Recombinant yeast for expressing larimichthys crocea iridovirus MCP protein as well as preparation method and application of recombinant yeast in preparation of vaccine

Abstract

The invention discloses a recombinant yeast for expressing large yellow croaker iridovirus MCP protein and a preparation method and application of the recombinant yeast in preparation of vaccines, and is characterized in that the recombinant yeast is saccharomyces cerevisiae transformed with pYD1-MCP recombinant plasmids and is named as EBY100 / pYD1-MCP, the pYD1-MCP recombinant plasmids can express the MCP protein on a yeast surface display system, the nucleotide sequence of a gene segment of the MCP protein is shown as SEQ ID NO.1, the nucleotide sequence of the gene segment of the MCP protein is shown as SEQ ID NO.2, and the nucleotide sequence of the gene segment of the MCP protein is shown as SEQ ID NO.2. The preparation method comprises a step of constructing a recombinant plasmid pYD1-MCP and a step of constructing a recombinant yeast EBY100 / pYD1-MCP, the oral vaccine of the larimichthys crocea iridovirus vaccine can be prepared, and the oral vaccine has the advantages of being high in protection rate, safe, low in cost, convenient to use and good in application prospect in prevention and control of the larimichthys crocea iridovirus.

Description

Technical Field

[0001] The present invention relates to the field of aquatic animal vaccines, and in particular to a recombinant yeast expressing large yellow croaker iridovirus MCP protein, a preparation method thereof, and application thereof in preparing vaccines. Background Art

[0002] Large yellow croaker ( Larimichthys crocea ) is an important economic fish species in marine aquaculture and occupies an important position in my country's marine aquaculture. However, the yellow croaker iridovirus ( Large yellow croakeriridovirus LYCIV) has caused serious losses to the large yellow croaker aquaculture industry. LYCIV is a double-stranded DNA virus belonging to the genus Cytomegalovirus of the family Iridoviridae. Megalocytivirus The virus can cause explosive deaths in farmed large yellow croaker juveniles, with affected fish showing symptoms of black body color, white gills, and enlarged spleens and kidneys. The mortality rate can be as high as over 50%. Currently, there are no drugs on the market specifically for the prevention and control of LYCIV. The major capsid protein (MCP) is the main capsid protein of LYCIV, located on the icosahedral surface, and its content accounts for over 40% of the total viral protein. MCP contains many highly conserved domains, and the homology of its gene sequence and amino acid sequence makes it a target gene for studying the classification and variation of iridoviruses. It not only plays an important role in the virus's infection process, but is also an important antigen-related protein of LYCIV.

[0003] Yeast surface display technology is a eukaryotic expression system that displays heterologous proteins on the surface of Saccharomyces cerevisiae cells. It is widely used in vaccine development due to its ease of large-scale production, food-grade properties and safety to fish, its potential as an immune adjuvant, and its ability to enhance recognition and binding of displayed proteins. Currently, LYCIV-related diseases are frequent, and no vaccine is commercially available, resulting in significant economic losses for the aquaculture industry. Therefore, developing a safe and effective vaccine against LYCIV is crucial for promoting the healthy development of large yellow croaker aquaculture. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a recombinant yeast expressing MCP protein of large yellow croaker iridovirus with high protection rate and safe, effective and easy to use, as well as its preparation method and application in preparing vaccine The technical solution adopted by the present invention to solve the above technical problems is: a recombinant yeast expressing the MCP protein of large yellow croaker iridovirus, wherein the recombinant yeast is a cerevisiae transformed with the pYD1-MCP recombinant plasmid, named EBY100 / pYD1-MCP, and the pYD1-MCP recombinant plasmid can express the MCP protein in a yeast surface display system, and the nucleotide sequence of the gene fragment of the MCP protein is shown in SEQ ID NO.1.

[0005] Furthermore, the saccharomyces cerevisiae is Saccharomyces cerevisiae EBY100.

[0006] Furthermore, the yeast is linked to the lectin receptor Aga1 subunit, the Aga1 subunit is linked to the pYD1-MCP recombinant plasmid, and the MCP protein is expressed as a C-terminal fusion with the lectin receptor Aga2 subunit. The pYD1-MCP recombinant plasmid can express the MCP protein and the lectin receptor Aga2 subunit as a fusion.

[0007] The present invention also provides a method for preparing the recombinant yeast expressing the large yellow croaker iridovirus MCP protein, comprising the following steps: (1) Construction of recombinant plasmid pYD1-MCP; (2) Construction of recombinant yeast EBY100 / pYD1-MCP.

[0008] Furthermore, step (1) is specifically as follows: primers are designed according to the gene sequence of MCP, and the restriction sites in the upstream primer MCP-F1 and the downstream primer MCP-R1 are Hind III and EcoR I The sequence of the upstream primer MCP-F1 is: 5'-CCCAAGCTTATGTCTGCAATC-3', and the sequence of the downstream primer MCP-R1 is: 5'-CCGGAATTCTGCAGATATCCA-3'; the MCP fragment was amplified using specific primers, and then the enzyme-digested MCP sequence was inserted into the pYD1 vector using T4 DNA ligase to obtain the recombinant plasmid pYD1-MCP.

[0009] Furthermore, step (2) is specifically as follows: transforming the recombinant plasmid pYD1-MCP into EBY100 competent cells, and obtaining the recombinant yeast EBY100 / pYD1-MCP by screening and identifying positive clones.

[0010] The present invention also provides the use of the recombinant yeast expressing the large yellow croaker iridovirus MCP protein in the preparation of a large yellow croaker iridovirus vaccine.

[0011] Furthermore, an oral vaccine was prepared using EBY100 / pYD1-MCP as an active ingredient.

[0012] Furthermore, the vaccine preparation method includes the following steps: spraying the induced EBY100 / pYD1-MCP yeast on the surface of commercial puffed feed for large yellow croaker, and obtaining a feed containing the vaccine that can be directly fed after drying.

[0013] Compared with the prior art, the advantages of the present invention are (1) This invention is the first to use the MCP encoding gene of LYCIV to prepare a viral vaccine.

[0014] (2) The present invention uses yeast surface display technology to express MCP in brewer's yeast and prepares an oral vaccine of LYCIV. The vaccine has high protective effect and the relative protection rate against large yellow croaker reaches 58.3%.

[0015] In summary, the present invention provides a recombinant yeast expressing the MCP protein of large yellow croaker iridovirus, as well as a preparation method and application thereof, for vaccine preparation. This vaccine is a novel vaccine obtained by displaying the MCP protein of large yellow croaker iridovirus on the surface of Saccharomyces cerevisiae using a yeast surface display system, fused with and expressing the major antigenic protein of large yellow croaker iridovirus. This vaccine can be administered orally, boasting high protection rates, safety, low cost, and ease of use, and holds great promise for the prevention and control of large yellow croaker iridovirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The fluorescence microscopy results of recombinant yeast expressing MCP protein are shown in Figure 1, where A is green fluorescence and B is bright field light. Figure 2 is the absorbance value of MCP-specific antibodies in the serum of large yellow croaker induced by oral vaccine; Figure 3 After oral administration of the vaccine IgM and IgT mRNA expression changes of A, head kidney IgM mRNA expression level of spleen. IgM mRNA expression level in the hindgut, C IgM mRNA expression level, D is the head kidney IgT mRNA expression level of spleen IgT mRNA expression level of the hindgut IgT mRNA expression level; Figure 4 The results show the effect of vaccine on the survival rate of large yellow croaker infected with LYCIV. DETAILED DESCRIPTION

[0017] The present invention will be described in further detail below with reference to the accompanying drawings and embodiments.

[0018] The present invention can be more clearly understood with reference to the following examples. Unless otherwise specified, the technical steps described in the present invention are conventional technical means in the art, or are commercial or disclosed reagents and materials.

[0019] Example 1: Construction of recombinant plasmid pYD1-MCP. The steps are as follows:

[0020] Primers were designed upstream and downstream of MCP using Primer Premier 5 software. The nucleotide sequence of the upstream primer MCP-F1 is shown in SEQ ID NO.2: 5'-CCCAAGCTTATGTCTGCAATC-3', and the nucleotide sequence of the downstream primer MCP-R1 is shown in SEQ ID NO.3: 5'-CCGGAATTCTGCAGATATCCA-3'. The restriction enzyme cleavage site is Hind III and EcoR I .

[0021] Step 2, DNA extraction: According to the instructions of the blood tissue / cell genomic DNA extraction kit, genomic DNA was extracted from the head and kidney tissues of large yellow croaker infected with LYCIV.

[0022] Step 3. Amplification of the target gene: Using genomic DNA as a template, MCP was amplified using specific primers MCP-F1 / R1. The amplification system was as follows: 2.0 µL DNA, 2.0 µL upstream primer MCP-F1, 2.0 µL downstream primer MCP-R1, 25.0 µL PrimeSTAR Max Premix (2×), and 19.0 µL ddH2O. The PCR amplification product was purified and recovered to obtain the MCP gene fragment.

[0023] Step 3, Restriction Digestion and Ligation: Use T4 DNA Ligase to insert the digested MCP sequence into the pYD1 vector. The ligation mixture is as follows: 2 µL of 10× ligation buffer, 1 µL of T4 DNA ligase, 1 µL of pYD1 vector DNA, 5 µL of purified PCR product, and 11 µL of sterile water (a total of 20 µL). Ligation is performed overnight at 4°C. The ligation product is then transformed into DH5α competent E. coli cells. Single colonies are identified by PCR and confirmed by sequencing. The resulting recombinant plasmid is named pYD1-MCP.

[0024] Example 2: Construction of recombinant yeast EBY100 / pYD1-MCP. The steps are as follows: Step 1. Use the yeast transformation kit to transform the pYD1-MCP recombinant plasmid into Saccharomyces cerevisiae EBY100: add 200 ng of pYD1-MCP plasmid and 360 μL of transformation buffer to 50 μL of competent cells EBY100, repeatedly pipette and precipitate to completely suspend the yeast cells in the premix; heat shock in a 30°C water bath for 60 min, mixing every 10 min; centrifuge at 12,000 rpm for 15 s, discard the supernatant, add 400 μL of sterile deionized water to resuspend the cells, spread on YNB medium plates containing 0.1 mg / mL leucine, and incubate at 30°C for 2-4 days. Pick single colonies for PCR identification and sequencing, and identify positive transformants as EBY100 / pYD1-MCP.

[0025] Step 2: Induce expression of positive transformants: inoculate EBY100 / pYD1-MCP into YNB-CAA liquid medium containing 2 wt% glucose and culture at 30°C. 600 = 2~5, and the recombinant yeast was collected by centrifugation. The collected yeast pellet was resuspended in YNB-CAA liquid medium containing 2wt% galactose in a clean bench to make the bacterial solution OD 600 Protein expression was induced at 0.5-1°C at 20°C, and the recombinant Saccharomyces cerevisiae induced for 72 h was kept for later use.

[0026] Step 3: Immunofluorescence verification of recombinant yeast expressing MCP protein: Take the induced recombinant cerevisiae yeast sample for immunofluorescence analysis, incubate with mouse anti-6×His monoclonal antibody as the primary antibody for 1 hour, and then incubate with FITC-coupled secondary antibody for 1 hour. After sealing, observe under a fluorescence microscope.

[0027] like Figure 1 China A and Figure 1 Fluorescence microscopy results in Figure B show that yeast cells transformed with the recombinant plasmid exhibit green fluorescence, indicating that the yeast cells transformed with the recombinant plasmid successfully expressed the MCP protein.

[0028] Example 3: Preparation of a vaccine containing EBY100 / pYD1-MCP yeast A large amount of recombinant Saccharomyces cerevisiae containing MCP was induced to express. The induced EBY100 / pYD1-MCP yeast was sprayed on the surface of commercial puffed feed for large yellow croaker. After drying, it can be used for oral feeding of large yellow croaker. Equal amounts of EBY100 / pYD1 and PBS were sprayed as the control group.

[0029] Example 4: Application of Large Yellow Croaker Iridescent Virus Yeast Vaccine in Anti-LYCIV 1. Oral vaccination Large yellow croakers with a size of 7-9 cm were temporarily raised in a recirculating aquaculture system with a water temperature of 24°C. After 14 days, healthy large yellow croakers with no significant difference in body size were randomly selected and divided into three groups (each group contained three parallel groups), namely the EBY100 / pYD1-MCP group, the EBY100 / pYD1 group and the PBS group. The immunization procedure was as follows: the first immunization was continuous feeding for 7 days, and the booster immunization was carried out after an interval of 7 days, and the feeding was continuous feeding for 7 days.

[0030] 2. Specific Antibody Expression Determination Whole blood was collected from the tail vein of the test fish 10, 20, and 30 days after the last immunization. The blood was refrigerated at 4°C overnight and then serum was collected. The absorbance of MCP protein-specific antibodies in the serum of large yellow croaker was measured using an indirect ELISA.

[0031] The results are as follows Figure 2 As shown, the level of MCP-specific antibodies in the serum of the EBY100 / pYD1-MCP group increased in a time-dependent manner compared with the PBS and EBY100 / pYD1 groups, reaching a peak on day 30. No significant differences in antibody levels were found between the PBS and EBY100 / pYD1 groups. These findings suggest that oral administration of EBY100 / pYD1-MCP can induce the production of MCP-specific antibodies.

[0032] 3. Immune-related gene testing The relative expression levels of IgM and IgT-F / R genes were detected by fluorescence quantitative analysis. The nucleotide sequence of IgM-F is shown in SEQ ID NO. 4: CTGTCGCAATGTGGTTCTGG, and the nucleotide sequence of IgM-R is shown in SEQ ID NO. 5: GTTTGTCAAGGCAGTCCCCT; the nucleotide sequence of IgT-F is shown in SEQ ID NO. 6: TTGACATTGAACCAACCAAGTC, and the nucleotide sequence of IgT-R is shown in SEQ ID NO. 7: CTCGGACTTGATTGCTGATTC; the nucleotide sequence of 18S-F is shown in SEQ ID NO. 8: AGAGTTTGATCCTGGCTCAG, and the nucleotide sequence of 18S-R is shown in SEQ ID NO. 9: GGTTACCTTGTTACGACTT.

[0033] 10, 20, and 30 days after the last immunization, the head kidney, spleen, and hindgut tissues were collected and total RNA was extracted using Trizol reagent and converted into cDNA. qPCR reactions were performed on an ABI QuantStudio 3 (ABI) instrument using cDNA as a template according to the instructions of the 2× Taq Pro Universal SYBR Master Mix kit.-ΔΔCT The experimental results were processed and analyzed by using large yellow croaker 18S rRNA The expression levels were normalized to obtain the relative expression levels of each gene.

[0034] IgM and IgT are key components of the adaptive immune response in fish. Figure 3 Middle A, Figure 3 Middle B, Figure 3 Middle C, Figure 3 Middle D, Figure 3 Zhong E and Figure 3 As shown in F, compared with the PBS and EBY100 / pYD1 groups, the EBY100 / pYD1-MCP group IgM and IgT The expression levels were significantly upregulated in the hindgut, liver and spleen. IgM The highest expression level was found in the spleen. IgT The highest expression level was found in the hindgut.

[0035] Step 4: LYCIV attack On the 30th day after the last immunization, 90 large yellow croakers were selected from each experimental group for the challenge test. 50 μL of 1×10 8 100 copies / mL of LYCIV suspension. After the challenge, the fish were observed for 15 consecutive days, and mortality was recorded. The survival rate and relative protection rate (RPS) were calculated using the formula: RPS% = [(control group mortality % - immunized group mortality %) / control group mortality %] × 100%.

[0036] Results showed that large yellow croaker began to die four days after challenge, with mortality rates of 40% in the PBS group, 46.7% in the EBY100 / pYD1 group, and 16.7% in the EBY100 / pYD1-MCP group. The calculated relative protection rate of the oral EBY100 / pYD1-MCP vaccine was 58.3%. This result demonstrates that the yeast oral vaccine constructed in this invention can enhance large yellow croaker's resistance to LYCIV.

[0037] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by persons of ordinary skill in the art within the spirit and scope of the present invention shall also fall within the scope of protection of the present invention.

Claims

1. A recombinant yeast expressing the MCP protein of large yellow croaker iridovirus, characterized by: The recombinant yeast is Saccharomyces cerevisiae transformed with the pYD1-MCP recombinant plasmid, named EBY100 / pYD1-MCP. The pYD1-MCP recombinant plasmid can express MCP protein in a yeast surface display system. The gene sequence of the MCP protein is shown in SEQ ID NO.

1.

2. The recombinant yeast expressing the MCP protein of large yellow croaker iridovirus according to claim 1, characterized in that: The brewer's yeast is Saccharomyces cerevisiae EBY100.

3. The recombinant yeast expressing the MCP protein of large yellow croaker iridovirus according to claim 1, characterized in that: The yeast is connected with the lectin receptor Aga1 subunit, the Aga1 subunit is connected with the pYD1-MCP recombinant plasmid, and the MCP protein is expressed by C-terminal fusion with the lectin receptor Aga2 subunit.

4. A method for preparing a recombinant yeast expressing the MCP protein of large yellow croaker iridovirus according to claim 1, characterized in that The following steps are involved: (1) Construction of recombinant plasmid pYD1-MCP; (2) Construction of recombinant yeast EBY100 / pYD1-MCP.

5. The method for preparing a recombinant yeast expressing the MCP protein of large yellow croaker iridovirus according to claim 4, characterized in that Step (1) is specifically as follows: primers are designed according to the gene sequence of MCP, and the restriction sites in the upstream primer MCP-F1 and the downstream primer MCP-R1 are Hind III and EcoR I The sequence of the upstream primer MCP-F1 is: 5'-CCCAAGCTTATGTCTGCAATC-3', and the sequence of the downstream primer MCP-R1 is: 5'-CCGGAATTCTGCAGATATCCA-3'; the MCP fragment was amplified using specific primers, and then the enzyme-digested MCP sequence was inserted into the pYD1 vector using T4 DNA ligase to obtain the recombinant plasmid pYD1-MCP.

6. The method for preparing a recombinant yeast expressing the MCP protein of large yellow croaker iridovirus according to claim 4, characterized in that Step (2) is specifically as follows: transforming the recombinant plasmid pYD1-MCP into EBY100 competent cells, and obtaining the recombinant yeast EBY100 / pYD1-MCP by screening and identifying positive clones.

7. Use of the recombinant yeast expressing the large yellow croaker iridovirus MCP protein according to claim 1 in the preparation of a large yellow croaker iridovirus vaccine.

8. The use according to claim 7, characterized in that An oral vaccine was prepared using EBY100 / pYD1-MCP as the active ingredient.

9. The use according to claim 7, characterized in that The preparation method of the vaccine comprises the following steps: spraying the induced EBY100 / pYD1-MCP yeast on the surface of commercial puffed feed for large yellow croaker, and obtaining the vaccine-containing feed that can be directly fed after drying.

Images