Reagent composition for liver cancer detection, kit and application

Abstract

The invention relates to the technical field of biological detection, and discloses a reagent composition for liver cancer detection, a kit and application. The reagent composition provided by the invention comprises a combination of primers and probes for detecting the methylation states of the FAM109B gene, the RIMS2 gene, the SNX31 gene, the FAR1 gene and the FLJ26850 gene, so that the methylation state of a specific target sequence in the liver cancer characteristic gene can be detected, and the detection sensitivity and specificity of the liver cancer are at a relatively high level. The reagent composition provided by the invention can be used for noninvasive liver cancer screening, and during liver cancer screening, compared with conventional liver ultrasound and alpha fetoprotein combined detection, the detection sensitivity is greatly improved, the early screening accuracy of liver cancer is improved, and the misdiagnosis rate and missed diagnosis rate are greatly reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and in particular to a reagent composition, a kit and uses for liver cancer detection. Background Art

[0002] Primary liver cancer is a common malignant tumor. Early detection and diagnosis are crucial for improving overall survival rates. Currently, a variety of liver cancer detection and screening methods are available, but they still have numerous limitations. For example, liver ultrasound combined with alpha-fetoprotein (AFP) testing is the most widely used liver cancer screening method. This method offers advantages such as affordability, minimal equipment requirements, and ease of implementation in diverse regions with diverse medical conditions. However, ultrasound examinations are susceptible to operator technical experience and patient status (such as obesity), while AFP levels are associated with liver cancer lesion size and vascular invasion. Studies have found that approximately 30-40% of liver cancer patients are AFP-negative. Clinical statistics show that the sensitivity of liver ultrasound combined with AFP testing for early liver cancer detection is only 63%, and this method carries a significant rate of misdiagnosis and missed diagnoses. Commonly used liver cancer diagnostic methods also include imaging modalities such as CT and magnetic resonance imaging (MRI), but these are complex and require high-quality equipment, making them unsuitable for large-scale screening. A puncture biopsy is the gold standard for diagnosing liver cancer. It can clarify the nature of the lesion and the molecular classification of liver cancer. However, it is an invasive diagnosis and carries the risk of tumor rupture, bleeding, and dissemination. Moreover, this method cannot be used for early screening of liver cancer.

[0003] Therefore, there is an urgent need to develop non-invasive, convenient and highly accurate early screening technology to make up for the shortcomings of existing methods and improve the early diagnosis rate of liver cancer. Summary of the Invention

[0004] The present invention aims to overcome the aforementioned problems of the prior art by providing a reagent composition, kit, and use thereof for liver cancer detection. The composition provided by the present invention detects the methylation levels of specific genes, exhibiting high detection specificity and sensitivity, enabling efficient liver cancer screening.

[0005] In order to achieve the above object, the present invention provides a reagent composition for liver cancer detection, which comprises the following combination of primers and probes: (1) Detection FAM109B Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NOs: 7-8, and a probe with a nucleotide sequence as shown in SEQ ID NO: 9; (2) Detection RIMS2Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NOs: 10-11, and a probe with a nucleotide sequence as shown in SEQ ID NO: 12; (3) Detection SNX31 Primers and probes for gene methylation status: primers having nucleotide sequences as shown in SEQ ID NOs: 13-14, and a probe having a nucleotide sequence as shown in SEQ ID NO: 15; and / or primers having nucleotide sequences as shown in SEQ ID NOs: 25-26, and a probe having a nucleotide sequence as shown in SEQ ID NO: 27; (4) Detection FAR1 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NOs: 16-17, and a probe with a nucleotide sequence as shown in SEQ ID NO: 18; (5) Primers and probes for detecting the methylation status of the FLJ26850 gene: primers having nucleotide sequences as shown in SEQ ID NOs: 19-20, and a probe having a nucleotide sequence as shown in SEQ ID NO: 21.

[0006] A second aspect of the present invention provides a kit for detecting liver cancer, comprising the reagent composition described in the first aspect.

[0007] The third aspect of the present invention provides use of the reagent composition described in the first aspect in preparing a product for screening liver cancer.

[0008] Through the above technical solution, the present invention can achieve at least the following beneficial effects: (1) When the present invention performs joint detection on a combination of specific liver cancer characteristic genes, the screening effect for liver cancer is good, and the detection stability, specificity, and sensitivity all reach high levels.

[0009] (2) The composition of the present invention can be used for non-invasive early screening and diagnosis of liver cancer, which is beneficial to improving patient compliance, reducing the difficulty of detection, and has the potential for clinical application and promotion.

[0010] (3) When the composition / kit of the present invention is used for liver cancer screening, it has high detection sensitivity and specificity for both tissue samples and plasma samples, and has high cancer specificity, which reduces the misdiagnosis rate and missed diagnosis rate compared with existing liver cancer detection and screening methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 This is a graph showing the results of fluorescent quantitative PCR detection of a positive control with a methylation ratio of 0.5% at 10 ng / reaction using the kit of the preparation example in Example 1.

[0012] Figure 2 This is a graph showing the results of fluorescent quantitative PCR detection of a negative control at 20 ng / reaction using the kit of the preparation example in Example 1. DETAILED DESCRIPTION

[0013] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0014] In the present invention, "methylation level" and "methylation status" both refer to the methylation status of the target sequence in the marker gene (which may include whether the target sequence in the marker gene is methylated, the degree of methylation, etc.), have similar meanings, and can be used interchangeably.

[0015] Studies have shown that the methylation of specific genes is closely related to the occurrence of cancer. Currently, there are relatively limited genes in the field that are considered to be related to liver cancer, and most of them are detection schemes for the methylation of a single gene. However, studies have found that some genes are found to be methylated in multiple types of cancer. Testing the methylation level of a single gene is prone to misdiagnosis, and the screening effect for liver cancer is still not ideal. Missed screening, false positives, etc. occur frequently, and multiple other detection methods are still needed for joint diagnosis. In long-term research, the inventors of the present invention cleverly discovered that the method of jointly detecting the methylation levels of specific genes in liver cancer-related characteristic genes has good sensitivity and specificity, thereby effectively improving the screening accuracy.

[0016] Based on this, the first aspect of the present invention provides a composition for detecting liver cancer, which comprises a reagent for detecting the methylation status of liver cancer characteristic genes or fragments thereof, wherein the characteristic genes include FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 Gene.

[0017] The gene names involved in the present invention have general meanings in the art, and their complete sequences can be obtained by conventional means in the art, for example, by querying public biological information databases such as NCBI. For example, FAM109B The complete sequence of the gene can be found in Genbank accession number: NG_132550.1; RIMS2 The complete sequence of the gene can be found in Genbank accession number: NG_053027.1; SNX31The complete sequence of the gene can be found in Genbank accession number: AP001205.3; FAR1 The complete sequence of the gene can be found in Genbank accession number: NG_041826.1; FLJ26850 The complete sequence of the gene can be found in Genbank accession number: NG_141873.1.

[0018] The composition provided by the present invention can be directed to the complete FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 The methylation level of the gene can be detected, and the methylation level of some fragments (such as a single fragment or multiple fragments) in the above gene can also be detected. FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 The purpose of liver cancer screening at a high sensitivity and specificity level can be achieved by detecting and analyzing the methylation level of a specific region in the gene. Compared with the detection of the entire gene, the detection of a specific segment is simpler and easier, so the present invention preferably uses a specific region in the composition. FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 A reagent that detects the methylation level of a specific region in a gene.

[0019] According to some preferred embodiments of the present invention, the reagent for detecting the methylation status of a liver cancer signature gene or a fragment thereof is a reagent for detecting the methylation status of a CpG island region or a fragment thereof within a liver cancer signature gene. CpG is the abbreviation for cytosine (C)-phosphate (P)-guanine (G), and "CpG island" refers to a region of the genome rich in CpG dinucleotides.

[0020] The composition provided by the present invention can detect the methylation level in the complete sequence of the CpG island region in each of the aforementioned genes, or can detect the methylation level in a partial segment (such as a single fragment or multiple fragments).

[0021] According to some particularly preferred embodiments of the present invention, the reagent for detecting the methylation status of liver cancer characteristic genes or fragments thereof is a reagent for detecting the methylation status of gene fragments such as nucleotide sequences shown in SEQ ID NO:1-5 (also referred to as "target sequences" or "target sequences" in the present invention).

[0022] The composition of the present invention can detect the methylation level of the target sequence, or can detect the methylation level of a segment of a characteristic gene that has at least 80% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 100% homology to the target sequence, or a range consisting of any two of the above values, or any intermediate value within the range). For example, the methylation level of a gene segment containing additional nucleotides in addition to the above sequence can be detected.

[0023] According to a preferred embodiment of the present invention, the composition further comprises a reagent for detecting an internal standard. An "internal standard" refers to a non-target gene (or fragment thereof) that is detected together with the target gene (or fragment thereof). The addition of an internal standard detection reagent during detection can further improve detection accuracy. Typically, a known conserved gene in the target object (e.g., the sample being tested) can be selected as the internal standard.

[0024] Preferably, the internal standard is at least one of the human housekeeping genes. "Housekeeping genes," also known as "housekeeping genes" or "housekeeping genes," are a class of genes that are stably expressed in all cells.

[0025] According to a particularly preferred embodiment of the present invention, wherein the internal standard is ACTB gene (its complete sequence can be found in Gene Bank accession number: NC_000007.14) or its fragments. ACTB The gene "is the gene encoding human cytoskeletal actin (β-Actin).

[0026] Preferably, the target sequence of the internal standard is shown as SEQ ID NO:6.

[0027] In the present invention, the reagents used to detect the methylation levels of the characteristic genes and (optionally) the internal standard can be conventional reagents used in corresponding detection methods in the art. For example, detection can be performed using amplification-sequencing, biochips, methylation fluorescence quantitative PCR, etc. Correspondingly, the reagents commonly used in these methods can be used in the composition of the present invention.

[0028] For example, when methylation fluorescence quantitative PCR is used for detection, according to a preferred embodiment of the present invention, the composition includes nucleic acid primers and probes. "Methylation fluorescence quantitative PCR" refers to a method in which the region to be detected is subjected to sulfite conversion or digestion with a methylation-sensitive restriction endonuclease, followed by fluorescence quantitative PCR detection using primers and probes specifically designed for the detection target, thereby determining the methylation level of the region to be detected.

[0029] Any nucleic acid primer and probe capable of detecting the aforementioned characteristic genes and (optional) internal standards may be applicable to the present invention. "Primer" refers to an oligonucleotide that can serve as a starting point for synthesis when placed under conditions that can induce the synthesis of primer extension products complementary to a nucleic acid chain, i.e., in the presence of nucleotides and an inducer such as DNA or RNA polymerase and at a suitable temperature and pH. A primer typically contains at least about 9, 10, or 15, or 20, or 25 or more nucleotides. "Probe" refers to a nucleic acid sequence that can hybridize with a target sequence under specified conditions and can be used to detect the presence of the target sequence. The probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under stringent conditions. In order to obtain better detection results, according to a particularly preferred embodiment of the present invention, the composition comprises a combination of the following primers and probes: (1) Detection FAM109B Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NOs: 7-8, and a probe with a nucleotide sequence as shown in SEQ ID NO: 9; (2) Detection RIMS2 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NOs: 10-11, and a probe with a nucleotide sequence as shown in SEQ ID NO: 12; (3) Detection SNX31 Primers and probes for gene methylation status: primers having nucleotide sequences as shown in SEQ ID NOs: 13-14, and a probe having a nucleotide sequence as shown in SEQ ID NO: 15; and / or primers having nucleotide sequences as shown in SEQ ID NOs: 25-26, and a probe having a nucleotide sequence as shown in SEQ ID NO: 27; (4) Detection FAR1 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NOs: 16-17, and a probe with a nucleotide sequence as shown in SEQ ID NO: 18; (5) Detection FLJ26850 Primers and probes for detecting gene expression status: primers having nucleotide sequences as shown in SEQ ID NOs: 19-20, and a probe having a nucleotide sequence as shown in SEQ ID NO: 21.

[0030] Preferably, the composition further comprises: (5) Detection of internal standard ( ACTB gene): primers whose nucleotide sequences are shown in SEQ ID NOs: 22-23, and a probe whose nucleotide sequence is shown in SEQ ID NO: 24.

[0031] According to a preferred embodiment of the present invention, the probe is modified with a reporter group (typically located at the 5' end), preferably a fluorescent reporter group. Any fluorescent reporter group commonly used in the art can be used in the present invention, for example, ATTO 425, HEX, FAM, ROX, CY5, Quasar 705, AF405, and the like.

[0032] According to a preferred embodiment of the present invention, the probe is further modified with a fluorescence quencher (typically located at the 3' end). Any quencher commonly used in combination with a fluorescent reporter group in the art is suitable for use in the present invention. Examples include BHQ-0, BHQ-1, BHQ-2, SQ1, SQ2, and the like. Those skilled in the art are familiar with the pairing of fluorescent groups and their corresponding fluorescence quenchers, and will not be further elaborated here.

[0033] According to some preferred embodiments of the present invention, the composition further comprises a negative control reagent and / or a positive control reagent.

[0034] A negative control reagent refers to a target gene for detection that is not methylated (e.g., the aforementioned signature gene or fragment thereof). In the compositions provided herein, the negative control may contain only one verified signature gene or fragment thereof that is not methylated, or may contain multiple verified signature genes or fragments thereof that are not methylated.

[0035] A positive control reagent refers to a target gene known to be methylated (e.g., the aforementioned signature gene or fragment thereof). In the compositions provided herein, the positive control may contain only one validated signature gene or fragment thereof containing methylation, or may contain multiple validated signature genes or fragments thereof containing methylation.

[0036] In the composition provided by the present invention, both the negative control and the positive control can be obtained by conventional means, for example, by artificial synthesis.

[0037] A second aspect of the present invention provides a kit for screening liver cancer, wherein the kit comprises the composition described in the first aspect.

[0038] The kit provided herein may contain only core reagents for liver cancer detection (e.g., primers and probes used for the aforementioned signature gene detection), or may further include other conventional reagents required for the detection process (e.g., buffer systems, enzymes, nucleotides, and other reagents required for PCR detection; and reagents required for nucleic acid extraction, purification, and sample pretreatment for methylation detection). Any reagent commonly used in the art for signature gene detection is suitable for use in the present invention, and skilled artisans may select and adjust these reagents based on the actual detection technology used.

[0039] According to some preferred embodiments of the present invention, the kit further comprises at least one of an enzyme, a buffer, a magnesium source, and deoxyribonucleoside triphosphates (dNTPs).

[0040] Preferably, the enzyme comprises a methylation-sensitive restriction endonuclease and / or a DNA polymerase. Any enzyme that can be used in methylation fluorescence quantitative PCR is suitable for use in the present invention. Preferably, the methylation-sensitive restriction endonuclease comprises at least one of HpaII, HinP1I, and HhaI. Any DNA polymerase known in the art for methylation fluorescence quantitative PCR can be used in the present invention, for example, a conventional DNA polymerase or a hot-start DNA polymerase (such as Taq enzyme).

[0041] Preferably, the magnesium source comprises a water-soluble inorganic Mg salt. Typically, the magnesium source can be provided in the form of an aqueous solution, such as Mg 2+ Magnesium chloride, magnesium sulfate, magnesium nitrate, etc. with a concentration of 1-6mM.

[0042] More preferably, the kit further comprises reagents for nucleic acid extraction and / or purification.

[0043] Reagents for nucleic acid extraction and / or purification are primarily used to extract nucleic acids from samples, and the extracted nucleic acids are then tested using the reagents for detecting the methylation levels of characteristic genes contained in the kit of the present invention. Any reagent known in the art for extracting / purifying nucleic acids from biological samples is suitable for use in the present invention. These reagents can be purchased directly from commercial sources or prepared using existing techniques. The biological sample can be a test specimen collected from a subject in need, for example, at least one of a histological section, tissue biopsy / paraffin-embedded tissue, cells, or a blood sample (e.g., whole blood, plasma, etc.).

[0044] In the present invention, there is no particular limitation on the concentrations of the various reagents contained in the kit, and they can be adjusted according to actual detection needs.

[0045] In order to obtain better detection effects (such as improving sensitivity, specificity and accuracy, etc.), according to some preferred embodiments of the present invention, among the reagents contained in the kit, Mg 2+ The final concentration of the primer can be 1-6 mM; the final concentration of dNTPs can be 1-80 mM; the final concentration of the methylation-sensitive restriction endonuclease can be 0.01-30 U / μL; the final concentration of the primer can be 0.1-40 μM; and the final concentration of the probe can be 0.1-20 μM. The final concentrations of the primer and probe refer to the final concentration of one primer / probe.

[0046] The present invention further provides a method for detecting liver cancer, which comprises detecting a sample using the composition described in the first aspect or the kit described in the second aspect.

[0047] The methods provided by the present invention can be diagnostic methods or non-diagnostic methods. For example, a diagnostic method may include using the composition or kit provided by the present invention to test a sample from a subject in need, and determining whether the subject has a risk of liver cancer, thereby determining a subsequent diagnosis and treatment plan (e.g., whether to conduct further diagnosis and testing, whether to conduct further treatment, etc.). For another example, a non-diagnostic method may include using the composition or kit provided by the present invention to test a sample in research work or non-diagnostic testing work, such as using the composition or kit provided by the present invention to test a sample in work such as liver cancer mechanism research, drug development, etc.

[0048] The third aspect of the present invention provides use of the composition described in the first aspect in preparing a product for screening liver cancer.

[0049] A fourth aspect of the present invention provides FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 Use of a combined gene methylation status detection reagent in preparing a product for liver cancer detection.

[0050] According to some preferred embodiments of the present invention, the product for screening liver cancer may be a kit.

[0051] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the present invention, and are not intended to limit the present invention.

[0052] In the following examples, unless otherwise specified, all reagents and materials used were commercially available products purchased from regular chemical or biological reagent / material suppliers, and all reagents were of analytical grade.

[0053] Preparation Example 1. Determine the target gene and prepare the target sequence and primers and probes for detecting the target sequence by FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 The combination of genes is used as the characteristic gene, and its target sequence is as follows: GGATCGCCCTCTTGGGCTTCGGTGCGATCGGCGGCGGGAGGTGAGAGTGGGCCCGGCGGGCTCCGGGAGGAGGTGGCCCCAGGGAAGGTGTGGCCGCGGGGAAGTGGCGGCGAACAGCCCCGACGCGAGGACGGGGAAACCAAGGCGGCAGCCAGGGAGACCCTGACCGAGGTGACCTCTGTTTAGGGCGACAACCGGGTTGGGGCTCCCCGCAGTGGCCACTGGCCCGGCGGTCCCGCACCCCCAGCCCGCCTCTCCTCCA (SEQ ID NO:1, FAM109B Target sequence of the gene); GGCGGCGGCACTGAGCGGCGGCGGCGCAGGGCGCGCGGGCCTTCCGCGCCGACTCCATCGACCCAAGGGGCGGCGGCGGTGGCGGCGGCTGAGCGACCCTGGGCCGGGCGCGTGATGAGGAGGGGCCGGCGCCAGACCCCGCTGCACGTCGGAGCTCGCCTGGATCCGGGCGTTGGCAGCCGAAGGGCCCTGGCCCCGGGACTCTCCGCCGCTAGCCCCCGTCATATCTTCTCCGCTTTCGCTTCTCCACTCTAGCCGGGGGTGGGGTGGGTGGGG (SEQ ID NO:2, RIMS2 Target sequence of the gene); ACCGGGATACAGAAATGCATCTTCATGGCTGAGCGGTGTCTTGGGAGTAGCGCTGGGAACCCGACCTGCGGCGGCGGGCGGTGCGCGGCTCTGAACTCGGCAGCGGTGGACGCAGCGCGGCCTGCCACGCGACTCAGAGCGAACCCCGGCGCCCGCTCTCGCCGGCCGGGGACATCTACAGGTGGGGCCGGGGCCGGGCCGCGCCGCCTCCCAGTCCCCGCCCCATCCAGCCCCGCCGCTCTGGTCCCGGGATAGGTGGCGCCTGGGGCTGGGGCG (SEQ ID NO:3, SNX31 Target sequence of the gene); CCGTGGAGGCTCCAGGGGTCCGTAGAGCTCTTCGCTCTCACCGACCCGGGCCACACCCGCCAAGCTGGTAGTTCTCCGAACGGATCCCTCACGCCCAGCAATGGCCGGAGGGCCCCCGGGCCCCACCATAATAGCGCTAAGC ACGCCACAATGGCAGCCCCGCTGTCTCCCGCGCGGGCCTCGCTGCGTGCTCCCAACCTTGGGAGTTGGCGCCCCTCCCGCGCGACGGACAGCCGGGCGTGGCCCTGGGCGCGACCCGACAGGACGCCAGCAGCCGGCGG (SEQ ID NO:4, FAR1 target sequence of the gene); ACGTTCTGTAAGCCCCGCCCCACTGCGTGCGGGCGGCTTTTGTCTCCACGGCAACCGTCAACTCTGGAAACGCCTGTCTTTCTCCATGGCAACTGTCTACGCCGCAGGCTGGAGCTGCCCATTACCGGAGCCCGTAAGCAGTATGGGT GCTGGACAAACAGCGTGATCGGGTCGTAAAACTTGGTGGAAAACGAATATTAGAGCACAAGGAAGGAAAAACCGGGCTGGGTGGGACTGAAATAGTTGATGTGAGGGAAGATTTCTCAAAGGGAGACTATTTTTTTATTGTTTG (SEQID NO:5, FLJ26850 target sequence of the gene); by ACTB The gene is used as an internal standard to further improve the detection accuracy. The target sequence of the internal standard is as follows: TTTTTGGCTTGACTCAGGATTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTTTTTTTAATAGTCATTCCAAATATGAGATGCGTTGTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCACTTCTCTCTAAGGAGA ATGGCCCAGTCCTCTCCCAAGTCCACACAGGGGAGGTGATAGCATTGCTTTCGTGTAAATTATGTAATGCAAAATTTTTTTAATCTTCGCCTTAATACTTTTTTATTTTGTTTTATTTTGAATGATGAGCCTTCGTGCCCCCCTCCCCCTTTTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGA (SEQ ID NO:6, ACTB target sequence of the gene) The primers and probes used for detection are shown in Table 1 and were synthesized by Hunan Kangde Biotechnology Co., Ltd. In Table 1, the primers marked with "F" are upstream primers, the primers marked with "R" are downstream primers, and the primers marked with "P" are probes.

[0054] Table 1

[0055] 2. Prepare the unit reaction reagent kit for PCR reaction Prepare the corresponding reagents according to the required amounts of the unit reaction reagent kit (i.e., the reagent kit used to detect one sample in one PCR reaction) in Table 2.

[0056] Table 2

[0057] In Table 2, PCR amplification buffer was purchased from Hunan Kangde Biotechnology Co., Ltd. with the catalog number PCR buffer (S10); Taq enzyme was purchased from Feipeng Biotechnology Co., Ltd.; methylation-sensitive restriction endonuclease mix was MRE S01 purchased from Hunan Kangde Biotechnology Co., Ltd. with the catalog number ME012-01; the reagents were packaged separately according to the "PCR reaction solution" and "enzyme" in the table, that is, the PCR reaction solution was a mixture of the listed components, and the enzyme was a mixture of the listed enzymes.

[0058] 3. Prepare control reagents Negative control: artificially synthesized nucleic acid sequences of SEQ ID NO: 1-5, which were verified to be non-methylated by sequencing. The concentration of each negative control was 2 ng / µL.

[0059] Positive control: A mixture of target gene standard methylated human genomic DNA and target gene unmethylated human genomic DNA, including: 10% standard methylated human genomic DNA at a concentration of 1 ng / µL; 1% standard methylated human genomic DNA at a concentration of 1 ng / µL; and 0.5% standard methylated human genomic DNA at a concentration of 1 ng / µL.

[0060] 4. Prepare the kit According to the target detection volume of a single kit, mix and package the reagents prepared in steps 1-3.

[0061] Example 1 The kit of the preparation example was used to detect gene methylation levels on the standard sample to determine its sensitivity and specificity. The standard sample served as the positive control and negative control in the kit.

[0062] Specific detection methods include: Take the unit reaction reagent kit, mix the reagents in it in a PCR tube, add 10 μL of standard, mix well, place the PCR tube in the Macrostone fluorescent quantitative PCR analyzer, and perform PCR reaction according to the reaction conditions in Table 3.

[0063] Table 3

[0064] According to the fluorescent marker group labeled on the probe, select the FAM channel (Reportere: FAM, Quencher: None) for detection FAM109B ; Select ROX channel (Reportere:ROX, Quencher:None) for detection RIMS2 ; Select HEX channel (Reportere: HEX, Quencher: None) detection SNX31 ; Select AF405 channel (Reportere: AF405, Quencher: None) detection FAR1 ; Select ATTO 425 channel (Reportere: ATTO 425, Quencher: None) detection FLJ26850 ; Select the CY5 channel (Reportere:CY5, Quencher:None) to detect the internal standard.

[0065] After the reaction is completed, the instrument automatically saves the results and can be automatically analyzed using the instrument's built-in software (you can also manually adjust the baseline start value, end value, and threshold line value for analysis). The intersection of the amplification curve and the threshold line is called Ct (i.e., cycle threshold, which refers to the cycle value experienced when the fluorescence signal in the PCR reaction tube reaches the set threshold).

[0066] Figure 1 and Figure 2 The test results for a positive control (10 ng / reaction, with a methylation ratio of 0.5%) and a negative control (20 ng / reaction) are shown. As can be seen from the figure, each target gene exhibits a clear amplification curve in the positive control, while only the internal standard exhibits an amplification curve in the negative control. This demonstrates the excellent specificity of the kit of the present invention. Furthermore, the kit can detect even at such a low final concentration of the positive control, demonstrating its excellent sensitivity.

[0067] Example 2 The kit of the preparation example was used to test actual samples to verify its effect on the detection of liver cancer.

[0068] The test samples used in this example were all clinical samples collected from Xiangya Hospital of Central South University. Informed consent has been obtained from relevant personnel for the research content of this example.

[0069] The clinical samples used in this example include 200 clinical plasma samples (including 90 patients with liver cancer, 70 patients with hepatitis B, and 40 patients with other cancers) and paraffin section samples of cancer tissues from 50 patients with liver cancer.

[0070] Specific testing and verification methods include: (1) Sample processing Plasma cell-free DNA extraction kit (Shengxiang Biotechnology Co., Ltd., S4008) was used to extract nucleic acid (cfDNA) from plasma samples, and paraffin section extraction kit (Nanjing Novozymes Biotechnology Co., Ltd., DM601-01) was used to extract nucleic acid from liver cancer tissue samples.

[0071] (2) Sample testing and result analysis Methylation fluorescence PCR was performed on nucleic acids extracted from each sample according to the method described in Example 1. A Ct value of ≤32 for each target was considered positive; otherwise, it was considered negative. The sensitivity and specificity of the detection for different sample types were then calculated using the following formulas. The results are shown in Table 4.

[0072] Tissue sample detection sensitivity (%) = number of positive detections / total number of positive cases × 100% Plasma sample detection sensitivity (%) = number of positive detections / total number of positive cases × 100% Specificity of plasma sample detection (%) = total number of negative detections / total number of negative samples × 100% Table 4

[0073] Based on the test results in Table 4, the cancer type specificity was calculated according to the following formula (where negative samples refer to the total number of samples from all non-liver cancer patients): Cancer type specificity (%) = number of negative detections in other cancer patients / total number of other cancer patients × 100% = 90.0% From the above test results, it can be seen that the FAM109B 、 RIMS2 、 SNX31 、 FAR1、FLJ26850 The five-target combination markers have an extremely high sensitivity for detecting liver cancer tissue samples (reaching 98.0%), indicating that these five detection target combination markers are liver cancer tissue-specific methylation genes, which are closely related to liver cancer. The accuracy of liver cancer screening using them is high and the missed diagnosis rate is low; the target combination markers of the present invention were used to detect plasma samples from other cancer patients, and the specificity reached 90.0%, indicating that this detection system has good cancer specificity and a low misdiagnosis rate; the target combination markers of the present invention were used to detect plasma samples with a sensitivity of 90.0% and a specificity of 92.7%. The detection performance is better than ultrasound and AFP detection, providing an effective and accurate new method for liver cancer screening and diagnosis.

[0074] Example 3 According to the method in Example 2, the clinical samples used in Example 2 were tested, except that the marker gene in the kit was used to detect SNX31 The primers and probes for the target sequence were replaced with the primers and probes in Table 5 below (the primers and probes for other marker genes and internal standards remain unchanged. In Table 5, the primers marked with "F" are upstream primers, the primers marked with "R" are downstream primers, and the primers marked with "P" are probes).

[0075] Table 5

[0076] The test results of each clinical sample were judged and analyzed in the manner described in Example 2, and the detection sensitivity and specificity of different types of samples were calculated. See Table 6 for details.

[0077] Table 6

[0078] Comparative Example 1 The clinical samples used in Example 2 were tested according to the method in Example 2, except that the detection target sequence was replaced with the following target sequence ( FLJ26850 The gene and internal standard target sequences remain unchanged), the primers and probes for these target sequences are shown in Table 7 below (the primers and probes for the internal standard remain unchanged. In Table 7, the names marked with "F" are upstream primers, those marked with "R" are downstream primers, and those marked with "P" are probes).

[0079] GGAAGGCCATTCTAGGCTGCAGGAACTGCAAGGGCAAAGGCTCTGAGGCGGGAGCCAGGTTCATGGGCAGATGTTTGAGGACACCTCCGGCTTCCAGGGCCTTCCAGAAGTTCCAGTCTCTTGGGTTTGGTTGTGCATTC CTGCGACCTTCACCGCAGGCCTCCTCCTCCACCCACTAGTGCAGAGCCTGGGGGCTGCCGGTGGGTTTCAGGCCAGGGAAGCAGAAATGGGTAATTTCCAGAGCCAGAAATCAGCCGACCCCGGTGGCCCGGTGGG (SEQ ID NO:28, FAM109B replacement target sequence of the gene) GACACCCCAGGGACCCTTCCTCCCTCCTCACGTTCTCCCTCCTTCCAGGATCCCGCCCCGACACTTCGGGGCCCTCCCGCTACGCGCACTCTTTCTCCTCAGGTCCTGACACCTGGGCGCCCCCTCCCTGTCACCCACCTT CAGTCCCAGCCCTGACTCTCGGGCGCCTTGCCACCCTTACGCTCCCCGCCCCGCCCCGGTCCCTCGGGCGCCCCCACTCGCCGCCTCTACCTCCCTACCTGCTACACCTGGCACCCCTGCCCCCACCCCTGCTCATAC (SEQ ID NO:29, RIMS2 Replacement target sequence of the gene) GCGGGCACTGAAATGGGGCCCAGCATAGCCCCAGCGCCCTGCCAGGCGGCGCTAGCGGGGATCACCCGGCTGCAACTGCGAGGGGCTTGGAAGAATCACCTGCGCCCGGTTCCCTCATCTCACAGCTGTAGGCGACCAGG AGCCGCAGCATGCATTCATCCAACTGTATGCCAAGCAATTCAGTTCATCCTTACCAGGACCCTGTTTCACAATAGGAAGCCCGAGGCCGTGAAAGGCCCAGTGTCTTGCCAGAGTCAGAGGAACAGAGCGCTTTGG (SEQ ID NO:30, SNX31 Replacement target sequence of the gene) GCTCGGGCTGCAGGCCTGGCCGAGGCGGGGGCGCCGACCAGCCGTCCCGCCCCCGCCCCCGCCCGGGTACGCCCAGAAGTGAGGGCGCCCGCCTCACCCCGGGTGGTCTCTGCCCCTCTTTGCCCCGCCGCCGCCCTTCA CAGGGCCGGGACCGCGTGGGGGACGTACGGTGGGGCCTGGTTTGCAGCCGCGGAGCCCGGGGAGCCGCCTGGGGTGGGAGGCCGCTAGAGGTGGCGAAGGTGGGGCGGGGTGGTTAGCCGAGCAGCGGGCTCCGCG (SEQ ID NO:31, FAR1 Replacement target sequence of the gene) Table 7

[0080] The test results of each clinical sample were judged and analyzed in the manner described in Example 2, and the detection sensitivity and specificity of different types of samples were calculated. See Table 8 for details.

[0081] Table 8

[0082] A comparison of the data in Tables 4, 6, and 8 shows that when testing the liver cancer characteristic gene combination selected in the present invention, changes in the target sequence of each gene or changes in the primer probe for the same target sequence will lead to significant changes in the detection sensitivity and specificity. Moreover, such changes in the test results are difficult to predict and cannot be inferred based on existing test results.

[0083] Comparative Example 2 The clinical samples used in Example 2 were tested, and the detection method and judgment method were the same as those in Example 2. The difference was that the target gene was selected FAM109B 、 RIMS2 、 SNX31 、 FAR1、FLJ26850 and SEPT9 The diagnostic performance of combined detection of different target genes for liver cancer was compared by combining 4 or 5 genes in the test.

[0084] FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 The target sequences of the genes are shown in SEQ ID NOs: 1-5, and the primers and probes are shown in Table 1. SEPT9 The target sequence of the gene is Genbank ID NG_011683.2 (96463-96594), and its primers and probes are shown in Table 9 below.

[0085] Table 9

[0086] Note: The 5' end of ME-SEPT9-P is modified with a fluorescent reporter group, and the 3' end is modified with a corresponding fluorescent quencher group. The specific modified group depends on the fluorescent reporter groups modified on the probes of other genes to be jointly detected (so that the fluorescent reporter groups modified on this probe and the fluorescent reporter groups modified on the probes of other genes are detected using different channels).

[0087] The sensitivity and specificity of plasma sample detection when jointly detecting different target gene combinations were calculated using the method in Example 2. The results are detailed in Table 10.

[0088] Table 10

[0089] It can be seen from Table 10 that in the above target gene combined detection system, the detection results of different target gene combinations are different. Among them, the target gene combination selected by the present invention ( FAM109B, RIMS2, SNX31, FAR1, and FLJ26850 ) has the highest detection sensitivity and specificity, that is, among these combined detection systems, the missed diagnosis rate and misdiagnosis rate when using this combination for liver cancer screening are the lowest, indicating that this gene combination joint detection method for liver cancer screening is more suitable for promotion and application in clinical and research work.

[0090] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, various simple variations of the technical solution of the present invention may be made, including combining the various technical features in any other appropriate manner. These simple variations and combinations should also be regarded as disclosed in the present invention and fall within the scope of protection of the present invention.

Claims

1. A reagent composition for liver cancer detection, characterized in that: The reagent composition includes the following primer and probe combinations: (1) Detection FAM109B Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NOs: 7-8, and a probe with a nucleotide sequence as shown in SEQ ID NO: 9; (2) Detection RIMS2 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NOs: 10-11, and a probe with a nucleotide sequence as shown in SEQ ID NO: 12; (3) Detection SNX31 Primers and probes for gene methylation status: primers having nucleotide sequences as shown in SEQ ID NOs: 13-14, and a probe having a nucleotide sequence as shown in SEQ ID NO: 15; and / or primers having nucleotide sequences as shown in SEQ ID NOs: 25-26, and a probe having a nucleotide sequence as shown in SEQ ID NO: 27; (4) Detection FAR1 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NOs: 16-17, and a probe with a nucleotide sequence as shown in SEQ ID NO: 18; (5) Detection FLJ26850 Primers and probes for gene methylation status: primers whose nucleotide sequences are shown in SEQ ID NOs: 19-20, and a probe whose nucleotide sequence is shown in SEQ ID NO:

21.

2. The reagent composition according to claim 1, characterized in that The reagent composition further comprises primers and probes for detecting an internal standard, and the target sequence of the internal standard is shown in SEQ ID NO:

6.

3. The reagent composition according to claim 2, characterized in that The primers and probes for detecting the internal standard include primers whose nucleotide sequences are shown in SEQ ID NOs: 22-23, and a probe whose nucleotide sequence is shown in SEQ ID NO:

24.

4. The reagent composition according to any one of claims 1 to 3, characterized in that The probe is modified with a fluorescent reporter group and / or a fluorescent quencher group.

5. A kit for detecting liver cancer, characterized in that: The kit comprises the reagent composition according to any one of claims 1 to 4.

6. The kit according to claim 5, characterized in that The kit further comprises at least one of an enzyme, a buffer, a magnesium source, and deoxyribonucleoside triphosphates.

7. Use of the reagent composition according to any one of claims 1 to 4 in preparing a product for screening liver cancer.

Images