.

7. The method for visual detection of Plasmodium falciparum based on RPA-PfAgo according to claim 5, characterized in that: In step (2), the PfAgo reaction system includes the following components: 10×Buffer 2~4μL、40mM Mn 2+ 1~4μL、10μM gDNA1 1~3μL、10μM gDNA2 1~3μL、200 U / μL PfAgo 2~6μL、10μM Reporter 0.5~1.5μL、DNA amplification product 2~6μL。 8. The RPA-PfAgo-based visualization detection method for Plasmodium falciparum according to claim 5, characterized in that: The visualization includes a fluorescence detection method based on reading a fluorescence curve with a fluorescence reader or a naked eye observation method using an ultraviolet lamp to assist in observing a fluorescent tube signal.

9. Use of the RPA-PfAgo-based Plasmodium falciparum detection method according to any one of claims 5 to 7 in detecting Plasmodium falciparum.

Images